A Real-Time Pluripotency Reporter for Human Stem Cells

Identification of human Rex-1 promoter

The mouse Rex-1 promoter region is well defined and studied, but the corresponding human Rex-1 promoter is less well known. Aligning the mouse promoter sequence to human sequence failed to identify significant homology. Therefore, we located a 5 kb region upstream of the star codon of the human Rex-1 gene from NCBI database, and then searched for sequences similar to the Oct-3/4-binding octamer motif (ATTTGCAT) and GC boxes (CCCGCCC), which are reported in mouse Rex-1 promoter [10], using pattern search software as described (http://bioweb.pasteur.fr/seqanal/interfaces/scan_for_matches.html). Patterns with significant matches were scored for regions of ∼800 bp. Five potential human Rex-1 regions were selected for producing the hRex-GFP constructs that were then tested in human BJ cells (normal human fibroblasts).

Construction of Rex-GFP lentiviral vectors

A lentiviral construct pL_UGIP in which GFP expression is under the control of Ubi promoter was purchased from ATCC (ATCC #10326372). The Ubi promoter was removed by digesting the vector with AgeI and PacI (New England Biolab, Ipswich, MA, USA). Mouse rex-1 promoter and the five potential human Rex-1 promoters were amplified from human and mouse genomic DNA, respectively (Clontech, Mountain View, CA, USA), with corresponding PCR primers containing restriction sites. The PCR products were first cloned into pCR2.1 vector (Invitrogen, Carlsbad, CA, USA) and digested with AgeI and PacI (New England Biolab, USA) to obtain the respective promoter regions. After electrophoresis, different promoter fragments were purified using an agarose gel extraction kit (Qiagen, USA). The purified promoter fragments were subcloned into the pL-UGIP backbone.

The sequence and orientation of mouse and human Rex 1 promoters were confirmed by DNA sequencing. The resulting mouse and human Rex-GFP constructs were then tested in human ESC and BJ cells to identify the human Rex-GFP construct that best served as a pluripotency reporter.

Primers for amplifying mouse Rex-1 promoter are: CATATCCTTAATTAAACCGATTCCTC (forward) and CTATCACCGGTTCTAGGCGGCTAGGAG (reverse); primers for amplifying human Rex-1 promoter are: CATATC CTTAATTAATGCAGAAAAGC (forward) and CTATCA CCGGTACAAATACGCGTGGGTGTAA (reverse).

Cell culture

BJ cells were purchased from ATCC (CRL-2522) and maintained as instructed in Eagle’s minimum essential medium (ATCC) with 10% fetal bovine serum (FBS). The HES3 were obtained from the stem cell core facility at the University of Southern California. The HES3 cells were cultured on mouse embryonic fibroblast (MEF) feeders with hESC medium: DMEM supplemented with 5% FBS (Hyclone, USA), 1% nonessential amino acid, 1% Insulin–Transferrin–Selenium-G Supplement, and for each 100 mL medium 0.5 mL Pen/Strep and 0.18 mL of 2-mercaptoethanol were added (except FBS, all components were purchased from Invitrogen). Cell passages were performed with microdissection of colonies. A sterile 25-G needle was used to remove the center of each colony for re-plating into fresh MEF feeder each week. The hESC medium was changed everyday. The H9 line was purchased from WiCell and maintained as instructed.

Transduction of human ESCs and fibroblasts

Retroviral vectors were produced with three-plasmid transient transfection using a 10-cm plate of 293T cells. The 293T cells were split the previous day with a 1:5 ratio. The calcium 6-phosphate precipitation method was performed with 2 µg vesicular stomatitis virus glycoprotein (VSVG) envelope expression plasmid, 10 µg of pCMV delta 8.91 (the gag, pol plasmid), and 10 µg of the lentiviral expression vector plasmid. The medium was changed the following morning and the respective lentiviral vectors were collected 24 h later by filtration through a 0.2-µm filter.

One milliliter of the vector supernatant plus 8 µg/mL polybrene were added to each well of a 24-well dish containing 2 × 10⁴ fibroblasts or HES3 on MEF feeders. After incubation with the respective vector for 2–4 h, transduction medium was replaced with 2 mL growth medium (EMEM with 10% FBS) for fibroblasts, or 2 mL of hESC medium for transduced HES3.

Clonal selection of BJ cells with hRex-GFP insertion

The hRex-GFP construct did not express GFP in somatic BJ cells. After transduction with hRex-GFP lentiviral vectors, BJ cells were prepared as single-cell suspensions using trypsin. A serial dilution was made to plate single BJ cells into 96-well plates. After expansion to ∼500 cells in wells, half the cells were removed mechanically with a pipette tip. Genomic DNA was extracted with DNeasy Kit (Qiagene, USA) and subjected to PCR analysis with GFP-specific primers: GACGTAAACGGCCACAAGTT (forward) and GAACTCCAGCAGGACCATGT (reverse).

Reprogramming and differentiation of hRex-GFP fibroblasts

Cell fusion was performed to reprogram BJ cells carrying the Rex-GFP construct. To induce cell fusion, 5 × 10⁷ hESC (H9) and 5 × 10⁷ transduced fibroblasts were mixed in the presence of polyethylene glycol (PEG; Roche, Nutley, NJ) as instructed by the manufacturer. The cell fusion mixtures were plated on MEF feeder under standard conditions for the maintenance of hESCs as described [2]. After 5 days, both GFP-positive colonies (reprogrammed hESC) and GFP-negative colonies (not reprogrammed) were observed. Both types of colonies were subjected to alkaline phosphatase assays (VECTOR Blue Substrate Kit, VECTOR Labs). The GFP-positive colonies were picked mechanically. To differentiate the reprogrammed cells, GFP-positive colonies were plated on a regular Petri dish with DMEM supplemented with 10% FBS.

Silence of hRex-GFP in fibroblasts

Rex-1 was found to be highly expressed in pluripotent human and murine cells, and its expression decreased as the cells differentiated [9,10,13]. Although the regulatory role of Rex-1 in stem cell pluripotency is unknown, it was reported that it is only expressed in pluripotent cells [13,14]. We transduced BJ cells with lentiviral vectors containing Ubi-GFP and human Rex-GFP constructs. Among six constructs, the mouse Rex-GFP and three human Rex-GFP constructs showed low GFP expression in BJ cells. Therefore, we selected one human Rex-GFP construct with no detectable GFP expression in five independent transduction experiments, and designated this construct as hRex-GFP. As shown in Figure 1, BJ cells incorporating the Ubi-GFP construct express GFP in transduced cells (Fig. 1). However, BJ cells transduced with hRex-GFP vectors did not express GFP (Fig. 2).

OPEN IN VIEWER

FIG. 1. 

Fibroblasts with hRex-GFP construct do not express GFP. (A) BJ cells transduced with Ubi-GFP vector express GFP. (B) BJ cells transduced with hRex-GFP vectors do not express GFP. (C) PCR with GFP-specific primers indicates GFP in the genome of hRex-GFP-transduced BJ cells. To rule out plasmid contamination, genomic DNAs were extracted from cells (A and B) after three passages post-transduction. Images are at 100× magnification.

OPEN IN VIEWER

FIG. 2. 

Expression of GFP from the hRex-GFP construct is stable in pluripotent human embryonic stem cells (hESCs) for at least eight passages. HES3 is maintained in pluripotent status. (A) After transduction, patches of GFP-positive cells appear in an HES3 colony. (B) The hRex-GFP HES3 colony was dissected and re-plated onto MEF with standard hESC maintenance medium. A typical pluripotent colony with GFP expression is shown. (C) After eight passages, hRex-GFP-transduced pluripotent HES3 colonies continue to express GFP. The center of the colony is GFP-positive, while cells located at the edge have lost GFP expression. (D) Hoffman modulation contrast images of the same colony are shown in C.

For verifying the incorporation of vector constructs into the genomes, genomic DNA was extracted from transduced BJ cells and subjected to PCR with GFP-specific primers. To rule out the possibility of vector DNA contamination, genomic DNA was prepared from transduced BJ cells that were at least three passages post-transduction. Electrophoresis of PCR products indicated that GFP sequence is present in genomic DNA of BJ cells transduced with Ubi-GFP or hRex-GFP vectors. The lack of GFP expression in BJ cells and the confirmation of GFP sequence incorporation show that the hRex-GFP construct is silent in BJ cells. This result agreed with previous reports that BJ cells do not express Rex-1 [4,15].

Stable expression of hRex-GFP in hESCs

In order to use the hRex-GFP construct as a real-time pluripotency reporter, the construct must be silent in somatic cells and have stable GFP expression in pluripotent cells, such as hESC. After transducing hESC (HES3) on MEF feeders with the hRex-GFP vector, patches of green cells appear (Fig. 2A) inside the pluripotent HES3 colonies ∼7 days post-transduction. The GFP-positive cell patches were dissected and re-plated onto MEF feeder to obtain GFP-positive hESC colonies (Fig. 2B). These GFP-positive hESC colonies were passaged by dissecting out the center of the colonies and re-plated onto MEF feeders. After eight passages, the colonies continued to express GFP (Fig. 2C). These data indicate the stable expression of GFP in hESC. We also observed that GFP expression is gradually lost in the cells located at the edge of the hESC colonies, suggestive of spontaneously differentiation at the colony periphery. Therefore, we further investigated whether the loss of GFP expression in these peripherally located cells is reflective of cell differentiation.

Lost of GFP expression in differentiated hRex-GFP cells

To initiate differentiation of HES3 colonies, hESC medium was replaced with DMEM medium supplemented with 10% FBS. Cells in the edge of the GFP-positive colonies rapidly lost GFP expression, while cells in the center of the colonies continued to express GFP (Fig. 3A). After exposure to differentiation conditions for 4 days, the cellular morphology of the colonies also changed from round to irregular in shape. Eventually most of the cells lost GFP expression, but the cells located in the center continued to express GFP. During HES3 culture maintenance, we observed that differentiation of a pluripotent colony often progressing from periphery toward the colony center. Therefore, these data suggest that only pluripotent cells with the hRex-GFP insertion express GFP. Differentiated cells with hRex-GFP insertion do not express GFP.

OPEN IN VIEWER

FIG. 3. 

GFP expression from hRex-GFP construct is reduced during differentiation of pluripotent cells. To induce differentiation, human embryonic stem cell (hESC) medium was replaced by DMEM with 10% FBS. (A) GFP expression is reduced and restricted at the center of the hRex-GFP HES3 colony after exposure to differentiation medium. (B) A highly differentiated colony is showed after 4 days in differentiation medium. There is small number of cells at the center of the hRex-GFP HES3 colony that continue to express GFP. (C) BJ cells with hRex-GFP insertion express GFP after reprogramming via cell fusion with H9 (inset is the alkaline phosphatase staining of a reprogrammed hybrid colony). (D) After replacing hESC medium with differentiation medium, some hybrid cells have lost GFP expression upon differentiation.

To investigate further the specificity of hRex-GFP as a pluripotency reporter, we reprogrammed BJ cells that have the hRex-GFP insertion by a cell fusion technique [4]. These BJ cells do not express GFP when they are cultured as fibroblasts (Fig. 1B). After fusing hRex-GFP BJ cells with H9 cells, the hybrid cells are plated on MEF feeder following which GFP-positive colonies appeared ∼5 days after fusion (Fig. 3C). We further isolated and re-plated GFP-positive colonies on MEF feeders in chamber slides. Alkaline phosphatase (AP) staining of GFP-positive colonies indicates that these colonies have strong AK activity and are pluripotent (Fig. 3, inset). The reprogrammed hybrid cells were then exposed to differentiation medium to induce cellular differentiation. As expected, when the GFP-positive hybrid cells underwent differentiation, they lost GFP expression. The lost of GFP expression began ∼48 h after exposing to differentiation medium, and progressed from the edge of the colonies toward the center (Fig. 3B and D). These data indicate that the hRex-GFP construct can be inserted into the genome of human fibroblasts via lentiviral vectors, and the insertion is stable and functional in progeny of these fibroblasts. Therefore, the hRex-GFP construct can be used for long-term and real-time monitoring of pluripotency in live cells.