Skeletal Myogenic Potential of Mouse Skin-Derived Precursors

Abstract

Cell transplantation-based therapy could be an effective way for the treatment of many diseases. Among numerous somatic stem cells isolated and purified, skin-derived precursors (SKPs) are abundant autologous cells, providing a large reservoir of cells for therapeutic transplantation. Previous studies showed that SKPs could be differentiated into neural and mesodermal progeny in vitro. In the present study, we attempted to differentiate SKPs to muscle progenitors in vitro. After treatment with a combination of growth factors, SKPs were differentiated into cells expressing markers of muscle progenitors, including Pax7. Furthermore, some of these cells expressed desmin, TnT, Mstn, and Myog, suggesting their differentiation into the muscular lineage. After single point injection, the differentiation of SKPs from green fluorescent protein positive donors into muscle precursors was also demonstrated in vivo. Additionally, donor SKPs migrated to the niche of muscle progenitors, participated in the regeneration of recipient muscles, and expressed markers of muscle progenitors, including Pax7, M-cadherin, and MyoD. After recovery of donor cells from recipient muscles at 3 weeks postinjection, some of the injected SKPs were converted to myogenic precursors, based on the expression of specific markers (Pax7 and MyoD). Some of these donor cells also expressed muscle makers (desmin, TnT, and Myog). At 20 weeks postinjection, the injected SKPs were localized to recipient muscles without decreases in their population size. In summary, these findings indicated that SKPs could develop into muscle progenitors and differentiated muscle cells in vitro and in vivo, thus providing valuable autologous cells for the treatment of muscle diseases.

Introduction

Skeletal muscles are distributed throughout our body with a strong ability to regenerate [1]. The stem or progenitor cells in muscle maintain its homeostasis [1]. Previous studies demonstrated the existence of many types of stem cells localized in muscles, including satellite cells and interstitial cells [1,2]. Satellite cells, localized beneath the basal lamina around myofibers, are the primary reservoir of adult muscle precursors and function as myogenic precursors for muscle growth and repair. To fully understand the homeostasis of muscle, many myogenic cell-related markers have been discovered, including Pax7 [3], Pax3 [4], myf5 [5 –7], desmin [8], MyoD [9], and M-cadherin [2]. Utilizing some of these markers, muscle precursors have been successfully isolated. After transplantation, these cells reconstitute the recipient muscle fibers [4,10 –12].

Transplantation of muscle stem cells has been regarded as an efficient method for the treatment of muscular diseases in mouse models [11,13]. However, their extremely low numbers and difficulties for enrichment limit their utility for cell therapy. Besides myogenic cells derived from muscles, several alternative sources for muscle repair have been found including mesangioblasts [14], bone marrow-derived myogenic progenitors [15,16], adult muscle stem cells [17], and ES-derived muscle precursors [18,19]. However, these alternative sources from somatic stem cells, similar to bone marrow-derived myogenic progenitors, are rare and exhibit a limited ability for expansion in vitro. Although ES-derived muscle cells have been shown to have therapeutic potential in the treatment of muscular dystrophy [18,19], its utility is still restricted. Previous studies suggested that it was difficult to differentiate ES cells into muscle precursors in vitro, because of inefficient paraxial mesoderm formation during embryoid body (EB) differentiation [18,19].

Skin-derived precursors (SKPs), derived from skin [20,21], can provide abundant autologous cells for cell therapy. These cells are easily acquired and expanded in vitro. Previous studies suggested that SKPs could be differentiated into many cell types, including neural cells, muscle cells, adipocytes [20,21], and insulin-producing cells [22] in vitro, suggesting their great potential for therapeutic application. Here, we differentiated SKPs to muscle precursors in vitro through a rapid protocol and demonstrated that SKPs could be engrafted to the niche of muscle progenitors through single point injection. Moreover, the injected donor cells could be retained in the recipient muscle up to 20 weeks postinjection without decreases in their population size. Through immunostaining in tissue sections and recovery of injected cells from recipient muscles, we demonstrated that these cells were converted to muscle precursors and expressed many myogenic markers. As abundant SKPs are easily acquired autologous progenitors, the transplantation of SKPs is a promising therapy for degenerative muscle diseases.

Materials and Methods

Mice

Neonatal and 4-week-old male Balb/C nude mice were purchased from Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Neonatal GFP transgenic mice were obtained from our laboratory. The animals were all maintained in accordance with institutional rules following the Guidelines for the Care and Use of Animals in Research. Mice were allowed free access to water and foods and raised in a constant photoperiod (14L: 10D).

Cell culture

Skin-derived precursors (SKPs) were isolated using a previously described method [20,21], with modifications. In brief, skin from abdomen and back was dissected free of other tissues, cut into 1–2 mm³ pieces, washed three times in phosphate-buffered saline (PBS), and then digested with 0.125% trypsin for 45 min at 37°C. Tissue pieces were then washed twice with PBS. Skin pieces were manually dissociated by pipetting into a 1-mL pipette, a process that was repeated until the tissue could not be broken down further. The cell suspension was then poured through a 40-µm cell strainer. Dissociated cells were centrifuged at 1,000 rpm for 8 min and were washed twice with medium (DMEM-F12, 1:1). Then cells were resuspended in 10 mL medium containing B-27 (Gibco-BRL, Carlsbad, CA), 20 ng/mL EGF, and 40 ng/mL bFGF (both from Sigma). Cells were cultured in 60-mm² tissue culture flasks (BD Falcon, Mississauga, Ontario, Canada) in a 37°C, 5% CO₂ tissue culture incubator. To passage floating clusters of cells, medium containing spheres was centrifuged and the pellet was manually dissociated with a 1-mL pipette. The cells were re-seeded in fresh medium as described earlier. Cells were passaged every 6–8 days.

For myospheres preparation [23], hind-limb muscles from neonatal mice were isolated, minced by scissors, and digested with 0.125% trypsin for 1 h at 37°C. A single cell suspension was obtained after filtering the samples through a 40-µm cell strainer. Isolated cells were pre-plated overnight on culture dishes in DMEM supplemented with 20% fetal bovine serum (FBS) 2 mM glutamine, 1% penicillin–streptomycin. Myospheres were formed after 3–4 days.

The murine ES cell lines R1 was cultured in DMEM with 20% FBS and 1,000 U/mL leukemia inhibitory factor (LIF, BD). To induce embryonic body (EB) formation [22,23], ES cells were dissociated with trypsin and suspended in Petri dishes (Alpha Medical Instrument Corp) with 10% FBS/DMEM without LIF. For 3–5 days, EBs were collected for further analysis.

Neuronal and glial differentiation of sphere colonies in vitro

For differentiation [20,21], spherical colonies were trypsinized and dissociated into single cells, then cultured in DMEM supplemented with 2% FBS (Gibco) on poly-d-lysine (Sigma, St. Louis, MO)- and laminin (Sigma)-coated 24-well plates for 7–28 days.

In vitro induction of mouse SKPs to muscle progenitors

SKPs were seeded into 35-mm dishes at a density of 10,000 per mL in growth medium supplemented with 10% FBS (Invitrogen, Carlsbad, CA). Beginning 24 h after seeding, cultures were treated for 24 h with 10 µM 5-azacytidine (Sigma). Cultures were then washed twice with PBS, and the culture medium was changed to differentiation medium containing 2% FBS, 50 µM hydrocortisone (Sigma), and 4 ng/mL IGF-1 (Peprotech, Rocky Hill, NJ), 4 ng/mL bFGF (Sigma). The medium was changed twice a week for 12 days until the experiment was terminated. To perform immunostaining for Pax7 (R&D), desmin (Abcom), TnT (Abcom), cells were rinsed twice with PBS, fixed with 4% paraformaldehyde for 15 min, permeated using 0.2% Triton X-100 for 10 min, blocked with 5% BSA for 1 h, and then incubated overnight with primary antibody at 4°C overnight. The following secondary antibodies were used according to the manufacturer’s recommendations. For some samples, pre-immune IgG of rabbit, goat, or mouse were used as negative controls.

In vivo induction of mouse SKPs to muscle progenitors

Four-week-old male Balb/C nude mice were used for the in vivo model of muscle regeneration. Fifty microliters of 10 µM CTX (cardiotoxin; Sigma) was injected into the TA muscle. One day later, 5 × 10⁶ mSKPs from GFP transgenic mice suspended in 50 µL PBS were administered (single point injection) into the same TA muscle (tibialis anterior). The other TA muscle served as internal control receiving PBS. Three weeks or 20 weeks later, TA muscles were removed, embedded in ornithine carbamoyl transferase, frozen in liquid-nitrogen-cooled isopentane, and cut on a cryostat into 7 µm serial sections. Sections were fixed in 4% paraformaldehyde and stained with antibody of laminin (Abcom), Nuclei were stained with 0.01 mg/mL of Hoechst 33342 (Sigma) for 10 min. Samples were viewed under a laser-scanning confocal microscope (Leica).

For the recovery of GFP⁺ cells, hind-limb muscles from recipient mice transplanted with GFP⁺ SKPs were removed, minced by scissors and digested with collagenase type A (Sigma) for 1 h at 37°C. A single cell suspension was obtained after filtering the samples through 40 µm cell strainer. Adherent cells were kept in culture for immuofluorescence. After culturing in differentiation medium for 1 day, adherent cells were fixed in 4% paraformaldehyde and stained with antibodies for Pax7 (R&D), desmin (Abcam), MyoD (Abcam), myogenin (Abcam), or TnT (Abcam).

Real-time PCR

Total RNAs were isolated from cells using Trizol reagent (Invitogen) according to the manufacturer’s instructions. A total of 2 µg of RNA was reverse-transcribed by using avian myeloblastosis virus reverse transcriptase (Promega) and 2 µg of random hexamer primers (Takara). All real-time PCRs were conducted using ABI-Prism 7300 (Applied Biosystems, Foster City, CA), by Shanghai GenePharma Co., Ltd. The sequences of primers used are listed in Table 1. Results were normalized to β-actin levels using the comparative Ct (2^−⊗⊗Ct) method. The results are expressed as fold induction over controls.

Table 1.

Primer Sequences for Real-Time RT-PCR Analysis

Gene	Sequence
Beta-actin	Forward primer	TCACTATTGGCAACGAG
Beta-actin	Reverse primer	AAGGAAGGCTGGAAAA
Desmin	F primer	GGAAATCCAACTAAGAGAAGAAGCA
Desmin	R primer	CTCCAGGTCAATACGAGCTAGAGTG
Mstn	F primer	TGGATGGGACTGGATTATCGC
Mstn	R primer	GCCTGCTGAGCCTCTGGGGTT
Myog	F primer	GGCTGACCCTACAGACGCCCACAAT
Myog	R primer	GGGAAGGCAACAGACATATCCTCCA
Hoxb1	F primer	AAGAGAAACCCACCTAAGACAGC
Hoxb1	R primer	TGAAGTTTGTGCGGAGACC
Pax3	F primer	GCATTCGGCCTTGCGTCATTTCT
Pax3	R primer	GGCGTTGTCACCTGCTTGGGTTT
Myf5	F primer	CGCTGTGGGGACAGAGAT
Myf5	R primer	GACAGGGCTGTTACATTCAGG
Pax7	F primer	GGCACAGAGGACCAAGCTC
Pax7	R primer	GCACGCCGGTTACTGAAC
Tbx6	F primer	CGCTGTGGGGACAGAGAT
Tbx6	R primer	TGACTGATACTCGGCAAGCA
Oct4	F primer	GTTGGAGAAGGTGGAACCAA
Oct4	R primer	CTCCTTCTGCAGGGCTTTC
Sox2	F primer	TGCTGCCTCTTTAAGACTAGGG
Sox2	R primer	TCGGGCTCCAAACTTCTCT

Immunofluorescence staining

Sections were fixed in 4% paraformaldehyde solution before staining for immunfluorescence. After washing three times in PBS, the samples were permeabilized with 0.2% Triton X-100 (Sigma) for 20 min. At room temperature, sections were rinsed several times in PBS and then incubated in 5% BSA for 1 h at room temperature. After the BSA solution was aspirated, the samples were incubated with appropriate primary antibodies of GFP (Santa Cruz, CA), Pax7 (R&D), MyoD (Abcom), M-cadherin (Abcom) at a concentration 1 µg/mL at 4°C overnight. After rinsing in PBS three times, samples were incubated with FITC-labeled, Cy5-labeled, or TRITC-labeled secondary antibodies, respectively (Zhongshan Biotechnology Beijing, People’s Republic of China), at 37°C for 1 h. After rinsing in PBS, nuclei were stained with 0.01 mg/mL of Hoechst 33342 (Sigma) for 10 min. Samples were viewed under a laser-scanning confocal microscope (Leica). For some samples, pre-immune IgG of rabbit, goat, or mouse were used as negative controls.

Statistics

To estimate GFP⁺ satellite cells and GFP⁺ muscle fibers, six sections, each 10 µm thick and 200–300 µm apart, were prepared for each muscle specimen and the number of GFP⁺ cells and GFP⁺ muscle fibers in each section was counted. We also selected five random views in each section and counted the total number of satellite cells and myofibers for each section. The ratio between GFP⁺ satellite cells and the estimated total number of satellite cells was determined. The ratio between GFP⁺ muscle fibers and the estimated total number of muscle fibers was determined. One-way ANOVA was used for statistical evaluation of the data. Values were presented as mean ± SEM. P value <0.05 was considered statistically significant.

Results

Differentiation potentials of SKPs and ES cells into muscle progenitors

SKPs and ES cells were cultured in growth medium according to the protocol described in Materials and Methods. After growth factors withdrawal, SKPs were differentiated in 2% FBS [20,21]. ES cells were cultured in DMEM with 20% FBS and 1,000 U/mL leukemia inhibitory factor [24,25]. After differentiation for 3 to 5 days, SKPs-derived cells and EBs were collected for RNA isolation and real-time RT-PCR analysis. We examined the expression of pluripotent markers, Oct4 and Sox2, at different days after differentiation. The expression of Oct4 mRNA was rapidly decreased during the differentiation of SKPs and ES cells (Supplementary Fig. 1). (Supplementary materials are available online at http://www.liebertpub.com/) In contrast to EBs, expression of Sox2 was increased during differentiation of SKPs, consistent with the preference for SKPs to develop into neural lineage [20,21]. We also analyzed the expression of Hoxb1 [24] and Tbx6 [26,27] (paraxial mesoderm markers). Both of these genes were up-regulated during differentiation of SKPs and ES cells, suggesting their potential to differentiate into muscle precursors. However, the expression of Pax7 and Myf5 (muscle progenitor markers) was higher during the differentiation of SKPs as compared with that of EB cells (Supplementary Fig. 1), indicating a stronger potential for SKPs to differentiate toward muscle progenitors.

Comparison of morphology and gene expression patterns between myospheres and SKPs

Since SKPs could spontaneously differentiate into muscle cells in vitro [20 –22], we examined the similarities between SKPs and muscle progenitors in their morphology and gene expression patterns. Muscle myospheres were isolated according to the protocol described before [23]. After culturing for 1 week, muscle progenitors and SKPs formed colonies with a similar morphology (Fig. 1). We further analyzed the expression of marker genes, including Oct4, Stat3, nestin, and fibronectin in these spheres. As shown in Figure 1, these genes were highly expressed in both spheres. After growth factor withdrawal, these spheres started to differentiate in vitro. Subsequently, βIII-tubulin-, MAP₂−, and NFM-expressing neural cells appeared, indicating the neural differentiation potential of myospheres and SKPs (Supplementary Fig. 2). These findings are consistent with previous reports demonstrating the competence of SKPs and muscle precursors to differentiate toward neural cells [20 –22,28].

FIG. 1.

Comparison of the colonies morphology and gene expression patterns between skin-derived precursor cells (SKPs) and myospheres. (A and B) The morphology of spheres in SKPs and myospheres. (C–J) Expression of Oct4, Stat3, nestin, and fibronectin in SKPs and myospheres; the magnifications in (A and B) were 40×. (C–J) Scale bars = 20 µm.

In vitro differentiation of SKPs to muscle progenitors

SKPs were differentiated in the medium containing 2% FBS, 50 µM hydrocortisone IGF-1, FGF, after treatment with 5-azacytidine (Fig. 2A). After 12 days of culture, SKPs-derived skeletal myocytes adopted a bipolar morphology as compared with the morphology of SKPs (Fig. 2a1, 2a2). Moreover, some SKPs-derived myotubes could be spontaneous twitch (Supplementary Video 1). At 12 days after differentiation, Pax7⁺ muscle progenitors, desmin⁺, and TnT⁺ muscle cells were detected (Fig. 2B). In contrast, these proteins were not detected in undifferentiated SKPs (Supplementary Fig. 3). We further analyzed the expression of Pax3, desmin, Mstn, and Myog mRNAs using real-time RT-PCR following the induction of differentiation. As shown in Figure 2C, the expression levels of these genes were elevated in a time-dependent manner as compared to non-differentiated SKPs. At 12 days after differentiation, their expression levels were comparable to those found in myospheres, indicating the conversion of SKPs to muscle progenitors and muscle cells. We also determined the percentage of cells showing positive staining for myogenic markers. As shown in Figure 2D, 41% ± 11% of cells were Pax7⁺, 59% ± 20% of cells were desmin⁺, and 26% ± 4% of them were TnT⁺.

FIG. 2.

In vitro differentiation of skin-derived precursor cells (SKPs) into muscle progenitors. (A) Differentiation strategy for SKPs to muscle progenitors in vitro: (a1) the morphology of SKPs, (a2) the morphology of differentiated SKPs after 12 days. (B) Staining of muscle progenitor marker Pax7 and muscle markers (desmin and TnT) at 12 days post-differentiation. (C) Real-time RT-PCR to analyze the relative expression of muscle progenitor marker Pax3 and muscle markers (desmin, Mstn, and Myog) during differentiation in vitro, the relative gene expression level of desmin compared to actin in SKPs was defined to one. (D) Percentage of cells expressing Pax7, desmin, and TnT at 12 days after the induction of differentiation. (B) Scale bars = 20 µm.

The donor SKPs were localized to the niche of muscle progenitors after single point injection into recipient mice

To investigate the differentiation potential of SKPs to muscle progenitors in vivo, we transplanted GFP⁺ SKPs into recipient mice, following single point injections to TA muscles as described in Materials and Methods. To localize injected cells, we isolated SKPs from GFP transgenic mice, and found the GFP proteins expressed in their nuclei (Supplementary Fig. 4A). Three weeks postinjection, the recipient mice were analyzed for the existence of GFP⁺ cells in their muscles. Previous studies suggested that adult muscles contained two major types of progenitors that were involved in myogenesis [2,29 –31]. Satellite cells are localized in the basement membrane juxtaposed to muscle fibers and interstitial cells are localized in the interstitial spaces of skeletal muscle. In response to injury or following disruption of the basal lamina, satellite cells can fuse to form multinucleated myotubes. We analyzed the existence of GFP⁺ cells in these two regions of recipient muscle. We found that donor GFP⁺ cells were enriched in both regions at 3 weeks postinjection (Fig. 3A–3D, Supplementary Figs. 4B and 5A). The number of SKPs that localized to the niche of satellite cells per muscle was 2.67% ± 1.53%. Moreover, GFP⁺ cells could form multinucleated myotubes (Fig. 3G). The number of fibers derived from SKPs was 4.33% ± 1.53%, which is lower than those derived from myospheres (14.33% ± 2.52%). These results suggested that the injected cells could migrate to the niches of muscle progenitors in vivo.

FIG. 3.

Engraftment of green fluorescent protein positive (GFP⁺) donor cells to the niche of myogenic progenitors in recipient muscles. (A) Flow chart indicating steps for injection and sample analysis after administering skin-derived precursor cells (SKPs) into tibialis anterior muscle (TA). (B and C) GFP⁺ cells in the niche of satellite cells (white arrows) and interstitial cells of recipient muscles (green arrows). (D and E) Sections from control muscles 3 weeks postinjection showing the niche of satellite and interstitial cells. (F) The nuclei of GFP⁺ cells localized in the middle of recipient muscle fibers at 3 weeks after transplantation (arrowheads). (G) GFP⁺ cells can form myotubes at 3 weeks after transplantation and the nuclei of GFP⁺ cells localized in the middle of recipient muscle fibers at 3 weeks after transplantation (arrowheads). Scale bars = 20 µm, CTX (cardiotoxin).

In vivo differentiation of SKPs to muscle progenitors following single point injections into muscles of recipient mice

To further investigate the differentiation of SKPs in recipient mice, we focused on GFP⁺ cells localized to the niche of satellite cells. Immunostaining analysis indicated that injected GFP⁺ cells expressed multiple markers of satellite cells, including Pax7, M-cadherin, and MyoD. However, only a proportion of these donor GFP⁺ cells were localized in the niche of satellite cells expressing these markers (Fig. 4A, Supplementary Fig. 5B) with Pax7, M-cadherin, and MyoD expressed in 42% ± 5%, 39% ± 12%, and 57% ± 16% of GFP⁺ donor cells (Fig. 4B).

FIG. 4.

In vivo differentiation of skin-derived precursor cells (SKPs) to muscle progenitor through single point injection of SKPs to recipient mice. (A) Fluorescence of green fluorescent protein positive (GFP⁺) and staining of muscle progenitor markers including Pax7, M-cadherin, and MyoD in recipient muscle fibers at 3 weeks postinjection (arrows). (B) Percentage of GFP⁺/Pax7⁺, GFP⁺/M-cadherin⁺, and GFP⁺/MyoD⁺ cells in the niche of satellite cells 3 weeks post SKPs injection. Scale bars = 20 µm.

Three weeks postinjection, we recovered GFP⁺ donor cells from recipient muscles and analyzed the expression of muscle progenitor markers (Pax7 and MyoD) and muscle marker genes (desmin, Myog, and TnT) in the donor cells based on immunostaining. We found that all of these muscle progenitor markers and muscle genes were expressed in recovered GFP⁺ donor cells (Fig. 5). Because Pax7, desmin, and TnT were not expressed in SKPs (Supplementary Fig. 3), these results suggested that SKPs were converted to muscle progenitors and muscle cells in the recipient myogenic niche.

FIG. 5.

Expression of muscle progenitor makers and mature muscle markers in green fluorescent protein positive (GFP⁺) donor cells recovered from recipient mice at 3 weeks postinjection. Fluorescence of GFP and staining of muscle progenitor markers Pax7 and MyoD, and mature muscle genes (desmin, Myog, and TnT) in recovered donor cells at 3 weeks postinjection. GFP⁻ cells from host mice also expressed these myogenic markers (arrows). Scale bars = 20 µm.

SKP-derived donor cells participate in the regeneration of recipient muscles and their long-time retention in recipient muscles at 20 weeks postinjection

We investigated whether the injected donor cells could participate in the regeneration of recipient muscle. Previous studies indicated that activated satellite cells could fuse to form a new fiber, and the nuclei derived from satellite cells were centrally located [31]. We found that there were GFP⁺ donor cells in the middle of the recipient muscle fibers, suggesting the involvement of donor cells in the regeneration of recipient muscle (Fig. 3B). More importantly, we found that there were still GFP⁺ donor cells present in recipient muscles at 20 weeks after injection (Fig. 6A) and most of them were localized in the niche of satellite cells (Fig. 6A). We further calculated the percentage of GFP⁺ donor cells in the niche of satellite cells (Fig. 6B). Compared with 3 weeks postinjection, the percentage of GFP⁺ donor cells at 20 weeks after injection did not show a decrease, suggesting the stable retention of these injected cells in recipient muscle.

FIG. 6.

Prolonged and stable retentions of green fluorescent protein positive (GFP⁺) cells in the satellite cell niche of muscles in recipient mice. (A) Detection of transplanted GFP⁺ cells in muscle fibers of recipient muscles 3 weeks postinjection (arrows). (B) Detection of transplanted GFP⁺ cells in recipient muscles 20 weeks postinjection (arrows). (C) Percentage of GFP⁺ cells localized in satellite cell niche at 3 and 20 weeks postinjection. Scale bars = 20 µm.

Discussion

Although ES cells are widely accepted as pluripotent cells with the potential to differentiate into different lineages after transplantation, the differentiation of ES cells toward muscle progenitors is still difficult [18,19,32]. It is possible that ES cell differentiation does not recapitulate the earlier differentiation of embryos and lacks the production of somites, where the signals for the derivation of muscle progenitors are originated [33]. In our study, we compared the spontaneous differentiation of ES and SKPs into muscle progenitors in vitro. Our results suggested that genes expressed in muscle progenitors, such as Pax7 and Myf5, were highly expressed during SKPs differentiation (Supplementary Fig. 1). These data suggested that SKPs were capable of differentiating into muscle progenitors. Moreover, we observed a relative high efficiency of SKPs differentiation into muscle progenitors and muscle cells in vitro and in vivo (Figs. 2 and 4). An explanation for the differentiation preference of SKPs to muscle progenitors was that the developmental origin of SKPs and muscle progenitors are similar. As SKPs are derived from dermal papilla [34 –37], whereas dermis originates from dermomyotome, and muscles originate from the border of dermomyotome [33].

The use of ES-derived cells for the treatment of degenerative muscle diseases is hampered by the complicated methods needed for the isolation and enrichment of EB-derived cells, the low efficiency of ES cell differentiation into muscle progenitors, and the formation of teratomas after transplantation [19]. SKPs could be freshly isolated and could provide autologous cells for transplantation [20,21]. Here we successfully differentiated SKPs into muscle progenitors through a simple protocol with a relatively high efficiency and these SKP-derived muscle progenitors were stably retained in recipient muscles without tumor formation at 20 weeks post-transplantation. These data indicated that SKPs-derived muscle cells could be a promising source for cell transplantation-based therapy.

After transplantation of GFP⁺ SKPs to recipient mice, the GFP⁺ cells could migrate to the niche of muscle progenitors, as earlier as 3 weeks postinjection (Fig. 3B and 3C). After recovery of GFP⁺ cells following dissociation of the recipient muscles, most of these GFP⁺ cells expressed muscle progenitor markers including Pax7 and MyoD. Some of these recollected cells also expressed mature muscle markers including desmin, Myog, and TnT. These findings demonstrated that SKPs could differentiate into muscle cells in vivo.

We did not detect specific localization of GFP⁺ cells in other tissues of recipient mice at 3 weeks postinjection (data not shown), suggesting that SKPs could specifically migrate to the niche of muscle progenitors, after damage was induced by CTX in the recipient muscle. In previous studies, hematopoietic stem cells were found to migrate to their niche in bone marrow, after transplantation into irradiated recipient mice [38 –40]. In this process, the homing efficiency was regarded as one major criterion to influence transplantation efficiency and therapy. Here, we found a very quick and efficient localization of donor GFP⁺ SKPs into the niche of muscle progenitors of recipient mice (Fig. 3). It is possible that damage induced by CTX in recipient muscle led to the release of chemokines that attracted the donor SKPs, due to their expression of unique plasma membrane proteins [41,42]. Because we did not observe any prominent localization of GFP⁺ cells in muscles of recipient mice without CTX-induced damaged (data not shown), the migration of SKPs to the damaged muscle is likely to be an active process.

In summary, we induced the differentiation of skin-derived progenitors from GFP⁺ transgenic and detected the long-term retention of injected GFP⁺ cells in the niche of muscle progenitors of recipient mice up to 20 weeks postinjection (Fig. 6). And the population size of these donor cells did not decrease with time. This finding indicated the efficient conversion of SKPs to muscle progenitor cells in vivo. Our studies suggested that SKPs could be to a promising source for cell transplantation-based treatment for muscle diseases.

Footnotes

Acknowledgments

We thank Professor Aaron Hsueh (Stanford University) for reading the manuscript. This work was supported by the National Basic Research Program of China (2007CB947401, 2006CB944006) and Chinese National Manned Space Program (Project 921-2).

References

Meeson

, Hawke

, Graham

, Jiang

, Elterman

, Hutcheson

, Dimaio

, Gallardo

and Garry

. (2004). Cellular and molecular regulation of skeletal muscle side population cells. Stem Cells, 22:1305–1320.

Tamaki

, Akatsuka

, Ando

, Nakamura

, Matsuzawa

, Hotta

, Roy

and Edgerton

. (2002). Identification of myogenic-endothelial progenitor cells in the interstitial spaces of skeletal muscle. J Cell Biol, 157:571–577.

Seale

, Sabourin

, Girgis-Gabardo

, Mansouri

, Gruss

and Rudnicki

. (2000). Pax7 is required for the specification of myogenic satellite cells. Cell, 102:777–786.

Montarras

, Morgan

, Collins

, Relaix

, Zaffran

, Cumano

, Partridge

and Buckingham

. (2005). Direct isolation of satellite cells for skeletal muscle regeneration. Science, 309:2064–2067.

Mangiacapra

, Roof

, Ewton

and Florini

. (1992). Paradoxical decrease in myf-5 messenger RNA levels during induction of myogenic differentiation by insulin-like growth factors. Mol Endocrinol, 6:2038–2044.

Beauchamp

, Heslop

, Yu

, Tajbakhsh

, Kelly

, Wernig

, Buckingham

, Partridge

and Zammit

. (2000). Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J Cell Biol, 151:1221–1234.

Kuang

, Kuroda

, Le

and Rudnicki

. (2007). Asymmetric self-renewal and commitment of satellite stem cells in muscle. Cell, 129:999–1010.

Fukada

, Miyagoe-Suzuki

, Tsukihara

, Yuasa

, Higuchi

, Ono

, Tsujikawa

, Takeda

and Yamamoto

. (2002). Muscle regeneration by reconstitution with bone marrow or fetal liver cells from green fluorescent protein-gene transgenic mice. J Cell Sci, 115:1285–1293.

Zammit

, Golding

, Nagata

, Hudon

, Partridge

and Beauchamp

. (2004). Muscle satellite cells adopt divergent fates: a mechanism for self-renewal. J Cell Biol, 166:347–357.

10.

Sherwood

, Christensen

, Conboy

, Rando

, Weissman

and Wagers

. (2004). Isolation of adult mouse myogenic progenitors: functional heterogeneity of cells within and engrafting skeletal muscle. Cell, 119:543–554.

11.

Cerletti

, Jurga

, Witczak

, Hirshman

, Shadrach

, Goodyear

and Wagers

. (2008). Highly efficient, functional engraftment of skeletal muscle stem cells in dystrophic muscles. Cell, 134:37–47.

12.

Sacco

, Doyonnas

, Kraft

, Vitorovic

and Blau

. (2008). Self-renewal and expansion of single transplanted muscle stem cells. Nature, 456:502–506.

13.

Torrente

, Tremblay

, Pisati

, Belicchi

, Rossi

, Sironi

, Fortunato

, El Fahime

, MG

D’Angelo

, Caron

, Constantin

, Paulin

, Scarlato

and Bresolin

. (2001). Intraarterial injection of muscle-derived CD34(+)Sca-1(+) stem cells restores dystrophin in mdx mice. J Cell Biol, 152:335–348.

14.

Sampaolesi

, Torrente

, Innocenzi

, Tonlorenzi

, G

D’Antona

, Pellegrino

, Barresi

, Bresolin

, De Angelis

, Campbell

, Bottinelli

and Cossu

. (2003). Cell therapy of alpha-sarcoglycan null dystrophic mice through intra-arterial delivery of mesoangioblasts. Science, 301:487–492.

15.

Ferrari

, Cusella-De

, Coletta

, Paolucci

, Stornaiuolo

, Cossu

and Mavilio

. (1998). Muscle regeneration by bone marrow-derived myogenic progenitors. Science, 279:1528–1530.

16.

LaBarge

and Blau

. (2002). Biological progression from adult bone marrow to mononucleate muscle stem cell to multinucleate muscle fiber in response to injury. Cell, 111:589–601.

17.

Dezawa

, Ishikawa

, Itokazu

, Yoshihara

, Hoshino

, Takeda

, Ide

and Nabeshima

. (2005). Bone marrow stromal cells generate muscle cells and repair muscle degeneration. Science, 309:314–317.

18.

Barberi

, Bradbury

, Dincer

, Panagiotakos

, Socci

and Studer

. (2007). Derivation of engraftable skeletal myoblasts from human embryonic stem cells. Nat Med, 13:642–648.

19.

Darabi

, Gehlbach

, Bachoo

, Kamath

, Osawa

, Kamm

, Kyba

and Perlingeiro

. (2008). Functional skeletal muscle regeneration from differentiating embryonic stem cells. Nat Med, 14:134–143.

20.

Toma

, Akhavan

, Fernandes

, Barnabe-Heider

, Sadikot

, Kaplan

and Miller

. (2001). Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol, 3:778–784.

21.

Toma

, McKenzie

, Bagli

and Miller

. (2005). Isolation and characterization of multipotent skin-derived precursors from human skin. Stem. Cells, 23:727–737.

22.

Guo

, Miao

, Liu

, Qiu

, Li

and Duan

. (2009). Efficient differentiation of insulin-producing cells from skin-derived stem cells. Cell Prolif, 42:49–62.

23.

Nomura

, Ashihara

, Tateishi

, Asada

, Ueyama

, Takahashi

, Matsubara

and Oh

. (2007). Skeletal myosphere-derived progenitor cell transplantation promotes neovascularization in delta-sarcoglycan knockdown cardiomyopathy. Biochem Biophys Res Commun, 352:668–674.

24.

Gadue

, Huber

, Paddison

and Keller

. (2006). Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Proc Natl Acad Sci USA, 103:16806–16811.

25.

Gouon-Evans

, Boussemart

, Gadue

, Nierhoff

, Koehler

, Kubo

, Shafritz

and Keller

. (2006). BMP-4 is required for hepatic specification of mouse embryonic stem cell-derived definitive endoderm. Nat Biotechnol, 24:1402–1411.

26.

Chapman

, Agulnik

, Hancock

, Silver

and Papaioannou

. (1996). Tbx6, a mouse T-Box gene implicated in paraxial mesoderm formation at gastrulation. Dev Biol, 180: 534–542.

27.

White

, Farkas

, McFadden

and Chapman

. (2003). Defective somite patterning in mouse embryos with reduced levels of Tbx6. Development, 130:1681–1690.

28.

Kondo

, Case

, Srour

and Hashino

. (2006). Skeletal muscle-derived progenitor cells exhibit neural competence. Neuroreport, 17:1–4.

29.

Qu-Petersen

, Deasy

, Jankowski

, Ikezawa

, Cummins

, Pruchnic

, Mytinger

, Cao

, Gates

, Wernig

and Huard

. (2002). Identification of a novel population of muscle stem cells in mice: potential for muscle regeneration. J Cell Biol, 157:851–864.

30.

Dreyfus

, Chretien

, Chazaud

, Kirova

, Caramelle

, Garcia

, Butler-Browne

and Gherardi

. (2004). Adult bone marrow-derived stem cells in muscle connective tissue and satellite cell niches. Am J Pathol, 164:773–779.

31.

Sambasivan

and Tajbakhsh

. (2007). Skeletal muscle stem cell birth and properties. Semin Cell Dev Biol, 18:870–882.

32.

Murry

and Keller

. (2008). Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development. Cell, 132:661–680.

33.

Bailey

, Holowacz

and Lassar

. (2001). The origin of skeletal muscle stem cells in the embryo and the adult. Curr Opin Cell Biol, 13:679–689.

34.

Fernandes

, McKenzie

, Mill

, Smith

, Akhavan

, Barnabe-Heider

, Biernaskie

, Junek

, Kobayashi

, Toma

, Kaplan

, Labosky

, Rafuse

, Hui

and Miller

. (2004). A dermal niche for multipotent adult skin-derived precursor cells. Nat Cell Biol, 6:1082–1093.

35.

Hunt

, Morris

, Sterling

, Anderson

, Joannides

, Jahoda

, Compston

and Chandran

. (2008). A highly enriched niche of precursor cells with neuronal and glial potential within the hair follicle dermal papilla of adult skin. Stem Cells, 26:163–172.

36.

Kubo

, Yoshida

, Kobayashi

, Yokoyama

, Mimura

, Nishiguchi

, Higashida

, Yamamoto

and Kanno

. (2009). Efficient generation of dopamine neuron-like cells from skin-derived precursors with a synthetic peptide derived from von Hippel-Lindau protein. Stem Cells Dev [Epub ahead of print].

37.

Valenzuela

, Dean

, Sachdev

, Tuch

and Sidhu

. (2008). Neural precursors from canine skin: a new direction for testing autologous cell replacement in the brain. Stem Cells Dev, 17:1087–1094.

38.

and Zhao

. (2008). Epigenetic regulation of mammalian stem cells. Stem Cells Dev, 17:1043–1052.

39.

Benveniste

, Cantin

, Hyam

and Iscove

. (2003). Hematopoietic stem cells engraft in mice with absolute efficiency. Nat Immunol, 4:708–713.

40.

Ema

and Nakauchi

. (2004). “Homing to Niche,” a new criterion for hematopoietic stem cells?. Immunity, 20:1–2.

41.

Torrente

, Camirand

, Pisati

, Belicchi

, Rossi

, Colombo

, El

, Caron

, Issekutz

, Constantin

, Tremblay

and Bresolin

. (2003). Identification of a putative pathway for the muscle homing of stem cells in a muscular dystrophy model. J Cell Biol, 162:511–520.

42.

Lavoie

, Biernaskie

, Chen

, Bagli

, Alman

, Kaplan

and Miller

. (2008). Skin-derived precursors differentiate into skeletogenic cell types and contribute to bone repair. Stem Cells Dev [Epub ahead of print].