Inhibition of Lnk in Mouse Induced Pluripotent Stem Cells Promotes Hematopoietic Cell Generation

Abstract

Embryonic stem (ES) cell- and induced pluripotent stem (iPS) cell-derived hematopoietic stem/progenitor cells (HSPCs) are considered as an unlimited source for HSPC transplantation. However, production of immature hematopoietic cells, especially HSPCs, from ES and iPS cells has been challenging. The adaptor protein Lnk has been shown to negatively regulate HSPC function via the inhibition of thrombopoietin (TPO) and stem cell factor signaling, and Lnk-deficient HSPCs show an enhanced self-renewal and repopulation capacity. In this study, we examined the role of Lnk on the hematopoietic differentiation from mouse ES and iPS cells by the inhibition of Lnk using a dominant-negative mutant of the Lnk (DN-Lnk) gene. We generated mouse ES and iPS cells stably expressing a DN-Lnk, and found that enforced expression of a DN-Lnk in ES and iPS cells led to an enhanced generation of Flk-1-positive mesodermal cells, thereby could increase in the expression of hematopoietic transcription factors, including Scl and Runx1. We also showed that the number of both total hematopoietic cells and immature hematopoietic cells with colony-forming potential in DN-Lnk-expressing cells was significantly increased in comparison with that in control cells. Furthermore, Lnk inhibition by the overexpression of the DN-Lnk gene augmented the TPO-induced phosphorylation of Erk1/2 and Akt, indicating the enhanced sensitivity to TPO. Adenovirus vector-mediated transient DN-Lnk gene expression in ES and iPS cells could also increase the hematopoietic cell production. Our data clearly showed that the inhibition of Lnk in ES and iPS cells could result in the efficient generation and expansion of hematopoietic cells.

Introduction

S ince embryonic stem (ES) cells and induced pluripotent stem (iPS) cells can self-renew indefinitely and differentiate into all types of cells in the 3 germ layers, they are expected to have clinical applications in cell-based therapies [1 –4]. For instance, ES cell- and iPS cell-derived hematopoietic cells are considered as an alternative source of adult hematopoietic cells for the treatment of hematological disorders and malignancies. Many groups have reported the differentiation of ES and iPS cells into mature hematopoietic cells, including erythrocytes, myeloid cells, and lymphoid cells [5 –10]. However, previous reports have described the generation of only small numbers of mature hematopoietic cells, probably as a result of inefficient generation and expansion of immature hematopoietic cells derived from pluripotent stem cells. Therefore, the use of ES cell- and iPS cell-derived hematopoietic cells as a cell source for therapeutic applications depends on the efficient production of hematopoietic cells, especially immature hematopoietic cells, from pluripotent stem cells.

Recently, inhibitors of differentiation (ID) genes, which are negative regulators of E proteins (E2A, HEB, and E2-2) [11], were shown to negatively regulate the hematopoietic differentiation in ES and iPS cells [12]. The same study also showed that the suppression of the ID genes, ID1 and ID3 increased the number of ES and iPS cell-derived hematopoietic progenitor cells [12]. These data indicate that negative regulators play an important role in the hematopoietic differentiation process in ES and iPS cells, and that manipulation of the expression of negative regulators would be an effective strategy for the efficient generation of hematopoietic cells from ES and iPS cells.

An adaptor protein Lnk/SH2B3 (hereafter referred to Lnk) is shown to negatively regulate the thrombopoietin (TPO) and stem cell factor (SCF) signaling, both of which are crucial cytokine-signaling pathways involved in hematopoietic stem cell (HSC) self-renewal, since Lnk-deficient HSCs exhibit an augmented response to TPO and SCF stimulation, and thereby Lnk-deficient mice show the marked HSC expansion in the bone marrow [13 –16]. In addition, Lnk is highly expressed in immature hematopoietic cells, particularly in HSCs [17], in contrast to ID genes, which are ubiquitously expressed in many tissues [11,18]. Therefore, we speculated that an inhibition of Lnk function in ES and iPS cells would lead to the efficient generation and expansion of immature hematopoietic cells. In the present study, we investigated the effects of Lnk inhibition on the hematopoietic differentiation of mouse ES and iPS cells, and we found that a suppression of Lnk function by the enforced expression of a dominant-negative mutant of the Lnk (DN-Lnk) gene in ES and iPS cells resulted in an increase in the number of both mesodermal cells with hematopoietic differentiation potential and immature hematopoietic cells. These findings indicate that the suppression of the Lnk would be useful for the efficient generation and expansion of ES cell- and iPS cell-derived hematopoietic cells.

Materials and Methods

Plasmid construction and adenovirus vectors

pEF-IRESneo, which contains internal ribosome entry sites (IRES) and a neomycin-resistant gene (Neo) downstream of the human elongation factor (EF)-1α promoter, was constructed by replacing the cytomegalovirus (CMV) promoter of pIRESneo (Clontech) with the EF-1α promoter, which is derived from pEF/myc/nuc (Invitrogen). Mouse DN-Lnk cDNA, derived from pMY-DN-Lnk [19], was inserted into pEFIRESneo, resulting in pEF-DNLnk-IRESneo. Adenovirus (Ad) vectors were constructed by an improved in vitro ligation method [20,21]. Mouse DN-Lnk cDNA was inserted into pHMCA5 [22], which contains the CMV enhancer/β-actin promoter with an β-actin intron (CA) promoter (a kind gift from Dr. J. Miyazaki, Osaka University) [23], resulting in pHMCA5-DN-Lnk. pHMCA5-DN-Lnk was digested with I-CeuI/PI-SceI and ligated into I-CeuI/PI-SceI-digested pAdHM4 [20], resulting in pAd-DN-Lnk. Ad-DN-Lnk and Ad-DsRed were generated and purified as described previously [24]. The CA promoter-driven β-galactosidase (LacZ)-expressing Ad vector, Ad-LacZ, and the CA promoter-driven DsRed-expressing Ad vector, Ad-DsRed, were generated previously [24,25]. The vector particle (VP) titer was determined using a spectrophotometric method [26].

Cell culture

The mouse ES cell line, BRC6 (Riken Bioresource Center), and the mouse iPS cell line, 38C2 (a kind gift from Dr. S. Yamanaka, Kyoto University) [27], were used in this study. DN-Lnk- or Neo-expressing mouse ES and iPS cell lines were generated as follows. The pEF-IRESneo and pEF-DNLnk-IRESneo were linearized and were then electroporated into mouse ES cells and iPS cells by using Gene Pulser Xcell (250 V, 500 μF; Bio-Rad Laboratory). pEF-IRESneo- or pEF-DNLnk-IRESneo-transfected ES cells and iPS cells were cultured in an ES cell medium containing 100 μg/mL G418 (for ES cells) or 200 μg/mL G418 (for iPS cells) for 10–14 days, and G418-resistant colonies were picked up and expanded. The expression of DN-Lnk was confirmed by conventional reverse transcription–polymerase chain reaction (RT-PCR). Mouse ES cells, iPS cells, and Neo- or DN-Lnk-expressing mouse ES and iPS cells were cultured in a leukemia inhibitory factor-containing ES cell medium (Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEFs) [28]. OP9 stromal cells were cultured in an α-minimum essential medium (α-MEM; Sigma) supplemented with 20% fetal bovine serum (FBS), 2 mM l-glutamine (Invitrogen), and nonessential amino acid (Invitrogen).

In vitro hematopoietic differentiation

For embryoid body (EB) differentiation, mouse ES and iPS cells were trypsinized and collected in an EB medium (EBM) containing the Dulbecco's modified Eagle's medium (Wako) supplemented with 15% FBS, non-essential amino acids (Millipore), penicillin/streptomycin (Invitrogen), 2 mM l-glutamine, and 100 μM β-mercaptoethanol (Nacalai Tesque), and they were plated on a culture dish for 30 min to allow the MEFs to adhere. Nonadherent cells were collected and plated on a round-bottom Lipidure-coated 96-well plate (Nunc) at 3×10³ cells (ES cells) or 1×10³ (iPS cells) cells per well. On day 5, half of the medium was exchanged for fresh EBM. EBs were collected on day 7, and a single-cell suspension was prepared by the use of trypsin/ethylenediaminetetraacetic acid. The EB-derived cells (4×10⁵ cells) were plated on OP9 stromal cells in the wells of a 6-well plate and were then cultured with an OP9 medium containing recombinant hematopoietic cytokines [100 ng/mL mouse SCF, 100 ng/mL human Flt3-ligand, 20 ng/mL mouse TPO, 5 ng/mL mouse interleukin (IL)-3, and 5 ng/mL human IL-6] to induce and expand the hematopoietic cells. In the case of DN-Lnk transduction using the Ad vector, EB-derived cells were transduced with Ad-LacZ or Ad-DN-Lnk at 3,000 VP/cell for 1.5 h in a 15-mL tube before the transduced EB-derived cells plating on OP9 cells. Hematopoietic cells were collected as described previously [25]. In brief, the floating and loosely attached cells were collected by pipetting and were transferred to 15-mL tubes. The adherent hematopoietic cells were harvested by trypsin treatment, and were then incubated in a tissue culture dish for 30–60 min to eliminate the OP9 stromal cells. Floating cells were collected as hematopoietic cells and transferred to the same 15-mL tubes. These hematopoietic cells were kept on ice for further analysis.

Flow cytometry

The following primary monoclonal antibodies (Abs), conjugated with fluorescein isothiocyanate, phycoerythrin, or allophycocyanin, were used for flow cytometric analysis: anti-CD45 (30-F11; eBioscience), anti-CD11b (M1/70; eBioscience), anti-Sca-1 (D7; eBioscience), anti-Ter119 (Ter-119; eBioscience), anti-CD34 (RAM34; eBioscience), anti-CXCR4 (2B11; BD Bioscience), anti-Gr-1 (RB6-8C5; eBioscience), anti-c-Kit (ACK2 or 2B8; eBioscience), and anti-CD41 (MWReg30; BD Bioscience). Purified rat anti-mouse c-Mpl/TPOR monoclonal Ab was obtained from IBL. Cells (1×10⁵–5×10⁵) were incubated with monoclonal Abs at 4°C for 30 min and washed twice with a staining buffer (phosphate-buffered saline/2% FBS). For detection of Mpl/TPOR, Dylight649-conjugated goat anti-rat IgG (BioLegend) was used as a secondary Ab. After staining, the hematopoietic cells were analyzed and isolated by flow cytometry on an LSR II and FACSAria flow cytometer, respectively, using FACSDiva software (BD Bioscience).

Colony assay and May-Giemsa staining

The cells (5×10⁴ cells) were cultured in a Methocult M3434 medium containing IL-3, IL-6, SCF, and erythropoietin (StemCell Technologies, Inc.) for 10 days. The number of individual colonies was counted by microscopy. The colony number was normalized to the total number of hematopoietic cells. The multipotent hematopoietic progenitor cell-derived colonies (colony-forming unit–granulocyte, erythrocyte, monocyte, megakaryocyte (CFU-GEMM)/CFU-Mix) were picked up, fixed on glass slides using a cytospin centrifuge (Cytospin 4; Thermo Shandon), and stained with May-Grünwald Stain solution (Sigma) and Giemsa solution (Wako).

Western blotting

The adherent hematopoietic cells and OP9 stromal cells were collected, and were then incubated in a new tissue culture dish for 40 min to eliminate adherent OP9 cells. Floating cells were harvested and were subsequently starved in an RPMI1640 medium containing 0.1% FBS and penicillin/streptomycin for 4–6 h. Cells were stimulated with 20 ng/mL TPO for 10 min (for Jak2) or 30 min (for Erk and Akt) before being lyzed in a lysis buffer [20 mM Tris–HCl (pH 8.0), 137 mM NaCl, 1% Triton X-100, 10% glycerol] containing a protease inhibitor cocktail (Sigma) and a phosphatase inhibitor cocktail (Nacalai Tesque). Cell lysates were loaded onto polyacrylamide gels and were transferred to a polyvinylidene fluoride membrane (Millipore). After blocking, the membrane was exposed to mouse anti-phospho-Erk1/2 (Cell Signaling), rabbit anti-Erk1/2 (Sigma), mouse anti-phospho-Akt (Cell Signaling), rabbit anti-total Akt (Cell Signaling), rabbit anti-phospho-Jak2 (Tyr1007/1008; Cell Signaling), or rabbit anti-Jak2 (Cell Signaling), followed by horseradish peroxidase-conjugated secondary antibody. The band was visualized by ECL Plus Western blotting detection reagents (GE Healthcare) or Pierce Western Blotting Substrate Plus (Thermo Scientific), and the signals were read using an LAS-3000 imaging system (Fujifilm).

Reverse transcription–polymerase chain reaction

RT-PCR was carried out as described previously [25]. The sequences of the primers used in this study are listed in Table 1.

Table 1.

List of Primers Used for Reverse Transcription–Polymerase Chain Reaction

Gene name	(5′) Sense primers (3′)	(5′) Antisense primers (3′)
Gapdh	ACCACAGTCCATGCCATCAC	TCCACCACCCTGTTGCTGTA
Flk-1	TCTGTGGTTCTGCGTGGAGA	GTATCATTTCCAACCACCC
Lnk	GCCACTTTCTGCAGCTCTTC	GTCCAGGGAGTCAGTGCTTC
Lnk (for real-time)	AGCCACTTTCTGCAGCTCTTC	GTAGAGGTTGTCAGGCATCTCC
DN-Lnk	GGGCTACCAGTGACACCAAT	CACTGTCCACGCTCTGTGAG
Oct-3/4	GTTTGCCAAGCTGCTGAAGC	TCTAGCCCAAGCTGATTGGC
Nanog	ATGGTCTGATTCAGAAGGGC	TTCACCTCCAAATCACTGGC
β-H1	AGTCCCCATGGAGTCAAAGA	CTCAAGGAGACCTTTGCTCA
β-major	CTGACAGATGCTCTCTTGGG	CACAACCCCAGAAACAGACA
Scl/Tal-1	AACAACAACCGGGTGAAGAG	GGGAAAGCACGTCCTGTAGA
Runx1	CTTCCTCTGCTCCGTGCTAC	GACGGCAGAGTAGGGAACTG
Gata1	TTGTGAGGCCAGAGAGTGTG	TTCCTCGTCTGGATTCCATC
Gata2	TAAGCAGAGAAGCAAGGCTCGC	ACAGGCATTGCACAGGTAGTGG
Fli1	CCAACGAACGGAGAGTCATT	ATTCCTTGCCATCCATGTTC
Erg	GGAGCTGTGCAAGATGACAA	GATTAGCAAGGCGGCTACTG
Erg (for real-time)	GGAGTGCAACCCTAGTCAGG	TAGCTGCCGTAGCTCATCC
Sfpi1	CCATAGCGATCACTACTGGGATTT	TGTGAAGTGGTTCTCAGGGAAGT
E47	ATACAGCGAAGGTGCCCACT	CTCAAGGTGCCAACACTGGT

Results

Expression of Lnk in mouse ES and iPS cells

We initially investigated Lnk expression in mouse ES cells, iPS cells, ES cell-derived EBs (ES-EBs), and iPS-EBs. As shown in Fig. 1a, Lnk was expressed in undifferentiated ES and iPS cells, and the expression levels of Lnk were significantly increased after EB formation. We further examined whether Lnk was expressed in Flk-1-positive (⁺) cells, because hematopoietic cells were generated from Flk-1⁺ cells, a common hemoangiogenic progenitor during ES cell differentiation [29 –31]. Quantitative RT-PCR analysis after the purification of Flk-1⁺ cells from ES-EBs and iPS-EBs revealed that Lnk was highly expressed in Flk-1⁺ cells (Fig. 1b). These data suggest that Lnk plays some role in the hematopoietic differentiation process in ES and iPS cells.

FIG. 1.

Lnk is expressed in mouse ES cells, iPS cells, and Flk-1⁺ hemoangiogenic progenitor cells. (a) Total RNA was extracted from undifferentiated ES cells, ES cell-derived EBs cultured for 5, 7, or 9 days (5-day ES-EBs, 7-day ES-EBs, 9-day ES-EBs, respectively), undifferentiated iPS cells, 5-day iPS-EBs, 7-day iPS-EBs, or 9-day iPS-EBs. Then, conventional (above) and quantitative (below) RT-PCR analysis was carried out. Results shown were the mean of 3 independent experiments with indicated SD. *p<0.05, **p<0.01 as compared with undifferentiated ES cells or iPS cells. (b) Flk-1⁺ and Flk-1⁻ cells were sorted from 7-day ES-EBs or 7-day iPS-EBs using FACSAria. The purity of the Flk-1⁺ and Flk-1⁻ cells exceeded 90% and 95%, respectively (data not shown). Total RNA was extracted from both types of cell, and the expression of Lnk was examined by conventional (left) and quantitative (right) RT-PCR analysis. The data were expressed as mean±SD (n=3); *p<0.05 as compared with Flk-1⁻ cells. ES, embryonic stem; EBs, embryoid bodies; iPS, induced pluripotent stem; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription–polymerase chain reaction, SD, standard deviation.

Enhanced mesodermal differentiation in EB by the inhibition of Lnk

The data described above led to the expectation that hematopoietic cells, including hematopoietic progenitor cells, could be efficiently generated from ES cells and iPS cells by the suppression of Lnk. To inhibit the function of Lnk, we utilized the DN-Lnk gene, which was developed by Takizawa et al. [19]. DN-Lnk binds to Lnk, and forms a multimer complex by a homophilic interaction with the N-terminal domain, thereby inhibiting Lnk function [19]. DN-Lnk-expressing ES and iPS cells were generated by introducing a DN-Lnk-expressing plasmid, and DN-Lnk mRNA expression was confirmed by RT-PCR (Fig. 2a). In this report, we present data from one DN-Lnk-expressing ES and iPS cell clone, because the same results were obtained from other DN-Lnk-expressing clones. Notably, the expression levels of wild-type Lnk in DN-Lnk-expressing cells were similar to those in Neo-expressing cells and their parent cells (Fig. 2a). DN-Lnk-expressing iPS cells maintained the undifferentiated state in culture and possessed pluripotency, as demonstrated by alkaline phosphatase staining, immunostaining, and teratoma formation (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/scd). Hence, ectopic expression of the DN-Lnk gene in ES and iPS cells would not affect their function.

FIG. 2.

Increased expression of hematopoietic transcription factors in DN-Lnk-expressing EB cells. (a) DN-Lnk-expressing ES cells and iPS cells were generated as described in the Materials and Methods section. DN-Lnk expression was confirmed by RT-PCR. (b) EB cells, which were cultured for 7 days, were stained with anti-mouse Flk-1 antibody, and were then subjected to flow cytometric analysis. The data were expressed as the mean±SD (n=3). (c) The expression level of hematopoietic marker genes in 7-day iPS-EBs were investigated by semiquantitative RT-PCR analysis. The left panel indicates the parent iPS cell (38C2)-derived 7-day EBs. (d) Gene expression analysis of the key transcription factors of hematopoietic stem/progenitor cells in total 7-day ES-EBs (left) and 7-day iPS-EBs (right). The data were expressed as mean±SD (n=3); *p<0.05 as compared with Neo. (e) After Flk-1⁺ cells were sorted from Neo- or DN-Lnk-expressing 7-day EB cells, quantitative RT-PCR analysis was performed. Left, ES-EB-derived Flk-1⁺ cells; right, iPS-EB-derived Flk-1⁺ cells.

Next, we generated EBs to induce mesodermal cells from DN-Lnk- or Neo-expressing ES and iPS cells. EBs were cultured for 7 days, because the proportion of Flk-1⁺ cells in EBs increased to a peak on day 7, and decreased over the next 2 days in our culture conditions (Supplementary Fig. S2). We found that DN-Lnk-expressing cells on day 7 of the EB culture yielded a modest increase in the number of Flk-1⁺ hemangiogenic progenitor cells relative to that of Neo-expressing cells (Fig. 2b). Interestingly, elevated expression of Scl/Tal-1, Runx1, and Gata-1 was observed in DN-Lnk-expressing total EB cells (Fig. 2c). Besides the expression levels of these genes, those of other key transcription factors of blood stem/progenitor cells, including Gata-2, Fli-1, and Erg [32], in DN-Lnk-expressing cells were also upregulated in comparison with those in Neo-expressing cells (Fig. 2d). To examine whether increased expression of these transcription factors in DN-Lnk-expressing cells was due to the increased generation of Flk-1⁺ cells, we performed the gene expression analysis after purification of Flk-1⁺ cells from DN-Lnk- or Neo-expressing total EB cells (Fig. 2e). No difference in the expression of Runx1, Gata-1, Gata-2, Fli-1, or Erg was observed between DN-Lnk-expressing cells and Neo-expressing cells, indicating that elevated expression of these hematopoietic genes in DN-Lnk-expressing EB cells would be largely because of the increased population of Flk-1⁺ cells. On the other hand, DN-Lnk-expressing Flk-1⁺ cells showed a 2-fold increase in the expression of Scl/Tal-1, an essential transcription factor for the hematopoietic development [33,34], compared with Neo-expressing Flk-1⁺ cells. The increased Scl/Tal-1 expression thus suggests that an inhibition of Lnk in Flk-1⁺ cells might contribute to enhance the production of hematopoietic progenitor cells. Taken together, these results raise the possibility that mesodermal cells with a hematopoietic differentiation potential would be efficiently generated in DN-Lnk-expressing cells during EB formation.

Inhibition of Lnk function increases the production of hematopoietic cells

To induce hematopoietic cells, EB-derived cells were cultured on OP9 stromal cells in the presence of hematopoietic cytokines. During culture, cobblestone-forming cells were more frequently observed in DN-Lnk-expressing cells than in Neo-expressing cells (Fig. 3a), indicating that DN-Lnk-expressing cells were immature hematopoietic cells with expansion potential. In support of this observation, DN-Lnk-expressing cells showed a significant increase in the number of hematopoietic cells compared to that of Neo-expressing cells (Fig. 3b). Importantly, compared to Neo-expressing cells, DN-Lnk-expressing cells could more efficiently proliferate on OP9 stromal cells for a period exceeding 14 days (Fig. 3b). Therefore, the proliferation of hematopoietic cells could be augmented by the inhibition of Lnk.

FIG. 3.

Efficient generation of hematopoietic cells from iPS cells by overexpression of the DN-Lnk gene. EBs derived from Neo- or DN-Lnk-expressing iPS cells were cultured for 7 days, and were then plated and cultured on OP9 cells with hematopoietic cytokines to induce and expand the hematopoietic cells. (a) Morphology of cobblestone-forming cells derived from DN-Lnk-expressing cells on OP9 stromal cells. Scale bar indicates 100 μm. (b) The number of hematopoietic cells was counted on days 7 and 14, after the EB cells were plated on OP9 cells. The data were expressed as mean±SD (n=3); *p<0.05 as compared with Neo. (c) Seven-day-cultured EB cells (7-day EBs) were cultured on OP9 cells for 3 or 6 days (OP9-d3 or OP9-d6, respectively). Total RNA was extracted from each cell, and the expression levels of the embryonic β-H1 globin and the adult β-major globin in the cells were measured by real-time PCR. (d) After the EB cells had been cultured on OP9 stromal cells for 7 days, the hematopoietic cells were cultured in a methylcellulose-containing medium with hematopoietic cytokines. Ten days later, the number of hematopoietic colonies was then determined using light microscopy. The number of total colonies or subdivided colonies (by morphological subtypes BFU-E, CFU-GM, and CFU-Mix) is shown. The colony number was normalized to the total number of cells. The data were expressed as mean±SD (n=3); **p<0.01 as compared with Neo. (e) Cytospin preparation from a DN-Lnk-expressing cell-derived CFU-Mix obtained from the cultures described in (d). E, erythrocyte; G, granulocyte; M, macrophage; Mk, megakaryocyte. Scale bar indicates 30 μm. (f ) After the EB cells were cocultured with OP9 stromal cells for 14 days, the hematopoietic cells were collected as described in the Materials and Methods section. Hematopoietic cells derived from Neo- or DN-Lnk-expressing iPS cells were stained with each antibody, and were then subjected to flow cytometric analysis. The proportion of antigen-positive cells is indicated in the histograms. Representative results from 1 of 3 independent experiments performed are shown. CFC, colony-forming cell; BFU-E, burst-forming unit; CFU-GM, colony-forming unit–granulocyte and monocyte; CFU-Mix/CFU-GEMM, CFU–granulocyte, erythrocyte, monocyte, and megakaryocyte.

To investigate whether primitive and definitive hematopoiesis could occur in DN-Lnk- or Neo-expressing cells, we measured the expression levels of red cell globin by RT-PCR analysis. In both DN-Lnk- and Neo-expressing hematopoietic cells, the expression levels of the embryonic globin, β-H1, and the adult globin, β-major, were decreased and increased, respectively, after culturing on OP9 stromal cells in comparison with those in total EB cells (Fig. 3c). This indicates that DN-Lnk- or Neo-expressing cells can show the primitive hematopoiesis followed by definitive hematopoiesis under our culture conditions.

We next examined the colony-forming potential of DN-Lnk-expressing cells. As shown in Fig. 3d, DN-Lnk-expressing cells showed a significant increase in the total colony-forming cell (CFC) number and CFU–granulocyte, macrophage number. Note that the number of CFU-GEMM/CFU-Mix, the most immature multipotent hematopoietic cells, in DN-Lnk-expressing cells was ∼5 times as much as that in Neo-expressing cells (Fig. 3d). May-Giemsa staining after picking up the colonies revealed that mixed colonies derived from DN-Lnk-expressing cells contained the erythroblasts, granulocytes, macrophages, and megakaryocytes (Fig. 3e), thus confirming the generation of multipotent hematopoietic cells. An elevated CFU-Mix number in DN-Lnk-expressing cells might have been due to the fact that Lnk is highly expressed in immature hematopoietic cells, especially in hematopoietic stem/progenitor cells [13,17]. We also analyzed surface antigen expression in DN-Lnk- or Neo-expressing cells by flow cytometry, and found that DN-Lnk-expressing cells showed a higher percentage of CD34⁺ cells and CD41⁺ cells (Fig. 3f), suggestive of an increased number of immature hematopoietic cells. In addition, the proportion of CD45⁺ cells, CD11b⁺ cells, Gr-1⁺ cells, or CXCR4⁺ cells was also increased in DN-Lnk-expressing cells (Fig. 3f). By contrast, a lower percentage of Ter119⁺ cells were observed in DN-Lnk-expressing cells (Fig. 3f). Consistent with this flow cytometric analysis, we found an increased expression of Sfpi1 (encoding Pu.1) and E47, which are the key factors responsible for hematopoiesis, and a decreased expression of β-major globin in DN-Lnk-expressing cells after the cultivation on OP9 stromal cells (Fig. 3c and Supplementary Fig. S3). These results clearly showed that Lnk inhibition promoted the production of hematopoietic cells, including multipotent immature hematopoietic cells and myeloid cells, from mouse ES and iPS cells.

Inhibition of Lnk function in pluripotent stem cell-derived hematopoietic cells augments TPO-mediated signaling

It was previously shown that Lnk negatively regulates various types of hematopoietic cytokine signaling, such as TPO [16]. To investigate whether the increased production of hematopoietic cells from DN-Lnk-expressing cells, described above, is due to the enhanced TPO-mediated signaling, we analyzed protein phosphorylation after TPO stimulation using DN-Lnk-expressing cells. Hematopoietic cells were starved and subsequently stimulated with 20 ng/mL of TPO before the preparation of the cell lysates. The results showed the elevated phosphorylation of Jak2, Erk1/2, and Akt, all of which are downstream of TPO signaling, in DN-Lnk-expressing cells (Fig. 4a). We also found almost no difference in the percentage of Mpl/TPOR-positive cells between DN-Lnk-expressing cells and Neo-expressing cells (Fig. 4b), indicating that enhanced TPO signaling in DN-Lnk-expressing cells does not result from the increased percentage of Mpl/TPO-expressing cells. Thus, our data suggest that Lnk inhibition by DN-Lnk gene transduction would augment the activation of signaling molecules upon stimulation with cytokines, and thus Lnk inhibition would promote the production of hematopoietic cells in DN-Lnk-expressing cells.

FIG. 4.

Enhanced TPO-induced signaling pathway in DN-Lnk-expressing cells. After the EB cells, which were cultured for 7 days, had been plated and cultured on OP9 stromal cells for 14 days, and the hematopoietic cells were harvested as described in the Materials and Methods section. (a) Hematopoietic cells derived from Neo- or DN-Lnk-expressing cells were starved for 4–6 h in the absence of TPO, and the cells were then stimulated with 20 ng/mL of TPO. Total cell lysates were subjected to western blot analysis using the indicated antibodies. (b) After hematopoietic cells were collected, the rate of Mpl/TPOR-expressing cells was examined by flow cytometry. Representative results from 1 of 2 independent experiments performed are shown. TPO, thrombopoietin.

Increased generation of hematopoietic progenitor cells from mouse pluripotent stem cells by transient transduction of a DN-Lnk gene

Our groups have shown that Ad vector-mediated transient, but not constitutive, transduction of differentiation-related genes in pluripotent stem cells could result in the efficient generation of functional cells, such as adipocytes, osteoblasts, hepatocytes, and hematopoietic cells [25,28,35 –37]. We expected that the transient inhibition of Lnk in iPS cells could also accelerate the hematopoietic differentiation. To test this expectation, we generated a DN-Lnk-expressing Ad vector, Ad-DN-Lnk, and examined the effects of transient Lnk inhibition on hematopoietic cell differentiation. The transduction efficiency in EBs, which was transduced with a DsRed-expressing Ad vector, was approximately 40%, as determined by flow cytometry (data not shown). A colony assay after transduction with Ad vectors revealed that the number of total colonies and mixed colonies in the cells transduced with Ad-DN-Lnk was slightly increased in comparison with that in the cells transduced with Ad-LacZ (control vector) (Fig. 5a, c). Moreover, the number of hematopoietic cells increased in Ad-DN-Lnk-transduced cells after 7-day cultivation on OP9 stromal cells (Fig. 5b, d). Thus, our data indicate that the transient inhibition of Lnk also enhances the differentiation and proliferation of hematopoietic cells derived from pluripotent stem cells.

FIG. 5.

Expansion of ES cell- and iPS cell-derived hematopoietic cells by the transient expression of DN-Lnk in EB cells. After ES cell- (a, b) or iPS cell- (c, d) derived EB cells, which were cultured for 7 days, had been transduced with Ad-LacZ or Ad-DN-Lnk at 3,000 VP/cell for 1.5 h, the cells were cultured on OP9 cells with cytokines for 7 days. Hematopoietic cells were collected, and then a colony assay was performed (a, c). The colony number was normalized to the total number of cells. We also counted the number of hematopoietic cells derived from Ad-LacZ- or Ad-DN-Lnk-transduced EB cells (b, d). The data were expressed as mean±SD (n=3); *p<0.05 as compared with Ad-LacZ. Ad, adenovirus.

Discussion

In this report, we successfully generated and expanded hematopoietic cells, including immature hematopoietic cells, with colony-forming potential, from mouse ES and iPS cells by the suppression of an adaptor protein Lnk (Fig. 3). We also demonstrated that the expression levels of hematopoietic transcription factors such as Scl and Runx1 in DN-Lnk-expressing total EB cells were significantly increased in comparison with those in Neo-expressing total EB cells (Fig. 2c, d), and that cytokine response was augmented in DN-Lnk-expressing cells (Fig. 4). Therefore, the data obtained in this study suggest that Lnk inhibition by enforced expression of a DN-Lnk gene in ES and iPS cells would lead both to a promotion of mesodermal differentiation during EB formation and to an increase in the expansion potential of ES and iPS cell-derived hematopoietic cells on an OP9 coculture system, and thus Lnk inhibition could enhance the hematopoietic cell production.

In developing mouse embryos, Lnk is shown to be expressed in the aorta-gonad-mesonephros (AGM) region, the site of hematopoiesis [38]. It has also been reported that the production of CD45⁺ hematopoietic cells was severely impaired by the enforced expression of Lnk in AGM-derived cells, suggesting that Lnk suppresses hematopoietic commitment [38]. However, the function of Lnk in hematopoiesis is not fully understood. In the current study, we found that Lnk was highly expressed in Flk-1⁺ cells (Fig. 1b), which are known to be hemoangiogenic progenitor cells during ES cell differentiation [29]. Furthermore, it was of note that levels of expression of Scl/Tal-1, which is essential for hematopoietic commitment of hemoangiogenic progenitor cells derived from ES cells [34], were slightly upregulated in Flk-1⁺ cells by the inhibition of Lnk function (Fig. 2e). Thus, it is possible that Lnk might negatively regulate the hematopoietic commitment in Flk-1⁺ cells by modulating the expression of Scl/Tal-1. We also showed that the percentage of Flk-1⁺ cells was increased in DN-Lnk-expressing EB cells (Fig. 2b), and this could result in the elevated expression of other key hematopoietic transcription factors, such as Runx1 and Gata-1, in DN-Lnk-expressing total EB cells compared with that in Neo-expressing total EB cells (Fig. 2c, d). This indicates that the functional Flk-1⁺ mesodermal cells would be efficiently generated from DN-Lnk-expressing ES and iPS cells. On the other hand, at earlier days of differentiation, the percentage of CD41⁺ cells, an early hematopoietic progenitor cells generated from pluripotent stem cells [39], in DN-Lnk-expressing EB cells was mostly equal to that in Neo-expressing EB cells (Supplementary Fig. S4). Taken together, the findings suggest that Lnk inhibition in ES and iPS cells could be effective for the generation of mesodermal cells with the potential for hematopoietic differentiation, but would not enhance the emergence of hematopoietic progenitor cells at earlier days of EB differentiation.

We examined the cytokine responses of iPS cell-derived hematopoietic cells, and observed the augmented phosphorylation of Erk and Akt in DN-Lnk-expressing cells (Fig. 4). This result is consistent with that of a previous report in which TPO-treated megakaryocytes derived from Lnk-deficient mice enhanced the extent of the activation of Erk and Akt [40]. By contrast, it was reported that Lnk-deficient adult HSCs or bone marrow-derived macrophages showed an enhanced Akt, but not Erk, activation after cytokine stimulation [16,41]. This difference in the activation of downstream molecules is most likely due to differences in cell populations. Because ES cell- and iPS cell-derived hematopoietic cells are heterogeneous, both Akt and Erk phosphorylation levels after cytokine treatment would be augmented in DN-Lnk-expressing cells relative to Neo-expressing cells. In general, Akt and Erk are known to be involved in cell survival and cell growth [42,43]. Hence, our data indicate that the suppression of Lnk by the ectopic expression of DN-Lnk in ES and iPS cells would lead to an increase in hematopoietic cell production through enhanced cytokine responses.

Recently, Dravid et al. reported the expression of Lnk in human ES cell-derived CD34⁺ hematopoietic progenitor cells, and they showed that the number of human ES cell-derived CD34⁺ cells was increased by Lnk knockdown using a lentivirus vector carrying the short-hairpin RNA against Lnk (shLnk) [44]. Their results are mostly consistent with our data, indicating the suppressive function of Lnk in hematopoietic cell generation in both mouse and human pluripotent stem cells. However, the generation of hematopoietic CFCs in shLnk-transduced cells and the molecular mechanisms associated with the generation of CD34⁺ cells by Lnk knockdown have not been addressed in detail. In this report, we clearly demonstrated that hematopoietic CFCs, including immature multipotent hematopoietic cells, were efficiently generated from mouse ES and iPS cells by Lnk inhibition, and these cells show potential for expansion on OP9 stromal cells (Fig. 3). In addition, we showed that the enhanced generation of hematopoietic cells in DN-Lnk-expressing cells was mediated by the promotion of mesodermal differentiation in EBs and augmented the sensitivity to cytokines in DN-Lnk-expressing cells as described above.

Another important finding of this study was that the transient inhibition of Lnk by Ad vector-mediated transduction of a DN-Lnk gene could also be an effective strategy for expanding hematopoietic cells (Fig. 5). Recently, the loss of Lnk and the mutation of Lnk have been reported to be associated with myeloproliferative diseases [45,46], indicating that oncogenesis may result from constitutive Lnk suppression in ES cell- and iPS cell-derived hematopoietic cells via the overexpression of a DN-Lnk gene or a lentivirus vector-mediated knockdown system, and such suppression would not be a directly applicable approach for clinical medicine. In this regard, our approaches using Ad vector-mediated transient Lnk inhibition are thought to be quite useful for the safe expansion of the ES cell- and iPS cell-derived hematopoietic cells. However, the number of ES cell- and iPS cell-derived hematopoietic cells in Ad-DN-Lnk-transduced cells was lower than that in the case of stably DN-Lnk-expressing cells (data not shown), possibly due to the low transduction efficiency of Ad vectors in EB cells. Therefore, it will still be necessary to establish methods for transiently inhibiting Lnk functionality using various types of Ad vectors [47] and short interference RNA.

In summary, we successfully developed efficient methods for differentiating mouse ES and iPS cells into hematopoietic cells by the suppression of the adaptor protein Lnk. Lnk functions downstream of multiple hematopoietic cytokine-signaling events, including those involving TPO, SCF, macrophage-colony stimulating factor, and erythropoietin [13,16,40,41,48,49], and Lnk-deficient mice show accumulation of pro-B cells in the bone marrow [48]. Therefore, various types of hematopoietic cells may be efficiently differentiated and expanded from ES and iPS cells by the inhibition of the Lnk function, when an appropriate cytokine is included in the culture; such work is currently ongoing in our laboratory.

Footnotes

Acknowledgments

We thank Misae Nishijima (National Institute of Biomedical Innovation) for her help. We thank Dr. Kazufumi Katayama (Osaka University, Osaka, Japan) for helpful discussion. We also thank Dr. S. Yamanaka and Dr. J. Miyazaki for kindly providing the mouse iPS cell line 38C2 and the CA promoter, respectively. This work was supported by a Grant-in-Aid for Young Scientists (B) (K. Tashiro) of the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan and the Ministry of Health, Labour, and Welfare of Japan.

Author Disclosure Statement

The authors have no financial conflicts of interest.

References

Evans

, Kaufman

. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature, 292:154–156.

Thomson

, Itskovitz-Eldor

, Shapiro

, Waknitz

, Swiergiel

, Marshall

, Jones

. 1998. Embryonic stem cell lines derived from human blastocysts. Science, 282:1145–1147.

Takahashi

, Yamanaka

. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126:663–676.

Takahashi

, Tanabe

, Ohnuki

, Narita

, Ichisaka

, Tomoda

, Yamanaka

. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131:861–872.

Nakano

, Kodama

, Honjo

. 1994. Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science, 265:1098–1101.

Chadwick

, Wang

, Li

, Menendez

, Murdoch

, Rouleau

, Bhatia

. 2003. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood, 102:906–915.

Schmitt

, de Pooter

, Gronski

, Cho

, Ohashi

, Zuniga-Pflucker

. 2004. Induction of T cell development and establishment of T cell competence from embryonic stem cells differentiated in vitro. Nat Immunol, 5:410–417.

Hiroyama

, Miharada

, Sudo

, Danjo

, Aoki

, Nakamura

. 2008. Establishment of mouse embryonic stem cell-derived erythroid progenitor cell lines able to produce functional red blood cells. PLoS One, 3:e1544.

Choi

, Yu

, Smuga-Otto

, Salvagiotto

, Rehrauer

, Vodyanik

, Thomson

, Slukvin

. 2009. Hematopoietic and endothelial differentiation of human induced pluripotent stem cells. Stem Cells, 27:559–567.

10.

Lei

, Haque

, Weiler

, Vrana

, Song

. 2009. T lineage differentiation from induced pluripotent stem cells. Cell Immunol, 260:1–5.

11.

Benezra

, Davis

, Lockshon

, Turner

, Weintraub

. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell, 61:49–59.

12.

Hong

, Lee

, Ji

, Bhatia

. 2011. ID1 and ID3 represent conserved negative regulators of human embryonic and induced pluripotent stem cell hematopoiesis. J Cell Sci, 124:1445–1452.

13.

Takaki

, Morita

, Tezuka

, Takatsu

. 2002. Enhanced hematopoiesis by hematopoietic progenitor cells lacking intracellular adaptor protein, Lnk. J Exp Med, 195:151–160.

14.

Velazquez

, Cheng

, Fleming

, Furlonger

, Vesely

, Bernstein

, Paige

, Pawson

. 2002. Cytokine signaling and hematopoietic homeostasis are disrupted in Lnk-deficient mice. J Exp Med, 195:1599–1611.

15.

Ema

, Sudo

, Seita

, Matsubara

, Morita

, Osawa

, Takatsu

, Takaki

, Nakauchi

. 2005. Quantification of self-renewal capacity in single hematopoietic stem cells from normal and Lnk-deficient mice. Dev Cell, 8:907–914.

16.

Seita

, Ema

, Ooehara

, Yamazaki

, Tadokoro

, Yamasaki

, Eto

, Takaki

, Takatsu

, Nakauchi

. 2007. Lnk negatively regulates self-renewal of hematopoietic stem cells by modifying thrombopoietin-mediated signal transduction. Proc Natl Acad Sci U S A, 104:2349–2354.

17.

Kwon

, Suzuki

, Kawamoto

, Ii

, Eguchi

, Akimaru

, Wada

, Matsumoto

, Masuda

et al. 2009. Pivotal role of lnk adaptor protein in endothelial progenitor cell biology for vascular regeneration. Circ Res, 104:969–977.

18.

Yokota

. 2001. Id and development. Oncogene, 20:8290–8298.

19.

Takizawa

, Kubo-Akashi

, Nobuhisa

, Kwon

, Iseki

, Taga

, Takatsu

, Takaki

. 2006. Enhanced engraftment of hematopoietic stem/progenitor cells by the transient inhibition of an adaptor protein, Lnk. Blood, 107:2968–2975.

20.

Mizuguchi

, Kay

. 1998. Efficient construction of a recombinant adenovirus vector by an improved in vitro ligation method. Hum Gene Ther, 9:2577–2583.

21.

Mizuguchi

, Kay

. 1999. A simple method for constructing E1- and E1/E4-deleted recombinant adenoviral vectors. Hum Gene Ther, 10:2013–2017.

22.

Kawabata

, Sakurai

, Yamaguchi

, Hayakawa

, Mizuguchi

. 2005. Efficient gene transfer into mouse embryonic stem cells with adenovirus vectors. Mol Ther, 12:547–554.

23.

Niwa

, Yamamura

, Miyazaki

. 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene, 108:193–199.

24.

Tashiro

, Kawabata

, Sakurai

, Kurachi

, Sakurai

, Yamanishi

, Mizuguchi

. 2008. Efficient adenovirus vector-mediated PPAR gamma gene transfer into mouse embryoid bodies promotes adipocyte differentiation. J Gene Med, 10:498–507.

25.

Tashiro

, Kawabata

, Omori

, Yamaguchi

, Sakurai

, Katayama

, Hayakawa

, Mizuguchi

. 2012. Promotion of hematopoietic differentiation from mouse induced pluripotent stem cells by transient HoxB4 transduction. Stem Cell Res, 8:300–311.

26.

Maizel

Jr. , White

, Scharff

. 1968. The polypeptides of adenovirus. I. Evidence for multiple protein components in the virion and a comparison of types 2, 7A, and 12. Virology, 36:115–125.

27.

Okita

, Ichisaka

, Yamanaka

. 2007. Generation of germline-competent induced pluripotent stem cells. Nature, 448:313–317.

28.

Tashiro

, Inamura

, Kawabata

, Sakurai

, Yamanishi

, Hayakawa

, Mizuguchi

. 2009. Efficient adipocyte and osteoblast differentiation from mouse induced pluripotent stem cells by adenoviral transduction. Stem Cells, 27:1802–1811.

29.

Nishikawa

, Nishikawa

, Hirashima

, Matsuyoshi

, Kodama

. 1998. Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development, 125:1747–1757.

30.

Yamashita

, Itoh

, Hirashima

, Ogawa

, Nishikawa

, Yurugi

, Naito

, Nakao

. 2000. Flk1-positive cells derived from embryonic stem cells serve as vascular progenitors. Nature, 408:92–96.

31.

Huber

, Kouskoff

, Fehling

, Palis

, Keller

. 2004. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature, 432:625–630.

32.

Wilson

, Foster

, Wang

, Knezevic

, Schutte

, Kaimakis

, Chilarska

, Kinston

, Ouwehand

et al. 2010. Combinatorial transcriptional control in blood stem/progenitor cells: genome-wide analysis of ten major transcriptional regulators. Cell Stem Cell, 7:532–544.

33.

Robb

, Elwood

, Elefanty

, Kontgen

, Li

, Barnett

, Begley

. 1996. The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse. EMBO J, 15:4123–4129.

34.

D'Souza

, Elefanty

, Keller

. 2005. SCL/Tal-1 is essential for hematopoietic commitment of the hemangioblast but not for its development. Blood, 105:3862–3870.

35.

Inamura

, Kawabata

, Takayama

, Tashiro

, Sakurai

, Katayama

, Toyoda

, Akutsu

, Miyagawa

et al. 2011. Efficient generation of hepatoblasts from human ES cells and iPS cells by transient overexpression of homeobox gene HEX. Mol Ther, 19:400–407.

36.

Takayama

, Inamura

, Kawabata

, Tashiro

, Katayama

, Sakurai

, Hayakawa

, Furue

, Mizuguchi

. 2011. Efficient and directive generation of two distinct endoderm lineages from human ESCs and iPSCs by differentiation stage-specific SOX17 transduction. PLoS One, 6:e21780.

37.

Takayama

, Inamura

, Kawabata

, Katayama

, Higuchi

, Tashiro

, Nonaka

, Sakurai

, Hayakawa

, Kusudaurue M

, Mizuguchi

. 2012. Efficient generation of functional hepatocytes from human embryonic stem cells and induced pluripotent stem cells by HNF4alpha transduction. Mol Ther, 20:127–137.

38.

Nobuhisa

, Takizawa

, Takaki

, Inoue

, Okita

, Ueno

, Takatsu

, Taga

. 2003. Regulation of hematopoietic development in the aorta-gonad-mesonephros region mediated by Lnk adaptor protein. Mol Cell Biol, 23:8486–8494.

39.

Matsumoto

, Isagawa

, Nishimura

, Ogaeri

, Eto

, Miyazaki

, Aburatani

, Nakauchi

, Ema

. 2009. Stepwise development of hematopoietic stem cells from embryonic stem cells. PLoS One, 4:e4820.

40.

Tong

, Lodish

. 2004. Lnk inhibits Tpo-mpl signaling and Tpo-mediated megakaryocytopoiesis. J Exp Med, 200:569–580.

41.

Gueller

, Goodridge

, Niebuhr

, Xing

, Koren Michowitz

, Serve

, Underhill

, Brandts

, Koeffler

. 2010. Adaptor protein Lnk inhibits c-Fms-mediated macrophage function. J Leukoc Biol, 88:699–706.

42.

Geest

, Coffer

. 2009. MAPK signaling pathways in the regulation of hematopoiesis. J Leukoc Biol, 86:237–250.

43.

Martelli

, Evangelisti

, Chiarini

, Grimaldi

, Cappellini

, Ognibene

, McCubrey

. 2010. The emerging role of the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin signaling network in normal myelopoiesis and leukemogenesis. Biochim Biophys Acta, 1803:991–1002.

44.

Dravid

, Zhu

, Scholes

, Evseenko

, Crooks

. 2011. Dysregulated gene expression during hematopoietic differentiation from human embryonic stem cells. Mol Ther, 19:768–781.

45.

Bersenev

, Wu

, Balcerek

, Jing

, Kundu

, Blobel

, Chikwava

, Tong

. 2010. Lnk constrains myeloproliferative diseases in mice. J Clin Invest, 120:2058–2069.

46.

, Simonds

, Jones

, Hale

, Goltsev

, Gibbs

Jr. , Merker

, Zehnder

, Nolan

, Gotlib

. 2010. Novel mutations in the inhibitory adaptor protein LNK drive JAK-STAT signaling in patients with myeloproliferative neoplasms. Blood, 116:988–992.

47.

Kawabata

, Sakurai

, Koizumi

, Hayakawa

, Mizuguchi

. 2006. Adenovirus vector-mediated gene transfer into stem cells. Mol Pharm, 3:95–103.

48.

Takaki

, Sauer

, Iritani

, Chien

, Ebihara

, Tsuji

, Takatsu

, Perlmutter

. 2000. Control of B cell production by the adaptor protein lnk. Definition Of a conserved family of signal-modulating proteins. Immunity, 13:599–609.

49.

Tong

, Zhang

, Lodish

. 2005. Lnk inhibits erythropoiesis and Epo-dependent JAK2 activation and downstream signaling pathways. Blood, 105:4604–4612.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.27 MB