Differentiation Potential and Profile of Nuclear Receptor Expression During Expanded Culture of Human Adipose Tissue-Derived Stem Cells Reveals PPARγ as an Important Regulator of Oct4 Expression

Abstract

Potential therapeutic use of human adipose tissue-derived stem cells (hADSCs) requires the production of large cell numbers by in vitro expansion. However, long-term in vitro culture is associated with reduced stem cell characteristics and differentiation capability. We investigated the proliferation rate and expression of p16^INK4a mRNA, surface stem cell markers, and stem cell transcription factors. The proliferation rate decreased significantly as passages increased, and the expression of p16^INK4a mRNA significantly increased. FACS analysis of CD73, CD90, and CD105 expression showed no significant difference among examined passages; however, the mRNA expression levels of pluripotent markers, Oct4 and Nanog, were significantly decreased at higher passages. At passages 12 and 20, there was decreased differentiation capability into insulin-producing cells, evidenced by significantly decreased expression of insulin and related β cell markers. Adipogenic and osteogenic differentiation was also decreased at higher passages. We then analyzed the transcriptional expression profiles of 48 nuclear receptors at four different passages. We found that the expression of peroxisome proliferator-activated receptor γ (PPARγ) and thyroid hormone receptor TRβ was significantly decreased at higher passages. Treatment with PPARγ activators or overexpression of PPARγ in hADSCs at passage 20 could recover Oct4 expression levels and increase Oct4 promoter activity. PPARγ inactivation by GW9662 inhibited the troglitazone-induced Oct4 mRNA expression. Furthermore, PPARγ overexpression in hADSC at passage 20 improved the differentiation potential to insulin-producing cells. In conclusion, we demonstrated that hADSCs undergo characteristic changes and reduction of differentiation capability during expanded culture in vitro, and revealed the role of PPARγ as one potential factor in the regulation of Oct4 expression during in vitro aging of hADSCs.

Introduction

Stem cells are distinguished from other cell types by two important characteristics: (1) they are unspecialized cells that are capable of renewing themselves through cell division, and (2) under certain physiologic or experimental conditions, they can be induced to become tissue-specific cell types. Possessing these unique characters, stem cells hold great promise for tissue regenerative medicine.

Mesenchymal stem cells (MSCs) are multipotent adult stem cells that can be isolated from various mesenchymal tissues in the adult body. MSCs were first described by Friedenstein et al. as bone marrow-derived clonogenic, plastic-adherent cells that are capable of differentiating into osteoblasts, adipocytes, and chondrocytes [1]. However, the ideal stem cells for use in functional tissue engineering need to be abundantly available, harvested with minimal morbidity, reliably differentiated down various pathways, and safe and effective for transplantation. Recently, some reports described the isolation of MSCs from human adipose tissue that seem to satisfy these criteria [2,3]. These human adipose tissue-derived stem cells (hADSCs) are capable of forming mesodermal tissues such as bone, cartilage, tendons, skeletal muscle, and fat when cultivated under lineage-specific conditions and can also form non-mesodermal tissues such as neurons and endocrine pancreatic cells [4,5].

As a first step for therapeutic application, it is necessary to obtain a sufficient cell number of MSCs by continuously subculturing in vitro for subsequent differentiation. Although MSCs are expandable, long-term in vitro culture of MSCs is associated with reduced proliferative potential due to cellular senescence, leading finally to growth arrest, a phenomenon known as replicative senescence, thus limiting the potential for MSC expansion [6,7]. As well, long-term expanded MSCs have altered differentiation potential toward mesenchymal cell lineages such as adipocytes, osteocytes, and chondrocytes [8]. In this study, we investigated the stem cell characteristics of hADSCs during extended culture in vitro and examined their capability to differentiate into insulin-producing cells. In addition, we analyzed the expression of 48 nuclear receptors (NRs) during culture to further understand which NRs might be involved in regulating the expression of the stem cell marker, octamer-binding transcription factor 4 (Oct4), during in vitro aging of hADSCs.

Materials and Methods

Materials

STEMPRO^® hADCSs were purchased from Life Technologies (Cat.No.R7788-115) and cultured in MesenPRO™ medium. The following reagents were purchased from indicated suppliers: troglitazone from Enzo Life Science; activin A, basic fibroblast growth factor (bFGF), and hepatocyte growth factor (HGF) from Peprotech; B27 serum-free supplement and N2 supplement from Life Technologies; and 15-deoxy-Δ^12,14-prostaglandin J₂ (15PGJ₂), valproic acid, exendin-4, nicotinamide, dexamethasone, 3-isobutyl-1-methylxantine, insulin, ascorbate-2 phosphate, β-glycerol phosphate, GW9662, and 3,3′,5-triiodo-L-thyronine (T3) from Sigma-Aldrich.

Cell culture

hADSCs were chosen for experiments at passages 4, 7, 12, and 20. The growth kinetics of each passage of hADSCs was measured by allowing cell proliferation for 1 week. Briefly, cells from each passage were seeded at 10⁴ cells/cm² in six-well plates and allowed to divide for 7 days. The medium was changed twice weekly. One culture from each group was harvested daily for determination of cell numbers. For chemical treatments, cells were seeded at 10⁴ cells/cm² in six-well plates and allowed to attach overnight. Then, the growth medium was replaced with fresh medium containing troglitazone or 15PGJ₂. Samples were collected at various times during incubation.

RNA isolation and quantitative polymerase chain reaction

Total RNA was isolated from cells using Trizol reagent according to the manufacturer's protocol. RNA samples were treated with DNase in order to remove possible contaminating genomic DNA. Quantification of RNA was measured by an ND-1000 spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized from 0.8 μg RNA using a PrimeScript™ 1^st strand cDNA synthesis kit (Takara). Quantitative polymerase chain reaction (PCR) was performed in duplicate and reaction mixture containing 1×Power SYBR-Green Master-mix (Applied-Biosystems), 600–750 nM each forward and reverse primers and 50 ng cDNA template. PCR amplification was carried out using Applied-Biosystem Prism 7900HT Real-Time PCR Sequence Detection System and stopped at 40 cycles. The relative gene expression levels were normalized with human cyclophilin using the comparative C_T method. The 48 human NR primer sequences followed a previous report [9]. The other quantitative PCR primer sequences are listed in Table 1.

Table 1.

List of Primers and Sequences for Quantitative Polymerase Chain Reaction

Target	Forward	Reverse
Cyclophilin	TGCCATCGCCAAGGAGTA G	TGCACAGACGGTCACTCAAA
Insulin	GCAGCCTTTGTGAACCAACA	TTCCCCGCACACTAGGTAGAGA
Nanog	CCAACATCCTGAACCTCAGC	GCTATTCTTCGGCCAGTTG
Ngn3	CGGAGTCGGCGAAAGAAG	CGTCCAGTGCCGAGTTGAG
Oct4	ACATCAAAGCTCTGCAGAAAGAACT	CTGAATACCTTCCCAAATAGAACCC
p16^INK4A	GAAGGTCCCTCAGACATCCCC	CCCTGTAGGACCTTCGGTGAC
PDX1	GAACTTGACCGAGAGACACATCAA	TTGTCCTCCTCCTTTTTCCACTT
PPARγ	AGATCCAGTGGTTGCAGATT	GGAGATGCAGGCTCCACTTT
Rex1	GAAGAGGCCTTCACTCTAGTAGTG	TTTCTGGTGTCTTGTCTTTGCCCG
RXRα	GAGCCCAAGACCGAGACCTA	AGCTGTTTGTCGGCTGCTT
Sox2	TGCGAGCGCTGCACAT	GCAGCGTGTACTTATCCTTCTTCA
SREBP-1c	TCGCGGAGCCATGGATT	GGAAGTCACTGTCTTGGTTGTTGA
aP2	GGCATGGCCAAACCTAACAT	TTCCATCCCATTTCTGCACAT
C/EBPα	GACACGCTGCGGGGCATCT	CTGCTCCCCTTCCTTCTCTCA
Runx2	TGAGAGCCGCTTCTCCAACC	GCGGAAGCATTCTGGAAGGA
OPG	GGCAACACAGCTCACAAGAA	CTGGGTTTGCATGCCTTTAT
ALP	ACCATTCCCACGTCTTCACA	CAGGCCCATTGCCATACA

Ngn3, neurogenin-3; Oct4, octamer-binding transcription factor; PDX1, pancreatic and duodenal homeobox 1; PPARγ, peroxisome proliferator-activated receptor γ; RXRα, retinoid X receptor α; Sox2, sex-determining region Y-box 2; SREBP-1c, sterol regulatory element-binding protein 1c; aP2 adipocyte fatty acid-binding protein 2; C/EBPα, CCAAT/enhancer-binding protein α; Runx2, runt-related transcription factor 2; OPG, osteoprotegerin; ALP, alkaline phosphatase.

Western blot

Whole cell extracts from undifferentiated cells at passages 4, 7, 12, and 20 were prepared. After Bradford assay, 40 μg of protein per lane were separated by electrophoresis in a 15% sodium dodecyl sulphate polyacrylamide gel. Proteins were then transferred to a polyvinylidene difluoride membrane. The membranes were blocked with 5% skim milk in Tris-buffered saline with 0.05% Tween 20 for 1 h and incubated with primary antibody to p16^INK4A (1:500; Upstate) overnight. Membranes were then incubated with secondary antibody horseradish peroxidase-conjugated anti-rabbit IgG (Santa Cruz) for 1 h at room temperature and visualized using a Fujifilm luminescent image analyzer LAS4000. Beta actin was used as a loading control.

Flow cytometry

Single-cell suspensions at passages 4, 7, 12, and 20 were obtained and washed twice with FACS buffer containing 1% fetal bovine serum in phosphate-buffered saline. Cells were counted and suspended at a concentration of 5×10⁵ cells in 100 μL FACS buffer and incubated for 30 min at 4°C in the dark with the following fluorescent antibodies: CD73-PE, CD90-FITC, and CD105-FITC (BD Biosciences). Cells were washed twice with FACS buffer and then analyzed using flow cytometry (FACS Calibur System; Becton Dickinson). Data acquisition and analysis were then performed (Cell Questsoftware; Becton Dickinson).

Differentiation of hADSCs

To induce insulin-producing cell differentiation, cells from passages 4, 7, 12, and 20 were trypsinized, suspended in culture medium, and centrifuged. Cells were counted and seeded at a density of 10⁴ cells/cm² in a 12-well low attachment plate (SPL 30212). To examine the effect of peroxisome proliferator-activated receptor γ (PPARγ) overexpression, hADSCs were transiently transfected with a pcDNA flag PPARγ plasmid (Addgene plasmid No. 8895, a gift of Dr. Bruce Spiegelman) or pcDNA plasmid (250 ng each) using a Neon transfection system (Life Technologies; two electric pulses at 1,005 V with 35 ms duration). Transfected cells were incubated in MesenPRO medium containing 2% growth supplement for 24 h and then differentiated into insulin-producing cells. To examine the effect of a PPARγ activator, troglitazone was added to hADSCs, and the cells were incubated for 24 at 37°C. Cells were then differentiated into insulin-producing cells using defined medium. The basic differentiation medium was serum-free DMEM/F12 (1:1) supplemented with 1% B27 serum-free supplement, 1% N2 supplement, and 1% penicillin/streptomycin. A three-step, 10-day protocol was used to differentiate hADSCs into insulin-producing cells: (1) 3 days of incubation in basic medium plus 50 ng/mL activin A and 2 mM valproic acid, (2) 3 days of incubation in basic medium plus 10 nM exendin-4 and 10 ng/mL bFGF, and (3) 4 days in incubation in basic medium plus 10 nM exendin-4, 50 ng/mL HGF, and 10 mM nicotinamide.

For adipogenic differentiation, cells were seeded at a density of 2×10⁴ cells/cm² in six-well culture plates and cultured for 2 days before differentiation. Subconfluent cells were incubated for 12 days with adipogenic differentiation medium consisting of DMEM high glucose supplemented with 10% fetal bovine serum, 1 μM dexamethasone, 500 μM 3-isobutyl-1-methylxantine, 5 μg/mL insulin, and 10 μM troglitazone; the medium was changed every 3 days. After adipogenic differentiation, cells were fixed in 10% formalin for 30 min at room temperature, washed, and stained with 1.8 mg/mL Oil Red O solution and visualized under a microscope. Oil Red O assays were performed by lysing stained cells with isopropanol and measuring the absorbance at 450 nm wavelengths.

For osteogenic differentiation, 5×10³ cells/cm² at passages 4, 7, 12, and 20 were seeded in six-well culture plates. After overnight incubation, the growth medium was replaced by osteogenic medium containing DMEM/F12 (1:1) supplemented with 0.1 μM dexamethasone, 50 μM ascorbate-2 phosphate, and 10 mM β-glycerol phosphate. After 2 weeks of incubation, the alkaline phosphatase (ALP) activity of the differentiated cells was measured using an ALP staining kit (Primary Cell Co.).

Insulin secretion

The insulin secretion of the differentiated cells was measured using a human insulin ELISA kit (Mercodia) according to the manufacturer's instructions. Insulin content was normalized with protein content of the corresponding cell lysates.

Luciferase reporter gene analysis

The luciferase reporter construct (phOct4-Luc) containing the upstream region of human Oct4 was kindly provided by Shinya Yamanaka (Addgene plasmid No. 17221). To find the effect of PPARγ overexpression, hADSCs (passage 20) were transfected with the phOct4-Luc plasmid (500 ng) and a β-galactosidase plasmid (200 ng) after transfection with the pcDNA flag PPARγ plasmid or pcDNA plasmid (250 ng each). They were subjected to 2 electric pulses at 1,005 V with 35 ms duration using the Neon transfection system. Thirty-six hours after transfection, the cells were collected with 1_× passive lysis buffer (Promega). The intensity of luciferase activity was normalized with β-galactosidase expression.

Statistical analysis

Data are presented as mean±SD. The significance of differences was analyzed with an unpaired Student's t-test and one-way ANOVA with the Bonferroni procedure using SPSS ver. 10.0 (SPSS, Inc.) The value of statistical significance was set at P<0.05.

Results

Characterization of hADSCs during expanded culture

hADSCs were cultured in vitro and the morphology, growth rate, and expression of p16^INK4A was examined at different passages. Cells displayed a small spindle shape at the early passages (P4 and P7), and they became larger, flattened, and tightly attached to the plate at later passages (Fig. 1A). When we analyzed growth kinetics, the growth rate was slower and the increase of cell number was significantly reduced with increasing passage number (Fig. 1B).

FIG. 1.

Characterization of human adipose tissue-derived stem cells (hADSCs) during expanded culture. (A) Morphological changes at passages 4, 7, 12, and 20. (B) Cells at the indicated passages were cultured for 7 days, and the number of cells were counted daily (n=4–5). (C) Cells at the indicated passages were harvested, and the expression of p16^INK4A mRNA was analyzed by quantitative polymerase chain reaction (PCR) (upper panel) and p16^INK4A protein by western blot (lower panel). Data are means±SDs. *P<0.05, **P<0.01 compared with passage 4.

Previous studies have shown that senescence-associated gene expression increases continuously during in vitro expansion. This is in line with the changes in morphology and loss of differentiation potential [7]. p16^INK4A is known to contribute to cellular senescence and also stem cell aging. It accumulates in many aged cells and tissues and is considered a biomarker of aging [10,11]. We found that p16^INK4A mRNA and protein expression was increased in later passages as compared with passage 4 (Fig. 1C).

Expression of stem cell markers during expanded culture

Expression of mesenchymal surface markers in hADSCs at different passages was examined by FACS analysis. The cell populations that expressed CD73, CD90, or CD105 were not different among passages (Fig. 2A). hADSCs have been reported to express several markers of pluripotent embryonic stem (ES) cells [12,13]. Therefore, we examined the expression of several important pluripotent markers. Oct4, an important transcription factor in maintaining the undifferentiated status of ES cells, was significantly decreased at passages 7, 12, and 20 as compared with passage 4. A similar pattern was observed with Nanog expression level. However, the expression of sex determining region Y-box 2 (Sox2) and reduced expression 1 (Rex1) was not significantly changed (Fig. 2B).

FIG. 2.

Expession of stem cell markers in hADSCs during expanded culture. (A) FACS analysis of mesenchymal surface markers CD73, CD90, and CD105 at passages 4, 7, 12, and 20. (B) The expression of mRNA for pluripotent markers was analyzed by quantitative PCR at the indicated passages. Data are means±SDs; n=3–4/group. *P<0.05, **P<0.01 compared with passage 4. Oct4, octamer-binding transcription factor 4; Sox2, sex-determining region Y-box 2; Rex1, reduced expression 1.

Reduction of differentiation capability of hADSCs into insulin-producing cells

hADSCs are multipotent stem cells that are able to differentiate into mesenchymal and nonmesenchymal lineages [14,15]. Therefore, we tested the ability of hADSCs at different passages to differentiate into insulin-producing cells, a non-mesenchymal lineage. For all passages, cells aggregated together and formed spheroid clusters, which became islet-like structures by day 10. However, hADSCs at passages 4, 7, and 12 formed clusters with smooth surfaces, whereas cells at passage 20 formed clusters with wrinkled and rough surfaces (Fig. 3A). To determine whether the morphological changes reflect successful differentiation of hADSCs, we analyzed the mRNA expression of insulin and the beta-cell differentiation transcription factors, pancreatic and duodenal homeobox 1 (PDX1) and neurogenin-3 (NGN3), in differentiated cells by quantitative PCR. The expression levels of insulin and the transcription factors were significantly decreased at passages 12 and 20 as compared with passage 4 (Fig. 3B). We next tested the functional ability of differentiated cells by measuring the amount of secreted insulin. The amount of insulin secreted from cells differentiated at passages 7, 12, and 20 was also significantly decreased. There was about a threefold decrease in insulin secretion at passage 20 compared with passage 4 (Fig. 3C).

FIG. 3.

Differentiation potential of hADSCs into insulin-producing cells during expanded culture. (A) Morphological changes of hADSCs were observed at days 1, 6, and 10 during differentiation. 40× magnification. (B) The expression of insulin, pancreatic, and duodenal homeobox 1 (PDX1) and neurogenin-3 (NGN3) mRNA was analyzed by quantitative PCR, (n=5–7/group). (C) Basal insulin secretion at 5 mM glucose was measured from cells differentiated from hADSCs at the indicated passages (n=3/group). Data are means±SDs. *P<0.05, **P<0.01 compared with passage 4.

Previous reports have shown that hADSCs retain their mesenchymal cell lineage differentiation capability through multiple passages [16]. Therefore, we next examined the ability of hADSCs at different passages to differentiate into adipocytes and osteoblasts. Differentiation of hADSCs into adipocytes, as determined by Oil Red O staining, was observed in all passages. However, lipid vacuoles were more numerous and dense when we differentiated the cells at passages 4 and 7 as compared with passages 12 and 20 (Supplementary Fig. S1A; Supplementary Data are available online at www.liebertpub.com/scd). Consistent with this, the expression of PPARγ, the key adipogenic differentiation transcription factor, was significantly decreased in passages 12 and 20 as compared with passage 4 at days 5 and 10 of differentiation. Similar results were obtained in the expression of the following adipogenic-related markers: sterol regulatory element binding protein 1c, adipocyte protein 2, CCAAT/enhancer-binding protein α, and retinoid X receptor (RXR)α (Supplementary Fig. S1B). When hADSCs were differentiated into osteoblasts, as determined by ALP staining, the most staining occurred in passage 4 and the least occurred in passage 20 (Supplementary Fig. S2A). The mRNA expression of the osteogenic markers ALP, osteoprotegerin (OPG) and runt-related transcription factor 2 (Runx2) were significantly decreased in higher passages (Supplementary Fig. S2B).

NR expression pattern of hADSCs during in vitro culture

Stemness is maintained by several key regulatory transcription factors and signaling molecules, which establish precise patterns of gene expression that characterize the undifferentiated phenotype. NRs are involved in the pathway of tissue-specific stem cell regulation [17], and certain NRs also play crucial roles in maintaining ES cells in co-operation with Oct4 and Nanog [18,19]. To investigate the changes in NR expression profile of hADSCs during culture, we screened the expression of 48 human NRs at passages 4, 7, 12, and 20. Analysis of NR mRNA expression levels revealed that 24 NRs were expressed in all examined passages. The 24 expressed NRs were categorized into three groups according to their expression patterns over the four passages: NRs that remained unchanged (13/24, Fig. 4A), NRs with decreasing expression (10/24, Fig. 4B), and NRs with increasing expression (1/24, Fig. 4C). Of these, only two were statistically significant—PPARγ and thyroid hormone receptor (TR)β showed a significant decrease at passages 12 and 20 or passage 20, respectively, as compared with passage 4 (Fig. 4).

FIG. 4.

The mRNA expression profile of nuclear receptors (NRs) in hADSCs during expanded culture. hADSCs at passage 4, 7, 12, and 20 were harvested and mRNA expression for 48 NRs was analyzed by quantitative PCR. There were 24 NRs expressed in hADSCs, which could be categorized into three groups according to their expression patterns. (A) The expression level was consistent across passages: chicken ovalbumin upstream promoter-transcription factor (COUP-TF) 1, COUP-TF 2, ERBA-related gene (EAR)2, estrogen-related receptor (ERR) α, glucocorticoid receptor (GR), liver X receptor (LXR) β, mineralocorticoid receptor (MR), Nur-related factor (NURR1), peroxisome proliferator-activated receptor (PPAR)α, retinoic acid-related orphan receptor (ROR)α, retinoid X receptor (RXR)β, testicular orphan receptor (TR)2, and vitamin D receptor (VDR). (B) The expression level decreased across passages: LXRα, PPARβ, PPARγ, retinoic acid receptor (RAR)α, RARγ, reverse-erb (REV-ERB)α, RXRα, testicular orphan receptor (TR)4, thyroid hormone receptor (TR)α, and thyroid hormone receptor (TR)β. (C) The expression level increased across passages: RARβ. Values are expressed as mean±SD from four independent experiments. Ct higher than 33 was considered low or no expression *P<0.05, **P<0.01 as compared with passage 4, n=5–9.

Regulation of Oct4 gene expression level by PPARγ

Since PPARγ expression was significantly decreased at passages 12 and 20, we investigated whether PPARγ plays any role in regulation of Oct4, a stem cell marker. Treatment of hADSCs at passage 20 with troglitazone, a PPARγ activator, increased the expression of PPARγ mRNA in a dose- and time-dependent manner and the expression of Oct4 mRNA was increased with a similar pattern (Fig. 5A). To confirm that troglitazone treatment increases Oct4 gene expression, we measured Oct4 promoter activity in hADSCs transiently transfected with phOct4-luc plasmid and found that troglitazone (20 μM) significantly increased the luciferase activity (Fig. 5A). In addition, treatment with 15PGJ₂, another PPARγ activator, increased PPARγ and Oct4 mRNA levels in a time-dependent manner (Fig. 5B). We then examined whether PPARγ overexpression could increase the Oct4 promoter activity and found that PPARγ overexpression in hADSCs at passage 20 caused an increase in Oct4 luciferase activity (Fig. 5C). An additional experiment was carried out using GW9662, a PPARγ-specific antagonist, in order to confirm that regulation of Oct4 expression is affected by PPARγ. Troglitazone in combination with GW9662 (10 μM) failed to increase Oct4 mRNA levels in hADSCs (Fig. 5D). These data provide evidence that PPARγ directly increases transcription of the Oct4 gene.

FIG. 5.

Regulation of Oct4 transcripts by PPARγ in hADSCs. (A) hADSCs at passage 20 were treated with 10, 20, or 40 μM troglitazone for 24 h or with 20 μM troglitazone for 12, 24, or 36 h (n=6) and the expression of PPARγ mRNA and Oct4 mRNA was analyzed by quantitative PCR. hADSCs transfected with hOct4-luciferase plasmid (500 ng) and β-galactosidase plasmid were treated with troglitazone (20 μM) for 24 h, and luciferase activity was measured. (B) hADSCs at passage 20 were treated with 5 μM of 15-deoxy-Δ^12,14-prostaglandin J₂ (15PGJ₂) for 12, 24, or 36 h, and PPARγ and Oct4 mRNA expression was analyzed by quantitative PCR. (C) PPARγ overexpression increased Oct4 promoter activity. hADSCs were transfected with the phOct4-Luc reporter plasmid and pcDNA flag PPARγ plasmid or the empty pcDNA plasmid and incubated for 36 h. Luciferase activity was measured. The fold inductions of the normalized luciferase activity were compared with those in control cells transfected with the phOct4-Luc and the empty plasmid. (D) hADSCs at passage 20 were treated with (+) or without (−) troglitazone (tro) and GW9662 (10 μM) for 24 h, and Oct4 mRNA expression was analyzed by quantitative PCR. Data are means±SDs. *P<0.05, **P<0.01.

Since TRβ expression was significantly decreased at passage 20, we examined whether Oct4 expression could be affected by TRβ activation. We found that treatment of hADSCs at passage 20 with T3 (10–40 ng/mL) had no effect on Oct4 or TRβ mRNA levels (Supplementary Fig. S3).

Retaining the differentiation potential by PPARγ

Since PPARγ activator treatment or PPARγ overexpression increased Oct4 mRNA expression, we assessed whether overexpression of PPARγ can maintain the differentiation potential of hADSCs. hADSCs at passage 20 were transfected with the PPARγ plasmid and then differentiated into insulin-producing cells. Insulin and PDX1 mRNA levels were increased in PPARγ overexpressing cells compared with pcDNA-transfected cells (Fig. 6A). Exposure of the hADSCs to troglitazone for 24 h resulted in an increase in the pancreatic beta-cell-related gene expression (Fig. 6B).

FIG. 6.

Differentiation potential of PPARγ overexpressing hADSCs into insulin-producing cells. (A) hADSCs at passage 20 were transfected with the pcDNA flag PPARγ plasmid (PPARγ) or empty pcDNA plasmid (pcDNA), incubated for 24 h, and then differentiated into insulin-producing cells. (B) hADSCs were treated with or without 20 μM troglitazone for 24 h and then differentiated into insulin-producing cells. The mRNA expression levels of insulin and PDX1 were analyzed by quantitative PCR (n=6). Data are means ± SDs. **P<0.01.

Discussion

MSCs have great therapeutic interest for mediating endogenous repair of cells and tissue damage, but they need to be expanded before they can be used for therapeutic purposes. However, expansion in vitro causes changes at both cellular and molecular levels, resulting in a decrease of the proliferation and differentiation potential of MSCs [20,21]. We found morphological changes and decline of proliferation rates during long-term culture of hADSCs, as previously reported [22,23]. Many studies have reported that MSCs undergo the typical Hayflick phenomenon of cellular senescence during long-term culture in vitro [24]. In our study, we detected an increase of p16^INK4A mRNA and protein expression as passage numbers increased.

To determine whether in vitro expansion could alter the mesenchymal characteristics of the cells, we checked the expression of surface markers. FACS data showed that hADSCs exhibited the most common phenotypical MSC markers (CD73, CD90, and CD105), and the expression of these markers was similar regardless of passage, suggesting that they are not directly related to stem cell maintenance or functional ability. We then examined the expression of several pluripotent stem cell markers that have been reported to be expressed in MSCs [25]. The expression of Oct4, an important pluripotent marker of ES cells, and Nanog gradually declined with increase of passages, whereas the expression of Sox2 and Rex1 did not. These results suggest that long-term culture of hADSCs reduces stemness and differentiation potential.

We investigated whether hADSCs at later passages have a reduced ability to differentiate into insulin-producing cells. Several methods have been used to generate insulin-producing cells from stem cells in vitro [26]. We used a three-step protocol with a combination of defined factors for induction of insulin-producing cells. At the first stage, we used activin A and valproic acid to induce definitive endoderm and orient to the endocrine lineage, respectively [27,28]. Exendin-4 and bFGF were added at the second stage to expand pancreatic progenitors, promote a pancreatic fate, and stimulate insulin secretion [29]. To induce β cell maturation and proliferation as well as increase insulin secretion, exendin-4, HGF, and nicotinamide were supplied at the last stage. Since we did not use insulin that might be absorbed by cells during in vitro culture [30], the insulin which appeared in the clusters was synthesized de novo by differentiated hADSCs. Although hADSCs from all examined passages could successfully generate insulin-producing cells, hADSCs at later passages had reduced differentiation potential evidenced by reduced expression of β cell- and pancreatic lineage-related genes and lower secretion of insulin in differentiated cells.

In agreement with previous reports [31,32], our study also demonstrated that hADSCs at higher passages have a reduced ability to differentiate into adipocytes or osteoblasts. The limitation could be seen at passage 12, and the differentiation capability was lost at passage 20. The decrease in differentiation potential could be due to a decrease of the expression of Oct4 and Nanog transcription factors along with the increase of p16^INK4A. These results indicate that the intrinsic differentiation potential of hADSCs relates to pluripotent stem cell regulation as well as senescence machinery. However, the underlying mechanisms need to be explored further.

NRs are involved in many cellular pathways, including regulation of stemness and stem cell differentiation [17,33]. For example, estrogen-related receptor β, steroidogenic factor 1, liver receptor homolog-1 (LRH-1), and DAX-1 are involved in the maintenance of ES cell pluripotency [34]. Retinoic acid receptors play a role in the differentiation of ES cells into the neuronal cells, and activation of RXRs promotes differentiation of ES cell into cardiomyocytes [34]. Given the importance of NRs in controlling cell development, studying the expression of NRs during expanded culture in vitro could provide a view of changing transcriptional regulatory networks. To examine the expression profile of NRs in hADSCs during culture, we assessed the expression all 48 human NRs at passages 4, 7, 12, and 20 by quantitative PCR. A half of NRs examined were expressed in hADSCs (with the Ct≤33), and the expression of PPARγ and TRβ was significantly decreased with an increase in passage. We found that Oct4 mRNA and Oct4 promoter activity were correlated with PPARγ expression, suggesting that PPARγ may play a role in the regulation of Oct4 expression. Treatment of hADCSs with PPARγ activators elevated both PPARγ and Oct4 mRNA, and overexpression of PPARγ increased Oct4 promoter activity. Furthermore, PPARγ activation or overexpression in hADSCs improved the differentiation potential into insulin-producing cells. These results suggest that the up-regulation of Oct4 by PPARγ maintains the stemness and differentiation potential during expanded culture of hADSCs. Some NRs such as germ cell nuclear factor and LRH-1 are known to bind to the regulatory regions of Oct4 and suppress or activate Oct4 transcription in ES cells [34]. Further research is required to determine whether there are any putative PPAR response elements in the Oct4 promoter.

Since hADSCs are relatively easy to isolate and manipulate in vitro, they could be considered promising candidates for the development of various therapeutic modalities for tissue regeneration. A better understanding of the biological characteristics and their differentiation potential will allow us to properly manipulate hADSCs in vitro before transplantation. The reduction of differentiation potential during expanded culture needs to be solved for clinical application of stem cell therapy. Further investigations are needed to establish the culture strategies to permit the expansion of hADSCs while retaining their potential for differentiation.

Footnotes

Acknowledgements

This research was supported by a grant from the Innovative Research Institute for Cell Therapy Project, Ministry for Health, Welfare and Family Affairs, Republic of Korea (A062260) and a grant from the R&D program of MOTIE/KIAT.

Author Disclosure Statement

The authors declare that there are no conflicts of interest.

References

Friedenstein

, Gorskaja

and Kulagina

. (1976). Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp Hematol, 4:267–274.

De Ugarte

, Morizono

, Elbarbary

, Alfonso

, Zuk

, Zhu

, Dragoo

, Ashjian

, Thomas

, et al. (2003). Comparison of multi-lineage cells from human adipose tissue and bone marrow. Cells Tissues Organs, 174:101–109.

Zhu

, Liu

, Song

, Fan

, Ma

and Cui

. (2008). Adipose-derived stem cell: a better stem cell than BMSC. Cell Biochem Funct, 26:664–675.

Zuk

, Zhu

, Ashjian

, De Ugarte

, Huang

, Mizuno

, Alfonso

, Fraser

, Benhaim

and Hedrick

. (2002). Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell, 13:4279–4295.

Timper

, Seboek

, Eberhardt

, Linscheid

, Christ-Crain

, Keller

, Muller

and Zulewski

. (2006). Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells. Biochem Biophys Res Commun, 341:1135–1140.

Hayflick

and Moorhead

. (1961). The serial cultivation of human diploid cell strains. Exp Cell Res, 25:585–621.

Wagner

, Horn

, Castoldi

, Diehlmann

, Bork

, Saffrich

, Benes

, Blake

, Pfister

, Eckstein

and Ho

. (2008). Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One, 3:e2213

Izadpanah

, Kaushal

, Kriedt

, Tsien

, Patel

, Dufour

and Bunnell

. (2008). Long-term in vitro expansion alters the biology of adult mesenchymal stem cells. Cancer Res, 68:4229–4238.

Xie

, Jeong

, Fu

, Bookout

, Garcia-Barrio

, Sun

, Kim

, Xie

, Root

, et al. (2009). Expression profiling of nuclear receptors in human and mouse embryonic stem cells. Mol Endocrinol, 23:724–733.

10.

Krishnamurthy

, Torrice

, Ramsey

, Kovalev

, Al-Regaiey

, Su

and Sharpless

. (2004). Ink4a/Arf expression is a biomarker of aging. J Clin Invest, 114:1299–1307.

11.

Shibata

, Aoyama

, Shima

, Fukiage

, Otsuka

, Furu

, Kohno

, Ito

, Fujibayashi

, et al. (2007). Expression of the p16INK4A gene is associated closely with senescence of human mesenchymal stem cells and is potentially silenced by DNA methylation during in vitro expansion. Stem Cells, 25:2371–2382.

12.

Kang

, Kim

, Park

, Kim

, Lee

, Seo

, Kang

, Lee

and Lim

. (2009). Insulin-secreting cells from human eyelid-derived stem cells alleviate type I diabetes in immunocompetent mice. Stem Cells, 27:1999–2008.

13.

Kolf

, Cho

and Tuan

. (2007). Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation. Arthritis Res Ther, 9:204.

14.

Lin

, Luo

, Chen

, Liu

, Qiao

, Yan

, Li

, Tang

, Zheng

and Tian

. (2005). Molecular and cellular characterization during chondrogenic differentiation of adipose tissue-derived stromal cells in vitro and cartilage formation in vivo . J Cell Mol Med, 9:929–939.

15.

Liu

, Martina

, Hutmacher

, Hui

, Lee

and Lim

. (2007). Identification of common pathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem Cells, 25:750–760.

16.

Izadpanah

, Trygg

, Patel

, Kriedt

, Dufour

, Gimble

and Bunnell

. (2006). Biologic properties of mesenchymal stem cells derived from bone marrow and adipose tissue. J Cell Biochem, 99:1285–1297.

17.

Jeong

and Mangelsdorf

. (2009). Nuclear receptor regulation of stemness and stem cell differentiation. Exp Mol Med, 41:525–537.

18.

Kelly

, Xu

, Kuick

, Koenig

and Hammer

. (2010). Dax1 up-regulates Oct4 expression in mouse embryonic stem cells via LRH-1 and SRA. Mol Endocrinol, 24:2281–2291.

19.

van den Berg

, Zhang

, Yates

, Engelen

, Takacs

, Bezstarosti

, Demmers

, Chambers

and Poot

. (2008). Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog gene expression. Mol Cell Biol, 28:5986–5995.

20.

Gimble

, Guilak

and Bunnell

. (2010). Clinical and preclinical translation of cell-based therapies using adipose tissue-derived cells. Stem Cell Res Ther, 1:19

21.

Barry

and Murphy

. (2004). Mesenchymal stem cells: clinical applications and biological characterization. Int J Biochem Cell Biol, 36:568–584.

22.

Chen

, Huang

and Hsieh

. (2007). Hyaluronan preserves the proliferation and differentiation potentials of long-term cultured murine adipose-derived stromal cells. Biochem Biophys Res Commun, 360:1–6.

23.

Bruder

, Jaiswal

and Haynesworth

. (1997). Growth kinetics, self-renewal, and the osteogenic potential of purified human mesenchymal stem cells during extensive subcultivation and following cryopreservation. J Cell Biochem, 64:278–294.

24.

Bonab

, Alimoghaddam

, Talebian

, Ghaffari

, Ghavamzadeh

and Nikbin

. (2006). Aging of mesenchymal stem cell in vitro . BMC Cell Biol, 7:14

25.

Park

and Patel

. (2010). Changes in the expression pattern of mesenchymal and pluripotent markers in human adipose-derived stem cells. Cell Biol Int, 34:979–984.

26.

Wong

. (2011). Extrinsic factors involved in the differentiation of stem cells into insulin-producing cells: an overview. Exp Diabetes Res, 2011:406182

27.

Haumaitre

, Lenoir

and Scharfmann

. (2009). Directing cell differentiation with small-molecule histone deacetylase inhibitors: the example of promoting pancreatic endocrine cells. Cell Cycle, 8:536–544.

28.

Sulzbacher

, Schroeder

, Truong

and Wobus

. (2009). Activin A-induced differentiation of embryonic stem cells into endoderm and pancreatic progenitors-the influence of differentiation factors and culture conditions. Stem Cell Rev, 5:159–173.

29.

Champeris Tsaniras

and Jones

. (2010). Generating pancreatic beta-cells from embryonic stem cells by manipulating signaling pathways. J Endocrinol, 206:13–26.

30.

Hansson

, Tonning

, Frandsen

, Petri

, Rajagopal

, Englund

, Heller

, Hakansson

, Fleckner

, et al. (2004). Artifactual insulin release from differentiated embryonic stem cells. Diabetes, 53:2603–2609.

31.

Wall

, Bernacki

and Loboa

. (2007). Effects of serial passaging on the adipogenic and osteogenic differentiation potential of adipose-derived human mesenchymal stem cells. Tissue Eng, 13:1291–1298.

32.

Wan Safwani

, Makpol

, Sathapan

and Chua

. (2011). The changes of stemness biomarkers expression in human adipose-derived stem cells during long-term manipulation. Biotechnol Appl Biochem, 58:261–270.

33.

Heng

, Feng

, Han

, Jiang

, Kraus

, Ng

, Orlov

, Huss

, Yang

, et al. (2010). The nuclear receptor Nr5a2 can replace Oct4 in the reprogramming of murine somatic cells to pluripotent cells. Cell Stem Cell, 6:167–174.

34.

Mullen

, Gu

and Cooney

. (2007). Nuclear receptors in regulation of mouse ES cell pluripotency and differentiation. PPAR Res, 2007:61563

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.19 MB

0.13 MB

0.04 MB