Role of E2F1 / SPHK1 and HSP27 During Irradiation in a PMA-Induced Inflammatory Model

Abstract

Background:

Sphingosine kinase 1 (SPHK1) and heat shock protein 27 (HSP27) are important for antioxidant and anti-inflammatory effects after red light irradiation in an inflammatory model.

Objective:

The purpose of the present study was to evaluate whether SPHK1 and HSP27 work independently or are dependent on some other regulator after 625 nm light-emitting diode irradiation in the human keratinocyte (HaCaT) cell line.

Methods:

Differentially expressed genes (DEGs) were identified between groups with or without 625 nm photobiomodulation (PBM) in the inflammatory model. Potential transcription factors (TFs) of key DEGs were predicted using the iRegulon plugin. The mechanism was investigated by analyzing mRNA and protein expression levels, prostaglandin E2 levels, and intracellular reactive oxygen species (ROS) in phorbol 12-myristate 13-acetate (PMA)-induced HaCaT cells after 625 nm PBM.

Results:

A total of 6 TFs (e.g., E2F1) and 51 key DEGs (e.g., SPHK1) were identified after 625 nm PBM in PMA-stimulated HaCaT cells. E2F1 worked as a regulator of SPHK1; however, it did not affect HSP27. E2F1 knockdown drastically decreased the SPHK1 expression level and increased the intracellular ROS, as well as the expression levels of inflammation-related proteins in PMA-induced HaCaT cells. In addition, the inhibition of HSP27 decreased the anti-inflammatory effect of 625 nm PBM.

Conclusions:

E2F1 worked as a TF of SPHK1 and exhibited anti-inflammatory and antioxidative effects through SPHK1 in PMA-induced HaCaT cells after 625 nm PBM. HSP27 is essential for the 625 nm PBM-induced anti-inflammatory function. Therefore, E2F1/SPHK1 and HSP27 could be used as potential biomarkers for anti-inflammatory therapy with 625 nm PBM.

Introduction

Photobiomodulation (PBM) has been widely accepted as a therapeutic modality for the treatment of skin inflammatory disorders, acne, wound healing, and pain control.¹ Red light PBM can be used in inflammatory and auto-immune diseases,^2,3 precancerous and cancerous lesions,^4,5 hair loss,^6,7 and anti-aging.^8,9 In particular, red light has revealed its efficacy for the treatment of acne vulgaris, rosacea, and psoriasis in clinical applications.¹⁰ Our previous study reported that red light PBM inhibits prostaglandin E2 (PGE₂) production and COX-1/2 expression. However, the signaling pathway of PBM at a cellular level remains unclear, and the biomarker to assess the effects of PBM must be determined.

Previous studies have also indicated the possibility of sphingosine kinase 1 (SPHK1)/NF-κB pathway and small heat shock protein 27 (HSP27) being responsible for the anti-oxidant and anti-inflammatory effects of 625 nm PBM.^11,12 However, the detailed molecular mechanisms still need to be elucidated. In addition, there might exist a master regulator that affects both SPHK1 and HSP27 in PBM, and this aspect needs to be investigated further.

Both SPHK1 and HSP27 could be key molecules in evaluating the therapeutic effects of 625 nm PBM. Thus, the first objective of the present study was to determine whether these genes worked independently or not. The second objective was to determine the upstream regulator of SPHK1 and HSP27 to clarify the underlying mechanism of red PBM in phorbol 12-myristate 13-acetate (PMA)-induced human keratinocyte (HaCaT) cells.

According to the microarray profiling data in our previous study,¹¹ 113 genes were upregulated under the influence of 625 nm PBM. To further identify differentially expressed genes (DEGs) and transcription factors (TFs), we comprehensively reanalyzed the gene expression profiling. Among the predicted TFs, E2F1 showed a strong link with SPHK1. Silencing E2F1 drastically decreased the SPHK1 expression level using 625 nm PBM. Six hundred and twenty-five nanometer PBM lost its anti-inflammation effect without HSP27 as well. Therefore, E2F1/SPHK1 and HSP27 might be useful as biomarkers for the prognosis of light-emitting diode (LED) irradiation.

Materials and Methods

Cell culture and chemicals

The immortalized human keratinocyte cell line, HaCaT, was purchased from AddexBio (Catalog Number: T0020001, San Diego, CA) and cultured in Dulbecco's Modified Eagle's Medium (Welgene, Korea) containing 10% heat-inactivated fetal bovine serum (Atlas Biologicals, Korea) and 100 units/mL of penicillin–streptomycin (Welgene) at 37°C in a humid atmosphere of 5% CO₂. HaCaT cells were seeded at 1 × 10⁴ cell/well in six-well plates and grown at 37°C for 24 h. The cells were treated with 12 ng/μL of PMA for 3 h and subsequently photobiomodulated by LED for 1 h¹¹ (Supplementary Fig. S1). PMA (Sigma); N-acetyl-L-cysteine (NAC; Sigma); 2′, 7′-dichlorodihydrofluorescein diacetate (H₂DCF-DA; Sigma); SYBR Green PCR Master Mix (Applied Biosystems; Warrington, United Kingdom); and complementary DNA (cDNA) Synthesis Kit were purchased from iNtRON Biotechnology (Korea).

Photobiomodulation

A continuous-wave LED irradiation system (U-JIN LED CO., LTD, Goyang, Korea) was used. The parameters used are as follows: power density: 3 mW/cm²; wavelength: 625 nm; total energy: 10.8 J; and duration of treatment: 3600 sec. The distance between cell culture medium and the light source was about 25 mm. The parameters and schematic of the PBM are shown in Table 1 and Supplementary Fig. S2.

Table 1.

Parameters Involved in the Study

Manufacturer	U-JIN LED CO.
Model identifier	KNCPOWERLED6
Year produced	2012
Number and type of emitters (laser or LED)	1, LED
Wavelength and bandwidth (nm)	625 ± 10
Pulse mode (CW or Hz, duty cycle)	CW
Beam spot size at target (cm²)	78.5
Irradiance at target (mW/cm²)	3
If pulsed peak irradiance (mW/cm²)	—
Exposure duration (sec)	3600
Radiant exposure (J/cm²)	0.14
Radiant energy (J)	10.8
Number of points irradiated	1
Area irradiated (cm²)	78.5
Application technique	Photobiomodulation
Number and frequency of treatment sessions	1
Total radiant energy over entire treatment course (J)	10.8
Geographical location	Korea

CW, continuous wave; LED, light-emitting diode.

Microarray and data analysis

HaCaT cells were stimulated with 12 ng/μL PMA for 3 h (PMA group), or irradiated by 625 nm PBM for 1 h (R60 group), or stimulated using PMA for 3 h and then irradiated by 625 nm PBM for 1 h (PR60 group). The treatment method and parameters were described in PBM part. The DEGs between PMA group and PR60 group were identified. t-test method was used to calculate the p-value for expression difference. Only the DEGs with p-value <0.05 and Fold change ≥1.5 were defined as candidate DEGs. Total RNA from untreated cells was used as control.

Bioinformatic analyses of associated genes and TFs

To further identify upregulated DEGs (Fold change ≥1.5) and TFs associated with the 625 nm PBM treated inflammatory in vitro model, the plugin iRegulon (v1.3) in Cytoscape was used. The iRegulon Cytoscape plugin is available through the Cytoscape App Store¹³ and can be downloaded from http://iregulon.aertslab.org/. Normalized enrichment score (NES) was considered as parameter for the analysis. The NES value allows the comparison of analysis results across gene sets because it considers differences in gene set sizes corrected by the size of the expression dataset.¹⁴ A high NES (≥3.0) indicates a motif that recovers a large proportion of the input genes within the top of its ranking.¹⁵ The larger the NES for the output, the more reliable the regulatory association.¹⁶ In the present study, NES >4 was utilized for subsequent identification of the corresponding TFs and construction of the regulatory network visualized by Cytoscape.

RNA isolation and real-time polymerase chain reaction

Total RNA was extracted from cells using RNAiso Plus reagent (Takara Bio, Japan), and first-strand cDNA was synthesized from 1 μg of total RNA using the Maxime RT PreMix (Random primer) Kit (iNtRON Biotechnology). cDNA samples were amplified and analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) using a Power SYBR Green PCR Master Mix (Applied Biosystems) and the Applied Biosystems StepOnePlus™ Real-Time PCR System. The expression of E2F1, SPHK1, CUX1, RFXANK, TBP, TGIF2LY, and SIN3A was quantified by RT-PCR using an ABI Real-Time PCR System (Applied Biosystems, United States) under standard qRT-PCR conditions. A 1:10 dilution is used to create a standard curve with at least five points. After getting the slope of the regression between the log values and the average Ct values, primer efficiency was calculated using the equation below¹⁷: Efficiency = [10^(−1/slope)] − 1. The PCRs were performed in triplicate, and the calculation of relative expression of each mRNA was based on the 2^−ΔΔCT method with normalization to the housekeeping gene GAPDH. The primer sequences used in the present study are presented in Table 2.

Table 2.

Real-Time Polymerase Chain Reaction Primer Sequences, Product Size, and Gene Function

Target gene	5′-3′ sequence (forward/reverse)	Product size	Function
E2F1	TGCCACCATAGTGTCACCAC/	89	Transcription factor; nucleic acid binding
E2F1	GTTCTTGCTCCAGGCTGAGT	89	Transcription factor; nucleic acid binding
SPHK1	ATGCTGGCTATGAGCAGGTC/	94	Sphingolipid metabolism
SPHK1	GACAGCAGGTTCATGGGTGA	94	Sphingolipid metabolism
CUX1	AGAGGTGGCTCAGAGAGAGG/CAGCTGGAGGGAGTGATTGG	70	Transcription factor involved in the control of neuronal differentiation in the brain
RFXANK	TGATTGGAATGGAGGGACGC/	61	Activates transcription from class II MHC promoters
RFXANK	AACGCATTTCACGTGGTTCC	61	Activates transcription from class II MHC promoters
TBP	TGGGGAGCTGTGATGTGAAG/	61	General transcription factor
TBP	TGTTGGTGGGTGAGCACAAG	61	General transcription factor
TGIF2LY	AACAGCGTAGAAACGACCCC/	60	May have a transcription role in testis
TGIF2LY	GGGTGGCATGGGCATCTTT	60	May have a transcription role in testis
SIN3A	CAGAGCGCTGGTCAGACTAC/	72	Transcriptional repressor
SIN3A	GATGTTCACGAAGCTCAGGC	72	Transcriptional repressor
GAPDH	ACCACCAACTGCTTAGCACC/	87	Housekeeping gene (Loading control)
GAPDH	GATGGCATGGACTGTGGTCA	87	Housekeeping gene (Loading control)

Western blotting

After red light irradiation, cells were kept for 6 h and then harvested for Western blotting analysis. Cells were lysed in cold lysis buffer (1% NP-40, 50mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.02% sodium azide, 150 mg/mL phenylmethylsulfonyl fluoride) containing protease inhibitor cocktail. The whole-cell lysates were separated by sodium dodecyl sulfate–polyacrylamide gel and transferred to polyvinylidene difluoride membranes (Millipore) followed by being blocked with 5% milk-TBS buffer at 25°C for 1 h. After being blocked, the membranes were incubated with primary antibodies at 4°C overnight. After being washed with TBST, the membranes were incubated with secondary antibodies for 2 h at 25°C and detected using the Chemiluminescence Detection Kit (GE Healthcare, Little Chalfont, United Kingdom). Primary antibodies for p-NF-κBp65, NF-κBp65, and p-HSP27 were purchased from Cell Signaling Technology. Antibodies for E2F1, SPHK1, SPHK2, HSP27, and GAPDH were obtained from Santa Cruz Biotechnology. The secondary antibodies used were anti-rabbit IgG, anti-mouse IgG, and anti-goat IgG (Santa Cruz Biotechnology). The protein levels were measured using ImageJ software.

Small interfering RNA

The silencing RNA duplexes for E2F1 (sc-29297; Santa Cruz Biotechnology), SPHK1 (sc-156038; Santa Cruz Biotechnology), and HSP27 (sc-29350; Santa Cruz Biotechnology) were commercially available and transfected into cells. Briefly, HaCaT cells (1 × 10⁵ cells/well) were seeded in six-well culture plates and incubated at 37°C in a CO₂ incubator until the cells are 60–80% confluent. Cells were then transfected with specific E2F1-siRNA, SPHK1-siRNA, HSP27-siRNA, or negative control small interfering RNA (siRNA) for 24 h using 25 pmol siRNA per well by Lipofectamine^® RNAiMAX (Invitrogen), following manufacturer's instructions.

Measurement of total reactive oxygen species

Cellular reactive oxygen species (ROS) was determined using H₂DCF-DA (Sigma). Cells were treated based on the experimental design mentioned above. After PBM, cells were prepared for DCF-DA assay immediately. Briefly, cells were then incubated with 10 nM DCF-DA for 15 min at room temperature (25–30°C), after which they were washed with PBS. DCF fluorescence intensity was monitored using a Lionheart™ FX Automated Microscope (BioTek Instruments) at λex = 469 nm and λem = 525 nm.

Statistical analysis

The results from the independent experiments are expressed as mean ± standard deviation. Statistical analysis of the experimental data was performed using the Student's t-test. All data were obtained from at least two independent experiments on different days. Data were considered statistically significant when the p-value was <0.05.

Results

Bioinformatic analysis of TFs and predicted target genes under 625 nm PBM

Based on the microarray data,¹¹ 113 genes were upregulated in PMA-induced HaCaT cells irradiated by 625 nm PBM. The transcription regulatory network of these genes is shown in Fig. 1a. The TFs with an NES >4 were CUX1, RFXANK, TBP, E2F1, TGIF2LY, and SIN3A. Specific information regarding TFs and their predicted target genes is shown in Table 3. Among these TFs, E2F1 and TGIF2LY worked as potential TFs of SPHK1 (Fig. 1b). NES of E2F1 was higher compared with TGIF2LY. A previous study¹⁸ also suggested a link between E2F1 and SPHK1.

FIG. 1.

Diagrams representing DEGs and a regulatory network of TFs and predicted genes; (a) green nodes indicate TFs, and pink nodes indicate predicted genes regulated by TFs; (b) Venn diagram representing two TFs: E2F1 and TGIF2LY, and their predicted target genes. DEGs, differentially expressed genes; TFs, transcription factors.

Table 3.

Transcription Factors and Target Genes Associated with 625 nm LED were Predicted by Iregulon Program

TF	NES	No. of genes	Predicted targets
CUX1	4.718	9	SMYD3, HAS2, CDCA7, SH2D5, P2RY2, SPRY1, DHRS3, TLE3, TWIST2
RFXANK	4.584	14	AAAS, BCL2L11, CYP26B1, LYPD1, MARCKSL1, MESP1, MSH6, NEDD9, PLAT, SOCS2, SQSTM1, ST3GAL1, TLE3, TWIST2
TBP	4.491	23	BAMBI, NEDD9, DYRK3, AAAS, SPRY1, CABLES1, HSPA5, ABL2, MYADM, SOCS2, SQSTM1, GLS, HS3ST2, NRG1, HOXD11, CDC25A, CCNE2, MARCKSL1, TLE3, HAS2, CYP26B1, CD97, DIDO1
E2F1	4.358	18	SPHK1, TLE3, CDCA7, SKP2, CDC25A, HIST1H2BJ, BCL2L11, HOXD11, SOCS2, MARCKSL1, CCNE2, SQSTM1, HAS2, DIDO1, DHRS3, RPP25, CABLES1, NEDD9
TGIF2LY	4.161	11	SPHK1, CDC25A, SQSTM1, TLE3, HAS2, DHRS3, MYADM, CD97, NRG1, DIDO1, SPRY1
SIN3A	4.144	28	MSH6, DEGS1, SOCS2, SAC3D1, PRR3, DHRS3, RPL27A, GLS, SQSTM1, MARCKSL1, RPP25, SMYD3, CABLES1, HES4, LRFN4, UPP1, ZNHIT2, DIDO1, TLCD1, HIST1H2BJ, CCNE2, MYADM, BCL2L11, MESP1, ALKBH2 TLE3, WDR74, OVOL2

Bold indicates that SPHK1 is of interest.

NES, normalized enrichment score, SPHK1, sphingosine kinase 1; TF, transcription factor.

E2F1 regulates SPHK1 expression under normal conditions by 625 nm PBM

Whether E2F1 is affected by 625 nm PBM in the noninflammatory state should also be considered to determine whether E2F1 is sensitive to red light. The mRNA expression level of SPHK1 was increased in both the R60 and siCON+R60 groups (Fig. 2a). However, SPHK1 was significantly decreased in siE2F1+R60 group. Similar results were found in the protein levels of E2F1 and SPHK1 (Fig. 2b). Six hundred and twenty-five nanometer PBM decreased the phosphorylation level of NF-κB (p-NF-κBp65); however, after knocking down the E2F1, the expression level of p-NF-κBp65 increased (Fig. 2b). These data indicate that E2F1 positively affected SPHK1 expression at both mRNA and protein levels under 625 nm PBM, and E2F1 negatively regulated p-NF-κBp65 protein expression.

FIG. 2.

E2F1 regulating SPHK1 expression by 625 nm PBM under normal conditions. (a) HaCaT cells were transfected by specific E2F1-siRNA, followed by red light for 1 h (R60). After knocking down E2F1, mRNA expression level of SPHK1 was decreased. (b) E2F1 silencing leads to SPHK1 decrease and increase of p-NF-κBp65 protein expression level. E2F1, SPHK1, p-NF-κBp65, and NF-κBp65 expression levels were evaluated by western blotting. (c) Protein levels were measured by ImageJ software program. The experimental data shown are all from three independently repeated experiments, and Student's t-test was used in statistical comparisons. The results are expressed as the mean ± standard deviation of the experimental data. *p < 0.5, **p < 0.05. HaCaT, human keratinocyte; PBM, photobiomodulation; SPHK1, sphingosine kinase 1; siRNA, small interfering RNA.

Crosstalk of E2F1/SPHK1/HSP27 in 625 nm PBM treated inflammation

Next, we transfected specific E2F1-siRNA (siE2F1) in inflammatory model, followed by 625 nm PBM. After PMA treatment, both E2F1 and SPHK1 protein expression levels were decreased, whereas p-NF-κBp65 and phosphorylation of HSP27 (p-HSP27) were increased. However, the 625 nm PBM reversed the expression levels of proteins as mentioned above (Fig. 3). More than 60% of E2F1 was knocked down compared to the cells transfected with a scrambled control (Fig. 3a, b). E2F1 silencing significantly reduced the SPHK1 protein expression compared to the controls (Fig. 3a, b). However, p-NF-κBp65 was increased in the same condition (Fig. 3a, b). There was no significant change in p-HSP27 expression with or without E2F1 siRNA treatment (Fig. 3a, b). These data indicate that E2F1 positively affected SPHK1 expression and negatively affected p-NF-κBp65.

FIG. 3.

Crosstalk between E2F1, SPHK1, and HSP27 by 625 nm PBM in inflammatory in vitro model. Silencing SPHK1 (a, b), E2F1 (c, d), HSP27 (e, f), and detection of each protein expression level. Protein levels were measured by the ImageJ software program. The experimental data shown are all from three independently repeated experiments, and Student's t-test was used in statistical comparisons. The results are expressed as the mean ± standard deviation of the experimental data. *p < 0.5, **p < 0.05. HSP27, heat shock protein 27.

More than 60% of SPHK1 was knocked down by the siRNA treatment (Fig. 3c, d). For E2F1 expression, there was no significant change between the siCON and siSPHK1 condition. The knockdown of SPHK1 decreased the expression of p-HSP27; however, it increased the expression of p-NF-κBp65 (Fig. 3c, d). These experiments suggested that E2F1 positively affected SPHK1 and SPHK1 positively affected HSP27. The inhibition of SPHK1 increased the expression level of p-NF-κBp65 in the HaCaT cells (Fig. 3c, d).

For the PMA condition, p-HSP27 expression increased, whereas its expression level was markedly decreased by the 625 nm irradiation (Fig. 3e, f). HSP27 knockdown (more than 50%) led to an increase in both SPHK1 and p-NF-κBp65 protein expression levels. However, E2F1 expression was not affected by siHSP27.

E2F1 is important for ROS scavenging by 625 nm PBM

E2F1 orchestrates the repression of oxidative metabolism and it can silence oxidative metabolic gene expression.¹⁹ The role of E2F1 in ROS scavenging was investigated by measuring the intracellular ROS (Fig. 4). From the fluorescence microscopic image, the green color fluorescent intensity increased for PMA-treated cells compared to control. Post-treatment with 625 nm PBM significantly reversed the ROS intensity in PMA-treated cells. However, E2F1 knockdown remarkably increased the green color fluorescence in HaCaT cells compared to that in the cells treated with the scrambled siRNA sequence (Fig. 4a). Comparing the PR60+ siE2F1 group to the PR60+siCON group, the intensity of ROS increased approximately threefold (Fig. 4b), suggesting that 625 nm PBM lost its ROS scavenging function in the absence of E2F1.

FIG. 4.

Effect of siE2F1 on intracellular ROS production in HaCaT cells. (a) siE2F1 produced ROS compared to that by 625 nm PBM and siCON groups. The intracellular ROS was detected by DCF-DA staining. (b) Fluorescence intensity of DCF-DA evaluated with Lionheart™ FX Automated Microscope software. ***p < 0.005. ROS, reactive oxygen species.

Effect of E2F1 on PGE₂ release irradiated by 625 nm PBM

The PGE₂ level was increased upon PMA treatment, and 625 nm PBM resulted in a marked decrease in PGE₂ release in both the PR60 and PR60+siCON groups (Fig. 5). Compared to control group, the concentration of PGE₂ was increased by PMA (3.2-fold higher compared with the control). In the PR60 and PR60+siCON groups, PGE₂ release was 0.67- and 0.79-fold lower compared with the PMA group. The decreased levels of PGE₂ indicated the anti-inflammatory activity of 625 nm PBM. However, the silencing of E2F1 led to a remarkable increase of PGE₂ release (2.94-fold higher compared with the siCON group). Therefore, E2F1-siRNA decreased the anti-inflammatory effects of 625 nm PBM in PMA-stimulated HaCaT cells.

FIG. 5.

Effect of siE2F1 on PGE₂ release in HaCaT cells. Release of PGE₂ was measured from the cultured medium, and these were processed for analysis by ELISA. PMA group: HaCaT cells were stimulated with 12 ng/μL PMA for 3 h; PR60 group: cells were stimulated with PMA, followed by irradiation by 625 nm PBM for 1 h; PR60+siCON and PR60+siE2F1 group: cells were transfected with CON and E2F1 siRNA, respectively, and then stimulated with PMA and subsequently irradiated with 625 nm PBM. Significant differences were seen at ***p < 0.005 compared with the presence or absence of siE2F1. PGE₂, prostaglandin E2; PMA, phorbol 12-myristate 13-acetate; PR60+siCON group, HaCaT cells were transfected with negative control siRNA and then treated the same as PR60 group; PR60+siE2F1 group, HaCaT cells were transfected with specific E2F1-siRNA and then treated the same as PR60 group.

Discussion

PBM has been known as a form of light therapy, which utilizes lasers, LEDs, or filtered lamps, in the visible and near infrared (NIR) spectrum.²⁰ Many wavelengths in the red (600–700 nm) and NIR (770–1200 nm) spectral regions have shown similar and positive results.^21
–23 It has been reported that red light is readily absorbed by blood and skin surface components, thus limiting tissue penetration (<10 mm). However, NIR light is not easily absorbed and has greater tissue penetration depth (>30–40 mm); therefore, it could provide greater photon deposition in the wound bed and show therapeutic healing effects.²⁴ Although both of red light and NIR light have antioxidant and anti-inflammatory effects, in the treatment of deeper wound, NIR could be expected for better effect. In our previous studies,^11,12 red light PBM ranging from 625 to 635 nm reduced inflammation as effectively as indomethacin or ibuprofen. Previous studies have shown that SPHK1 ¹¹ and HSP27 ¹² play important roles in the antioxidant and anti-inflammatory effects of red PBM. We assumed that there might exist a master regulator that affected both SPHK1 and HSP27 during red PBM.

In the present study, a total of 6 TFs (e.g., E2F1) and 51 key DEGs (e.g., SPHK1) were identified and were further validated by RT-PCR (Supplementary Fig. S3). Among these TFs, E2F1 and TGIF2LY worked as candidate TFs of SPHK1 (Fig. 1b). When using the Cytoscape iRegulon plugin, the NES was the output result. According to the results of the present study, the NES of E2F1 was higher compared with TGIF2LY. Saenz-Ponce et al.¹⁸ reported that E2F1 controls SPHK1 expression. Therefore, we decided to undertake further studies of E2F1.

E2F1 induction results in the expression of numerous genes required for DNA synthesis.²⁵ PMA has previously been shown to decrease E2F1 activity and expression.^26,27 These findings are supported by the result that PMA reduced E2F1 expression, followed by the sequential downregulation of SPHK1 expression (Fig. 3a). Previous evidence has shown that E2F1 repressed mitochondrial biogenesis and oxidative phosphorylation²⁸ and affects other protein expression.¹⁸ After red light PBM, both mRNA and protein expression levels of E2F1 were increased. In the same condition, expression of p-NF-κBp65 protein (Fig. 3), total ROS in the cells (Fig. 4), and PGE₂ content (Fig. 5) were decreased. However, the silencing of E2F1 significantly reversed these phenomena, which suggested that E2F1 negatively regulated oxidative metabolism and inflammation. This result is supported by another study where the knockdown of E2F1 increased the oxidative metabolic-associated gene expression.¹⁹ The knockdown of E2F1 also decreased SPHK1 expression, which indicated that E2F1 positively affected SPHK1. In the 625 nm PBM condition, E2F1 and SPHK1 expressions were increased, thereby leading to an anti-inflammatory effect. Because E2F1 worked as a TF of SPHK1, SPHK1 decreased during E2F1 silencing. Therefore, the antioxidant and anti-inflammation functions were lost without the presence of E2F1 and/or SPHK1 with red PBM. There are two isotypes of SPHK, designated SPHK1 and SPHK2. SPHK1 has been recognized as a key regulator of the delicate balance between cell proliferation and apoptosis.²⁹ Previous study found that 625 nm PBM exerts its antioxidant and anti-inflammation effects through SPHK1. However, distribution and expression of SPHK2 were not affected by 625 nm PBM (Supplementary Figs. S4 and S5).

HSP27 is a member of the small HSPs and is involved in diverse cellular functions such as stress tolerance, refolding of unfolded proteins, and the regulation of cytoskeleton dynamics, as well as cell cycle regulation.^30
–32 HSP27 is known to become rapidly phosphorylated by various agonists, including PMA.^33,34 In our previous study, HSP27 was essential for decrease of intracellular ROS and the inhibition of PGE₂ secretion in the lipopolysaccharide-induced inflammatory model by red PBM.¹² To elucidate the relationship between ROS and HSP27, NAC was used to clear the PMA-induced ROS. The cleared ROS led to a decrease of p-HSP27 with or without PMA stimulation (Supplementary Fig. S6). The capacity of HSP27 is determined by the phosphorylation status, and our results showed that 625 nm PBM inhibited the phosphorylation of HSP27 in PMA-induced HaCaT cells, indicating that phosphor-HSP27 was decreased by 625 nm irradiation. When knocking down HSP27, SPHK1 expression slightly increased. As described above, the increase of SPHK1 has an anti-inflammatory function. However, in the absence of HSP27, 625 nm PBM could not reduce the inflammatory response, even if SPHK1 was increased. Moreover, a significant decrease in phosphorylated NF-κBp65 levels by 625 nm PBM was seen in control siRNA-treated HaCaT cells. However, 625 nm PBM could not decrease phosphorylation of NF-κBp65 in HSP27-silenced HaCaT cells. This also suggests that HSP27 is essential for 625 nm PBM-induced anti-inflammatory function.

Conclusions

In summary, E2F1 worked as a TF of SPHK1 and exhibited anti-inflammatory and antioxidative effects through SPHK1 in PMA-induced HaCaT cells irradiated with 625 nm PBM. In addition, HSP27 was essential for the 625 nm PBM-induced anti-inflammatory function. Therefore, the presence of E2F1/SPHK1 and HSP27 in 625 nm PBM caused a decrease in inflammation. They could be used as potential biomarkers for anti-inflammatory therapy using red LED PBM therapy.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the National Research Foundation of Korea grant funded by the Korean Government (MSIT) (No. 2019R1F1A1044073 and 2019R1F1A1056887 and 2019R1F1A1059492).

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

Supplementary Figure S3

Supplementary Figure S4

Supplementary Figure S5

Supplementary Figure S6

References

Opel

, Hagstrom

, Pace

, et al. Light-emitting diodes: a brief review and clinical experience. J Clin Aesthet Dermatol, 2015; 8:36–44.

Zhang

, Wu

, Zhang

, et al. Topical 5-aminolevulinic photodynamic therapy with red light vs intense pulsed light for the treatment of acne vulgaris: a spilit face, randomized, prospective study. Dermatoendocrinol, 2017; 9:e1375634.

Kleinpenning

, Otero

, van Erp

, Gerritsen

, van de Kerkhof

. Efficacy of blue light vs. red light in the treatment of psoriasis: a double-blind, randomized comparative study. J Eur Acad Dermatol Venereol, 2012; 26:219–225.

Čarija

, Puizina-Ivić

, Vuković

, Kovačević

, Čapkun

. Single treatment of low-risk basal cell carcinomas with pulsed dye laser-mediated photodynamic therapy (PDL-PDT) compared with photodynamic therapy (PDT): a controlled, investigator-blinded, intra-individual prospective study. Photodiagnosis Photodyn Ther, 2016; 16:60–65.

Fernández-Guarino

, Harto

, Jaén

. Pulsed dye laser does not seem as effective as red light in basal cell carcinoma mal-pdt: a small pilot study. J Skin Cancer, 2012; 2012:396481.

Lanzafame

, Blanche

, Bodian

, Chiacchierini

, Fernandez-Obregon

, Kazmirek

. The growth of human scalp hair mediated by visible red light laser and LED sources in males. Lasers Surg Med, 2013; 45:487–495.

Lanzafame

, Blanche

, Chiacchierini

, Kazmirek

, Sklar

. The growth of human scalp hair in females using visible red light laser and LED sources. Lasers Surg Med, 2014; 46:601–607.

Barolet

, Roberge

, Auger

, Boucher

, Germain

. Regulation of skin collagen metabolism in vitro using a pulsed 660 nm LED light source: clinical correlation with a single-blinded study. J Invest Dermatol, 2009; 129:2751–2759.

Calderhead

, Vasily

. Low level light therapy with light-emitting diodes for the aging face. Clin Plast Surg, 2016; 43:541–550.

10.

Bryld

, Jemec

. Photodynamic therapy in a series of rosacea patients. J Eur Acad Dermatol Venereol, 2007; 21:1199–1202.

11.

Sun

, Kim

, Cho

, Shi

, Kim

. Red light-emitting diode irradiation regulates oxidative stress and inflammation through SPHK1/NF-kappaB activation in human keratinocytes. J Photochem Photobiol B, 2018; 186:31–40.

12.

Lim

, Kim

, et al. Modulation of lipopolysaccharide-induced NF-kappaB signaling pathway by 635 nm irradiation via heat shock protein 27 in human gingival fibroblast cells. Photochem Photobiol, 2013; 89:199–207.

13.

Saito

, Smoot

, Ono

, et al. A travel guide to Cytoscape plugins. Nat Methods, 2012; 9:1069.

14.

Castillo

, Carrillo

, Libisch

, et al. Host-parasite interaction: changes in human placental gene expression induced by Trypanosoma cruzi. Parasit Vectors, 2018; 11:479.

15.

Verfaillie

, Imrichová H, Van de Sande B, et al. iRegulon: from a gene list to a gene regulatory network using large motif and track collections. PLoS Comput Biol, 2014; 10:e1003731.

16.

, Wang

, Li

, Yu

, Si

, Wang

. Identification of key genes and pathways associated with obesity in children. Exp Ther Med, 2017; 14:1065–1073.

17.

Wong, Marisa

, Juan

. Medrano. Real-time PCR for mRNA quantitation. Biotechniques, 2005; 39:75–85.

18.

Saenz-Ponce

, Pillay

, de Long

, et al. Targeting the XPO1-dependent nuclear export of E2F7 reverses anthracycline resistance in head and neck squamous cell carcinomas. Sci Transl Med, 2018; 10:eaar7223.

19.

Blanchet

, Annicotte

, Lagarrigue

, et al. E2F transcription factor-1 regulates oxidative metabolism. Nat Cell Biol, 2011; 13:1146–1152.

20.

Yadav

, Gupta

. Noninvasive red and near-infrared wavelength-induced photobiomodulation: promoting impaired cutaneous wound healing. Photodermatol Photoimmunol Photomed, 2017; 33:4–13.

21.

Sakurai

, Yamaguchi

, Abiko

. Inhibitory effect of low-level laser irradiation on LPS stimulated prostaglandin E2 production and cyclooxygenase-2 in human gingival fibroblasts. Eur J Oral Sci, 2000; 108:29–34.

22.

Lim

, Choi

, Kim

, et al. Anti-inflammatory effect of 635 nm irradiations on in vitro direct/indirect irradiation model. J Oral Pathol Med, 2015; 44:94–102.

23.

Choi

, Lim

, Kim

, et al. Inflammatory cytokines are suppressed by light-emitting diode irradiation of P. gingivalis LPS-treated human gingival fibroblasts: inflammatory cytokine changes by LED irradiation. Lasers Med Sci, 2012; 27:459–467.

24.

Gupta

, Dai

, Hamblin

. Effect of red and near infrared wavelengths on low-level laser (light) therapy induced healing of partial-thickness dermal abrasions in mice. Lasers Med Sci, 2014; 29:257–265.

25.

DeGregori

, Johnson

. Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. Curr Mol Med, 2006; 6:739–748.

26.

Cozzi

, Parsons

, Ogbourne

, Pedley

, Boyle

. Induction of senescence in diterpene ester-treated melanoma cells via protein kinase C-dependent hyperactivation of the mitogen-activated protein kinase pathway. Cancer Res, 2006; 66:10083–10091.

27.

Itsumi

, Shiota

, Yokomizo

, et al. PMA induces androgen receptor downregulation and cellular apoptosis in prostate cancer cells. J Mol Endocrinol, 2014; 53:31–41.

28.

Denechaud

, Fajas

, Giralt

. E2F1, a novel regulator of metabolism. Front Endocrinol (Lausanne), 2017; 8:311.

29.

Hait

, Oskeritzian

, Paugh

, Milstien

, Spiegel

. Sphingosine kinases, sphingosine 1-phosphate, apoptosis and diseases. Biochim Biophys Acta, 2006; 1758:2016–2026.

30.

Singh

, Sharma

, Tiwari

. The small heat shock protein Hsp27: present understanding and future prospects. J Therm Biol, 2017; 69:149–154.

31.

Haslbeck

, Franzmann

, Weinfurtner

, Buchner

. Some like it hot: the structure and function of small heat-shock proteins. Nat Struct Mol Biol, 2005; 12:842.

32.

Van Montfort

, Slingsby

, Vierlingt

. Structure and function of the small heat shock protein/α-crystallin family of molecular chaperones. Adv Protein Chem, 2001; 59:105–156.

33.

Alford

, Glennie

, Turrell

, Rawlinson

, Saklatvala

, Dean

. Heat shock protein 27 functions in inflammatory gene expression and transforming growth factor-beta-activated kinase-1 (TAK1)-mediated signaling. J Biol Chem, 2007; 282:6232–6241.

34.

Liu

, Hong

, Feng

, et al. Regulation of lipopolysaccharide-induced inflammatory response by heat shock protein 27 in THP-1 cells. Cell Immunol, 2010; 264:127–134.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.10 MB

0.13 MB

Role of E2F1 / SPHK1 and HSP27 During Irradiation in a PMA-Induced Inflammatory Model

Abstract

Background:

Objective:

Methods:

Results:

Conclusions:

Introduction

Materials and Methods

Cell culture and chemicals

Photobiomodulation

Microarray and data analysis

Bioinformatic analyses of associated genes and TFs

RNA isolation and real-time polymerase chain reaction

Western blotting

Small interfering RNA

Measurement of total reactive oxygen species

Statistical analysis

Results

Bioinformatic analysis of TFs and predicted target genes under 625 nm PBM

E2F1 regulates SPHK1 expression under normal conditions by 625 nm PBM

Crosstalk of E2F1/SPHK1/HSP27 in 625 nm PBM treated inflammation

E2F1 is important for ROS scavenging by 625 nm PBM

Effect of E2F1 on PGE2 release irradiated by 625 nm PBM

Discussion

Conclusions

Footnotes

Author Disclosure Statement

Funding Information

Supplementary Material

References

Supplementary Material

Effect of E2F1 on PGE₂ release irradiated by 625 nm PBM