Occurrence of the Vibrio cholerae Seventh Pandemic VSP-I Island and a New Variant

Abstract

Using comparative genomics, we identified a new variant of the Vibrio Seventh Pandemic Island-I (VSP-I). Results of polymerase chain reaction (PCR) screening for both known VSP-I variants indicate that the novel variant is present only in non-O1/non-O139 strains of V. cholerae and Vibrio mimicus. Comparative genomics revealed little sequence divergence in the seventh pandemic VSP-I; however, a second insertion site located on the smaller chromosome was identified. Although the seventh pandemic VSP-I genomic island was detected in all seventh pandemic V. cholerae serogroup O1 and O139 isolates examined in this study, unique genes of the island cannot be used alone as an identifying target, because the seventh pandemic VSP-I was also present in three non-seventh pandemic strains of V. cholerae isolated from Chesapeake Bay. As an alternative, a PCR assay targeting the VC2346 gene was found to be confirmatory for seventh pandemic isolates of V. cholerae.

Introduction

Vibrio cholerae, an autochthonous aquatic bacterium, is the causative agent of cholera, a severe, watery, life-threatening diarrheal disease. Cholera bacteria are serogrouped based on the variable somatic O antigen, with more than 200 serogroups identified (Chatterjee and Chaudhuri, 2003). Although most of the serogroups of V. cholerae have been associated with mild gastroenteritis or sporadic local outbreaks of diarrhea, only toxigenic strains of serogroups O1 and O139 have been linked to cholera epidemics. V. cholerae serogroup O1 is further divided into two biotypes, Classical and El Tor. The two biotypes are differentiated by a combination of biochemical traits and biotype-specific bacteriophages (Kaper et al., 1995). Genes responsible for cholera toxin, ctxAB, and other virulence factors have been shown to reside in various mobile genetic elements.

The epidemic potential of cholera has been realized throughout human history with seven recorded pandemics and endemism in many developing countries. Isolates from the sixth pandemic were nearly exclusively of the Classical biotype. However, the seventh, and current, pandemic has been dominated by strains of V. cholerae O1 El Tor. All previous pandemics originated in the Indian subcontinent, whereas the seventh pandemic originated on the Indonesian island of Sulawesi, spreading over Asia, Africa, and Latin America. In 1992, a new serogroup, V. cholerae O139, was identified as the cause of cholera outbreaks in India and Bangladesh (Ramamurthy et al., 1993).

Comparative genomic studies using DNA microarrays identified two gene clusters, Vibrio Seventh Pandemic (VSP)-I and -II, associated with seventh pandemic strains and absent in Classical and both pre-seventh pandemic and nontoxigenic, environmental V. cholerae El Tor (Dziejman et al., 2002). VSP-I is a 16-kb region inserted in chromosome I between ORFs VC0174 to VC0186 and comprising 11 genes, VC0175–0185. The G+C content of VSP-I was found to be 40%, compared to 47% for the entire V. cholerae genome, suggesting foreign origin of this region (Dziejman et al., 2002). In support of this hypothesis, Murphy and Boyd (2008) reported that the island can be excised from the chromosome of V. cholerae, but when VSP-I is present, the flanking genes remain intact (Dziejman et al., 2002).

Recently, it has been shown that VSP-I can reside in V. cholerae non-O1/non-O139 (Chatterjee et al., 2009, O'Shea et al., 2004). Here, we report the sequence of a VSP-I variant from a bioluminescent non-O1/non-O139 isolate of V. cholerae, VL426. Polymerase chain reaction (PCR) primers designed to identify seventh pandemic VSP-I and the newly sequenced environmental variant were used to survey clinical and environmental isolates of V. cholerae.

Materials and Methods

Strains and media

V. cholerae strains used for comparative genomics study of VSP-I are listed in Table 1, which included complete and draft genomes. One hundred eighty-eight well-characterized laboratory culture collection strains and 190 V. cholerae isolates from two cholera-endemic regions of Bangladesh were screened for VSP-I. Those giving nonprototypical results are described in the Results section. All were grown in Luria-Bertani medium (Difco, BD, Sparks, MD, USA) and stored at −80°C in LB broth amended with 25% glycerol.

Table 1.

Vibrio cholerae Strains Used for the Comparative Genomics Analysis Conducted in This Study

Strain	Serogroup	Biotype	Geographical origin	Source of isolation	Year of isolation	Accession
N16961	O1 Inaba	El Tor	Bangladesh	Clinical	1975	NC_002505/NC_002506
RC9	O1 Ogawa	El Tor	Kenya	Clinical	1985	ACHX00000000
MJ-1236	O1 Inaba	El Tor	Matlab, Bangladesh	Clinical	1994	CP001485/CP001486
B33	O1 Ogawa	El Tor	Beira, Mozambique	Clinical	2004	ACHZ00000000
MO10	O139		Madras,India	Clinical	1992	AAKF03000000
CIRS101	O1 Inaba	El Tor	Dhaka, Bangladesh	Clinical	2002	ACVW00000000
2740-80	O1 Inaba	El Tor	US Gulf Coast	Water	1980	NZ_AAUT01000000
BX330286	O1 Inaba	El Tor	Australia	Water	1986	ACIA00000000
MAK757	O1 Ogawa	El Tor	Celebes Islands	Clinical	1937	NZ_AAUS00000000
NCTC 8457	O1 Inaba	El Tor	Saudi Arabia	Clinical	1910	NZ_AAWD01000000
O395	O1 Ogawa	classical	India	Clinical	1965	NC_009456/NC_009457
V52	O37		Sudan	Clinical	1968	AAKJ02000000
12129(1)	O1 Inaba	El Tor	Australia	Water	1985	ACFQ01000000
TM 11079-80	O1 Ogawa	El Tor	Brazil	Sewage	1980	ACHW00000000
VL426	non-O1/O139	albensis	Maidstone, Kent, UK	Water	Unknown	ACHV00000000
TMA21	non-O1/O139		Brazil	Seawater	1982	ACHY00000000
1587	O12		Lima, Peru	Clinical	1994	NZ_AAUR01000000
RC385	O135		Chesapeake Bay	Plankton	1998	NZ_AAKH02000000
MZO-2	O14		Bangladesh	Clinical	2001	NZ_AAWF01000000
V51	O141		USA	Clinical	1987	NZ_AAKI02000000
MZO-3	O37		Bangladesh	Clinical	2001	NZ_AAUU01000000
AM-19226	O39		Bangladesh	Clinical	2001	NZ_AATY01000000
623–39	non-O1/O139		Bangladesh	Water	2002	NZ_AAWG00000000

Comparative genomics

Genome to genome comparison was performed using three different approaches, because completeness and quality of nucleotide sequences varied strain to strain. First, nucleotide sequences, as whole contigs, were directly aligned using the Mummer (Kurtz et al., 2004). Second, ORFs of a given pair of genomes were identified and reciprocally compared with each other, using BLASTN (comparison based on ORF). Third, a bioinformatic pipeline was developed to identify homologous regions of a given ORF. Initially, homologous regions of ORFs of completely sequenced chromosomes, or high quality contigs, were identified using BLASTN. The potentially homologous region was expanded in both directions by 2,000 bp each. The query ORF sequence and target homologous region were aligned, using global pairwise alignment (Myers and Miller, 1988), and the resultant matched regions were extracted and saved as homologs (comparison based on similarity). Orthologs and paralogs were differentiated by reciprocal comparison. In most cases, comparisons based on ORF and similarity yielded the same orthologs, but the similarity-based comparison performed better for draft sequences of low quality, in which sequencing errors, albeit rare, hampered identification of correct ORFs. For ease and clarity, VSP-I genes are primarily referred to by their V. cholerae O1 El Tor N16961 locus tags VC#### on large chromosome and VCA#### for those on the smaller chromosome. Genes of V. cholerae O1 MJ-1236 are indicated by the notation VCD_ ######, and those of V. cholerae non-O1/non-O139 VL426 by the notation VCA_ ######.

Primer design

Conserved and group-specific regions of VSP-I were identified by examining aligned and unaligned sequences using ClustalX2 software (Larkin et al., 2007). PCR primers for group-specific targets and testing chromosomal insertion were designed using FastPCR Molecular Biology Software (Kalendar, 2009) and are listed in Table 2.

Table 2.

Polymerase Chain Reaction Primers Used in This Study

Primer	Sequence	Target	Annealing Temp (°C)	Amplicon size (bp)
dcd-820F	gcttattcagcagccctcaggtc	VC0175	65	584
dcd-1403R	tagcgtcgagatgacacaccttcg
VSPI-F	gccgagaactctaaagcgcttctc	VC0180-0181	61	331
VSPI-R	ccaaggtacagatgagtaccagca
smp-F	gcaactgtgctagcagttgccgtg	VC2346	65	405
smp-R	gcctgtttcaaacgtgatgcgta
VC0174-F	aaactggcgacctttgagcaagc	Chromosome I insertion site	65	1321
VC0186-R	gatggtagcctgacgctgcatctg
VCA0695-F	atagcgggagttggctctgca	Chromosome II insertion site	65	957
VCA0697-R	ggtgacttggtgcccatcgta

PCR analysis

PCR, using primers designed in this study, was used to screen 378 isolates of V. cholerae for presence of the two VSP-I targets, a seventh pandemic group-specific marker, VC2346, annotated as “SMP-like protein,” and chromosomal insertion in both chromosomes.

Results

Seventh Pandemic VSP-I island

Consistent with previous studies, seventh pandemic V. cholerae O1 El Tor N16961, MJ-1236, B33, RC9, and CIRS101, and V. cholerae O139 MO10 contained VSP-I inserted between genes VC0174 and VC0186 (Fig. 1). Interestingly, V. cholerae O1 MJ-1236 harbored a second copy of VSP-I that was inserted between genes VCA0095 and VCA0096 (MJ-1236 genes VCD_000620 and _000630) on the smaller chromosome. This second copy of the seventh pandemic VSP-I includes MJ-1236 genes VCD_000621 to VCD_000629. When the nucleotide sequence of the VSP-I islands of V. cholerae O1 El Tor N16961 and V. cholerae O1 MJ-1236 was compared, there were only three nucleotide differences found between the islands (Table 3). Differences in the number of genes from the canonical VSP-I of V. cholerae O1 El Tor N16961 and V. cholerae O1 MJ-1236 are simply due to differences between the gene finding and annotation protocols used for each genome. Among all seventh pandemic strains analyzed in this study, there was very little sequence divergence with regard to VSP-I, with three single nucleotide polymorphisms (SNPs) and two single nucleotide gaps present (Table 3).

FIG. 1.

Schematic representation of the seventh pandemic VSP-I and VL426 variant. Flanking genes are indicated by their O1 El Tor N16961 VC locus. VSP-I island genes are indicated by their annotated function. Genes outlined with dashed lines indicate those not present in deposited annotation in GenBank, but which were found by sequence comparison with that of V. cholerae O1 El Tor N16961. TR, transcriptional regulator; RR, response regulator; Hyp, hyptothetical protein; PInt, phage integrase; Tnp, transposase (see Table 3 for more details).

Table 3.

Nucleotide–Nucleotide Comparison between Seventh Pandemic VSP-I Islands and the New Variant, Including Flanking Genes

VC locus	Annotation	N16961, RC9	MO10	B33, MJ-1236 chr1	CIRS101	MJ-1236 chr2	VL426
VC0174	Hypothetical, flanking gene	948(+)	948(+)	948(+)	948(+)	VCA0695, SH3 domain protein, 657 nt	948(+); 36 SNPs
Intergenic	N/A	252	252	252	252	153 (139, 3′)	256 (149, 5′, with 17 SNPs)
VC0175	deoxycytidylate deaminase-related protein	1,599(−)	1,599(−)	1,599(−)	1,599(−)	1,599(−)	5397 nt; highly divergent area
Intergenic	N/A	508	508	508	508	508
VC0176	Putative transcriptional regulator	309(−)	309(−)	309(−)	309(−)	309(−)	221; 34 SNPs
Intergenic	N/A	102	102	102	102	102	102; 13 SNPs
VC0177	Response regulator	564(+)	564(+)	564(+)	564(+)	564(+); C → A, nt 115(+)	81; 14 SNPs
Intergenic	N/A	913	913	913	913; missing T at nt 492	913	1760 nt; highly divergent area
VC0178	patatin-related protein	1,068(+)	1,068(+)	1,068(+)	1,068(+)	1,068(+)	1068(+); 122 SNPs
Intergenic	N/A	13	13	13	13	13	13
VC0179	hypothetical	1,311(+)	1,311(+)	1,311(+)	1,311(+)	1,311(+)	1311(+); 9 SNPs
Intergenic	N/A	2	2	2	2	2	2
VC0180	hypothetical	1,755(+)	1,755(+)	1,755(+); C → T, nt 1,004(+)	1,755(+); C → T, nt 1,004(+)	1,755(+); C → T, nt 1,004(+)	1,755(+); 3 SNPs
Intergenic	N/A	−10	−10	−10	−10	−10	−10
VC0181	hypothetical	471(+)	471(+)	471(+)	471(+)	471(+)	471(+); 1 SNP
Intergenic	N/A	10	10	10	10	10	10
VC0182	hypothetical	432(−)	432(−)	432(−)	432(−)	432(−)	432(−); 1 SNP
Intergenic	N/A	−28	−28	−28	−28	−28	−28
VC0183	Phage Integrase	2,112(−)	2,112(−)	2,112(−)	2,112(−)	2,112(−)	1678; 518 aligned, with 45 SNPs
Intergenic	N/A	9	9	9	9	9	9
VC0184	hypothetical	1,689(−)	1,689(−); C → T, nt 708(−)	1,689(−)	1,689(−)	1,689(−)	1608; 1592 aligned with 78 SNPs
Intergenic	N/A	−3	−3	−3	−3	−3	−3
VC0185	Putative transposase	1,215(−)	1,215(−)	1,215(−)	1,215(−)	1,215(−); Missing T at nt 912(−)	1,215(−); 163 SNPs
Intergenic	N/A	76	76	76	76	207	76; 3 SNPs
VC0186	Glutathione reductase, flanking gene	1,353(−)	1,353(−)	1,353(−)	1,353(−)	VCA0696, hyptothetical, 111 nt	1,353(−); 26 SNPs

For ease and clarity, VSP-I genes are referred to by their V. cholerae O1 El Tor N16961 locus tags. Shaded regions indicate areas of sequence divergence, with darker shading indicating highest sequence divergence.

SNP, single nucleotide polymorphism.

Identification of the VSP-I variant

Comparative genomics using 23 complete and draft genomes of V. cholerae, revealed a 17,328-bp genomic island, encompassing VCA_002467 to VCA_002478, present in the genome of strain V. cholerae non-O1/non-O139 VL426 that was similar to the seventh pandemic VSP-I and inserted in the same position on chromosome 1 (Fig. 1). From the comparison of annotated VSP-I islands of the seventh pandemic group and VL426, it is concluded that homologues of 9 of the 11 genes of the seventh pandemic VSP-I are present in VL426 variant VSP-I, and that the other genes have been disrupted by insertion of transposons in two regions (Fig. 1 and Table 3). Because of these insertions, this variant is 3 kb larger than the seventh pandemic VSP-I. Nucleotide–nucleotide alignment revealed a highly conserved region between the two VSP-I variants spanning genes VC0179 to VC0182, including the 3′ 119 nt of gene VC0178, 5′ 518 nt of gene VC0183, and intergenic regions (Table 3). Two less similar conserved regions, one that includes 949 nt of gene VC0182 and the other which covers gene VC0185 and most (94%) of gene VC0184, were also identified (Table 3). Within the larger region of sequence divergence (Table 3), a small span of homologous sequence was identified that includes part of genes VC0176 and VC0177 and the 102 nt intergenic region. The two regions of the VL426 variant of VSP-I showing sequence divergence have G+C% of 38.9 and 45.2% for the large and small regions, respectively, different from the seventh pandemic island (36.8 and 37.3% for those regions).

VSP-I PCR screen

To determine the distribution of VSP-I variants within V. cholerae, two PCR primer pairs were designed (Table 2). The first target, spanning genes VC0180 to 0181, within the highly conserved four hypothetical protein-coding gene region, was used to identify strains containing any variant of VSP-I. The second target, gene VC0175, was used to identify the seventh pandemic variant of VSP-I. Absence of an amplicon from the VC0175 PCR primers but presence of an amplicon of the correct size for VC0180-0181 suggested there was another variant of VSP-I, perhaps similar to that inserted in the genome of VL426. A third primer pair, using gene VC2346 as the target, was designed to confirm whether an isolate was a seventh pandemic isolate (Table 2). This gene is a component of the genomic backbone of V. cholerae; that is, it is not part of a genomic island, and it contains stretches of parsimony informative sites that were used to design a seventh pandemic group specific PCR assay (Chun et al., 2009). In total, 378 isolates of V. cholerae were screened for VSP-I (Table 4).

Table 4.

Results of Polymerase Chain Reaction Screening for VSP-I

Strain group	Total	VC0180-0181	VCO175	VC2346	Chr 1	Chr 2
Laboratory culture collection	188
V. cholerae O1 Classical	8	0	0	0	0	0
V. cholerae O1 El Tor, seventh pandemic	31	31	31	31	31	1
V. cholerae O1 El Tor, pre-seventh pandemic	3	0	0	0	0	0
V. cholerae O1, environmental	23	1	1	0	0	0
V. cholerae O139	17	16	16	16	16	1
V. cholerae non-O1/non-O139	91	5	2	0	32	12
V. mimicus	15	2	0	0
Bangladesh isolates	190
V. cholerae O1, clinical	101	100	100	100	100	4
V. cholerae O1, environmental	17	16	16	16	17	0
V. cholerae O139, clinical	10	10	10	10	10	1
V. cholerae O139, environmental	15	15	15	15	15	0
V. cholerae non-O1/non-O139	47	0	0	0	13	4

Target VC0180-0181 is a conserved region found in both variants of VSP-I, while VC0175 is unique to the seventh pandemic group VSP-I. Gene VC2346 is unique to the seventh pandemic V. cholerae. Chromosomal insertion sites are designated as Chr 1 and Chr 2.

Among the 188 strains from our laboratory culture collection examined (Table 4), V. cholerae serogroup O1 Classical and pre-seventh pandemic V. cholerae O1 El Tor were negative for the three primer pairs, as expected. Similarly, all clinical V. cholerae O1 El Tor strains isolated during the current pandemic were positive for all three primer pairs. Among the V. cholerae O139, all of the 18 clinical isolates were positive for the three primer pairs, whereas the single environmental isolate was negative for all three. The serotype of this strain was confirmed by O1/O139 wb* PCR and agglutination with O139 antisera (data not shown). Among the 23 environmental V. cholerae O1 isolates, all were negative for all three primers, except V. cholerae V-69, an isolate from a water sample collected off North Point State Park near Baltimore, MD, in the Chesapeake Bay, USA (Colwell et al., 1981), which was positive for both VSP-I primer pairs, but negative for the seventh pandemic marker, VC2346. Environmental V. cholerae O1 strains lacking VSP-I included three U.S. Gulf coast isolates, six isolates from Bangladesh, three isolates from Mexico, three isolates from Brazil, and single isolates from Chile, Australia, Thailand, and Japan. V. cholerae non-O1/non-O139 isolates were negative for the three primer pairs, except for five strains, three of which gave a positive signal for VC0180-0181. These were V. cholerae VL426 and ATCC14547, both biovar albensis (Spencer, 1955) and V. cholerae RC341; all three strains are bioluminescent. Interestingly, V. cholerae V-5 and V-63 gave positive signals for both VSP-I targets, indicating presence of the seventh pandemic VSP-I. V. cholerae V-5 is a serogroup O37 strain isolated from Jones Fall, MD, in 1976, and V. cholerae V-63 is also an O37 serogroup, isolated from Hawkins Point, MD, in 1977. Two V. mimicus, both isolated from water samples collected near the Louisiana coast, were positive for VC0180-0181.

All clinical V. cholerae O1 and O139 from Bangladesh were positive for the three primer pairs, except for one isolate, an O1 El Tor Ogawa strain isolated in 2004. This strain was also negative for ctxA by PCR (data not shown). Sixteen of 17 environmental V. cholerae O1 from Bangladesh were positive for all three primer pairs. The single environmental V. cholerae O1 isolate that was negative for VSP-I primers was also negative for ctxA by PCR (data not shown). All 15 environmental V. cholerae O139 from Bangladesh were positive for the three primer pairs and all 47 V. cholerae non-O1/non-O139 were negative for the three primer pairs.

Chromosomal insertion

Because V. cholerae O1 El Tor MJ-1236 gave evidence of integration of VSP-I into both chromosomes, all isolates were screened by PCR (Table 2) to determine if an island was present at the two insertion sites, between VC0174 and VC0186 on chromosome 1 and between VCA0695 and VCA0696 on chromosome 2, suggested by the failure to produce an amplicon. The seventh pandemic VSP-I was inserted into the chromosome 1 site in 99.5% (189/190) of the cases. In addition, it was inserted into chromosome 2 at a frequency of 3.7% (7/190), but only in strains that had the island also present on chromosome 1 as well. This included V. cholerae O1 MJ-1236, and one O139 and five O1 El Tor clinical isolates from Bangladesh. For the three strains from Chesapeake Bay that harbored the seventh pandemic VSP-I, V. cholerae V-5 and V-63 had VSP-I inserted in chromosome 1, whereas that of V. cholerae V-69 was inserted in an unidentified alternate site. All VL426-like VSP-I islands in V. cholerae were inserted into the typical chromosome 1 insertion site. None of the strains had VSP-I inserted only into chromosome 2. Interestingly, among V. cholerae non-O1/non-O139, 30% (40/133) had an island other than VSP-I in the typical VSP-I chromosome 1 insertion site, with 15 also having an insert in the VSP-I chromosome 2 insertion site. One strain, from Bangladesh, revealed only a chromosome 2 insert, which was not VSP-I.

Discussion

Analysis of the genomes of six seventh pandemic isolates of V. cholerae yielded two very interesting results. First, V. cholerae O1 MJ-1236 was found to contain a second copy of VSP-I, located on the smaller chromosome. None of the other 22 genomes analyzed in this study revealed an insert at that chromosomal location. Second, a SNP, located in gene VC0180, appears to be held in common among the three most recently isolated seventh pandemic strains, V. cholerae B33, CIRS101, and MJ-1236, which are altered or hybrid O1 El Tor strains (Table 3).

V. cholerae strains assayed for VSP-I using the two PCR primer pairs developed in this study gave expected results, for example, the seventh pandemic clinical isolates of V. cholerae O1 El Tor and O139 were positive for both VSP-I primer pairs and positive when tested with the seventh pandemic group-specific PCR, whereas V. cholerae O1 Classical, pre-seventh pandemic V. cholerae O1 El Tor, and most of the V. cholerae non-O1/non-O139 and V. mimicus were negative for both VSP-I PCR primer pairs and VC2346 primers.

In addition to V. cholerae VL426, five V. cholerae and V. mimicus strains contained a VSP-I variant different from the seventh pandemic VSP-I. These included V. cholerae ATCC14547, type strain of biovar albensis, and a luminescent V. cholerae non-O1/non-O139 isolate from Chesapeake Bay, MD, RC341. To confirm the assumption that the single PCR targeting VC0180-0181 indicated presence of a genomic island similar to VSP-I, PCR was used to amplify the region between genes VC0174 and VC0186 of V. cholerae RC341. An approximately 22-kb island was found (unpublished data), which is significantly larger than the seventh pandemic VSP-I and the V. cholerae VL426 variant (Fig. 1). Thus, it is concluded that there are additional variants of VSP-I among environmental isolates of V. cholerae and V. mimicus.

V. cholerae V-3, V-63, and V-69, isolated from the Chesapeake Bay, MD, contained the seventh pandemic VSP-I island, because they were positive when tested with both VSP-I PCR primer pairs. This is a surprising finding, given that environmental V. cholerae non-O1/non-O139 isolates from cholera endemic areas that were screened did not have the seventh pandemic VSP-I island. V. cholerae V-69 is an non-seventh pandemic O1 Inaba isolate and V. cholerae V-3 and V-63 are O37 serogroup, and it is unclear why they would possess this otherwise seventh pandemic specific genomic island. These strains warrant further investigation.

In contrast to the V. cholerae O1 and O139 environmental isolates held in our laboratory culture collection, which were screened by PCR, most of the recent environmental V. cholerae O1 and O139 isolates from Bangladesh contained a seventh pandemic VSP-I island, indicating a degree of relatedness to clinical V. cholerae O1 and O139 isolates. Ninety-four percent (16/17) and 100% (15/15) of recent environmental V. cholerae O1 and O139 isolated in Bangladesh were seventh pandemic and contained the seventh pandemic VSP-I island. Most of these strains were isolated at typical epidemic periods during the year, except five isolates. One was isolated in late July 2004, exactly midway between a strong Spring epidemic (April–May) and a much smaller Fall outbreak (late November) of cholera, while the remaining four were isolated in late September, two months prior to the Fall outbreak that same year.

VSP-I chromosomal insertion sites

In addition to the seven strains, shown in Table 1, with a VSP-I variant at the insertion site, VC0174-0186, on the large chromosome, three others had alternate genomic islands. V. cholerae 623-39 contains an insert for which one gene was identified and annotated as “Chromosome segregation ATPase” (NZ_AAWG01000125, nt 8300 to 7857). Similarily, V. cholerae RC385 also contained a small genomic island at the chromosome I insertion site, approximately 3.7 kb in size, with a single 1,536-bp annotated gene, “deoxycytidylate deaminase-related protein.” This gene had low sequence similarity, 67%, with gene VC0175 of V. cholerae O1 El Tor N16961, although the annotation is similar. V. cholerae MZO-3 contained a putative prophage at the insertion site on the large chromosome.

In addition to V. cholerae MJ-1236, several V. cholerae had VSP-I or another genomic island inserted into both chromosomes. Six clinical seventh pandemic V. cholerae O1 and O139 isolates had VSP-I inserted into both chromosomes and several V. cholerae non-O1/non-O139 contained an insert in both chromosomes. Even though the chromosomal insertion PCR primers were designed using all of the 23 strains listed in Table 1, it is possible that sequence divergence was present in the areas the PCR primers were designed or genomic rearrangements were present. For example, all 15 isolates of V. mimicus were screened for genomic islands at the typical chromosomal insertion sites. Thirteen failed to reveal an amplicon for both chromosomal sites, whereas one had an insert only in chromosome 1 and another had no inserts at these locations. By examining the arrangement and nucleotide sequence of two of these strains for the four VSP-I flanking genes (Table 3), we found that homologues of the flanking genes were present in the same orientation on chromosome 1 but not on chromosome 2. However, one of the flanking genes on chromosome 1 was only 80% similar to that of V. cholerae (unpublished data).

Conclusions

In conclusion, although all seventh pandemic V. cholerae O1 El Tor and O139 of clinical origin contained the seventh pandemic VSP-I, the island is not exclusive to this group, evidenced by its presence in the three Chesapeake Bay isolates. A variant of this island was found, using comparative genomics, in the genome of V. cholerae VL426, although the distribution of this variant was limited to only five strains in this study, but included V. mimicus. In addition, a second insertion site of VSP-I was found on the small chromosome and genomic and PCR data indicate that other elements can insert into the genome at these two sites.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Chatterjee

S.N.

, Chaudhuri

2003. Lipopolysaccharides of Vibrio cholerae. I. Physical and chemical characterization. Biochim Biophys Acta, 1639:65–79.

Chatterjee

, Ghosh

, Raychoudhuri

, Chowdhury

, Bhattacharya

M.K.

, Mukhopadhyay

A.K.

et al. 2009. Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J Clin Microbiol, 47:1087–1095.

Chun

, Grim

C.J.

, Hasan

N.A.

, Lee

J.H.

, Choi

S.Y.

, Haley

B.J.

et al. 2009. Comparative genomics reveals mechanism for short-term and long-term clonal transitions in pandemic Vibrio cholerae. Proc Natl Acad Sci USA[Epub ahead of print].

Colwell

R.R.

, Seidler

R.J.

, Kaper

, Joseph

S.W.

, Garges

, Lockman

et al. 1981. Occurrence of Vibrio cholerae serotype O1 in Maryland and Louisiana estuaries. Appl Environ Microbiol, 41:555–558.

Dziejman

, Balon

, Boyd

, Fraser

C.M.

, Heidelberg

J.F.

, Mekalanos

J.J.

2002. Comparative genomic analysis of Vibrio cholerae: genes that correlate with cholera endemic and pandemic disease. Proc Natl Acad Sci USA, 99:1556–1561.

Kalendar

, Lee

, Schulman

A.H.

2009. Fast PCR software for PCR primer and probe design and repeat search. Genes, Genomes and Genomics, 3,1.

Kaper

J.B.

, Morris

J.G.

Jr. , Levine

M.M.

1995. Cholera. Clin Microbiol Rev, 8:48–86.

Kurtz

, Phillippy

, Delcher

A.L.

, Smoot

, Shumway

, Antonescu

et al. 2004. Versatile and open software for comparing large genomes. Genome Biol, 5:R12.

Larkin

M.A.

, Blackshields

, Brown

N.P.

, Chenna

, McGettigan

P.A.

, McWilliam

et al. 2007. Clustal W and Clustal X version 2.0. Bioinformatics, 23:2947–2948.

10.

Murphy

R.A.

, Boyd

E.F.

2008. Three pathogenicity islands of Vibrio cholerae can excise from the chromosome and form circular intermediates. J Bacteriol, 190:636–647.

11.

Myers

E.W.

, Miller

1988. Optimal alignments in linear space. Comput Appl Biosci, 4:11–17.

12.

O'Shea

Y.A.

, Reen

F.J.

, Quirke

A.M.

, Boyd

E.F.

2004. Evolutionary genetic analysis of the emergence of epidemic Vibrio cholerae isolates on the basis of comparative nucleotide sequence analysis and multilocus virulence gene profiles. J Clin Microbiol, 42:4657–4671.

13.

Ramamurthy

, Bag

P.K.

, Pal

, Bhattacharya

S.K.

, Bhattacharya

M.K.

, Shimada

et al. 1993. Virulence patterns of Vibrio cholerae non-O1 strains isolated from hospitalised patients with acute diarrhoea in Calcutta, India. J Med Microbiol, 39:310–317.

14.

Spencer

1955. The taxonomy of certain luminous bacteria. J Gen Microbiol, 13:111–118.