miR-26b-3p Regulates Human Umbilical Cord-Derived Mesenchymal Stem Cell Proliferation by Targeting Estrogen Receptor

Abstract

Human umbilical cord-derived mesenchymal stem cells (hUC-MSC) have been considered as promising candidates for cell-based regeneration medicine. However, the application was limited to its poor in vitro proliferation ability against the huge demand of cells. MicroRNA plays important roles in the regulation of cell proliferation, apoptosis, and differentiation. The objective of this study is to explore the roles of miRNAs in regulating the in vitro proliferation of hUC-MSC and unveil their possible mechanism. In this study, we found that miR-26b-3p was significantly upregulated during serial in vitro passage of hUC-MSC and was correlated with cellular senescence and cell cycle genes. The overexpression of miR-26b-3p greatly inhibited the proliferation of hUC-MSC in vitro, which is indicated by 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay, cell cycle, and cell growth curve analyses. miR-26b-3p suppression partly rescued this phenotype by maintaining its proliferation ability in vitro. For mechanism studies, we predicted and validated that miR-26b-3p suppresses estrogen receptor 1 (ESR1) expression by directly binding to the coding sequence (CDS) region of its message RNA (mRNA), thus subsequently changing the expression of its downstream effector Cyclin D1. In conclusion, we found that miR-26b-3p played an important role in the regulation of hUC-MSC proliferation in vitro by targeting the ESR-CCND1 pathway.

Introduction

Mesenchymal Stem Cells (MSCs) are attractive and promising candidates for cell-based regenerative medicine due to their self-renewal capacity, multilineage differentiation potential, paracrine effects, and immunosuppressive properties. MSCs have been successfully used in organ/cell transplantation, treatment of autoimmune disease, and tissue repair [1,2]. The NIH website (http://clinicaltrials.gov) lists 19,364 cell-based therapies, and 206 of those are MSCs-related, involved in a wide range of therapeutic applications including bone/cartilage disease, graft versus host disease, and brain disease. Some of these trials are in Phase III or Phase II/III [1,3,4].

In recent years, human umbilical cord-derived mesenchymal stem cells (hUC-MSC) attract attentions as a more promising source of MSCs [5]. Accumulating evidence showed that hUC-MSC may have therapeutic advantages to treat several diseases, especially autoimmune and neurodegenerative diseases. However, the ultimate requirement of cell-based therapy is that the functional cells reach their target in sufficient numbers to achieve a good clinical outcome. But as hUC-MSC gradually lost their therapeutic properties and proliferation abilities during in vitro amplification [6], there is a compelling need for finding a way to suppress hUC-MSC cellular senescence and maintain their proliferation abilities in vitro that enable more effective application for cell-based therapy in the future.

MicroRNAs (miRNAs) are small (20–22 nucleotides) noncoding RNAs that cause translational repression and/or message RNA (mRNA) destabilization by binding to the target mRNAs [7]. MiRNAs are reported to play important roles in the regulation of cell proliferation, apoptosis, and differentiation [8,9]. Herein, we screened a set of miRNAs that may have strong influence on hUC-MSC. Among which, miR-26b-3p, a reported miRNA that inhibits the growth in many cancer cells [10] that significantly upregulates during serial in vitro passage, inhibits the proliferation of hUC-MSC by regulating the mRNA and protein level of estrogen receptor 1 (ESR1), thus influencing its downstream target CCND1. To this end, we identified that serial in vitro passage upregulated miR-26b-3p could inhibit hUC-MSC proliferation through ESR1-CCND1 pathway, thus providing new insights into in vitro proliferation control of hUC-MSC.

Materials and Methods

Cell culture

Human umbilical cords were obtained from the Changhai Hospital affiliated to the Second Military Medical University, all umbilical cords were obtained with patients' informed written consents. hUC-MSC were then isolated and cultured as follows. Briefly, fresh umbilical cords and skin were firstly washed with 70% ethanol and Dulbecco's modified Eagle's medium (DMEM; Gibco-Invitrogen) to remove excess blood. The tissues were then minced and cultured in DMEM containing 10% fetal bovine serum (FBS) at 37°C. When the cells reached 70% confluence, they were trypsinized for subculture with 0.05% trypsin and 0.025% ethylenediamine tetraacetic acid (EDTA). Daily cultures were done using DMEM with 10% FBS, 100 IU/mL streptomycin and penicillin, and 2 mM l-glutamine (Gibco-Invitrogen). Eight human umbilical cords were obtained and successfully cultured totally, and each successfully cultured primary cell lines were partially cryopreserved after each passage for further study.

Characterization of hUC-MSC by flow cytometry

The isolated hUC-MSC were detached from the culture flask, washed, and suspended in 1% bovine serum albumin (BSA) containing relevant antibodies including CD29, CD90, CD44, CD34, CD14, CD45, and HLA-DR (BD Biosciences), and incubated at room temperature for 30 min. The isotype antibody was used as control. The cells were then washed with the BSA and analyzed using BD FACSCalibur flow cytometry analyzer (BD Biosciences).

RNA isolation and real-time polymerase chain reaction analysis

Total RNA was extracted using TRIzol (Invitrogen). The miRNA was reverse transcribed with specific primer (Supplementary Table S1; Supplementary Data are available online at www.liebertpub.com/scd). For mRNA, the first-strand complementary DNA (cDNA) was generated with random primers and oligo dT. For analysis, cDNA were analyzed with real-time polymerase chain reaction (PCR) using a Power SYBR Green PCR Master Mix (Roche) in a StepOne Plus System (Applied Biosystems) according to the standard protocol.

Plasmids construction

For screening which part of ESR1 mRNA is effective to miR-26b-3p binding, we first cloned the coding sequence (CDS) region and 3′ untranslated region (UTR) region into the pmiR-Report vector (Promega). The 3′UTR region was separated into two parts and together with the CDS region we generated three reporter vectors using the primers listed in the Supplementary Table S1. The ESR1 CDS containing putative miR-26b-3p binding site, which we identified later, was amplified from hUC-MSC cDNA and cloned into pmiR-Report vector (the vector contains flanking sequence ∼200 bp up- and downstream of the target site; Promega) downstream of the luciferase coding gene to generate wild-type (wt) ESR1-CDS. ESR1-CDS vector with mutated bases within the putative miR-26b-3p binding site is also cloned and named variant ESR1-CDS. The primers for PCR or quantitative real-time PCR used in this study were listed in Supplementary Table S1.

Luciferase reporter gene assays

HEK293 cells were plated into 96-well. When 70% confluent, the cells were co-transfected with the pRL-TK plasmid, the indicated reporter construct containing either wild-type or mutant binding site of miR-26b-3p and miR-26b-3p mimics/inhibitor. At 48 h post-transfection, dual luciferase reporter assay was performed according to the manufacturer's instruction. The results were normalized using pRL-TK. All experiments were performed with four replicates.

Western blot

The protein concentration was determined using a BCA Protein Assay Kit (Beyotime). The protein extracts were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to poly-vinylidene difluoride membranes (Millipore). Nonspecific protein was blocked with 5% dried skim milk for 1 h, and the membranes were incubated overnight with antibodies directed against ESR1 (1:500; Proteintech) and GAPDH (1:1,000; ABclonal). Horseradish peroxidase (HRP)-conjugated secondary antibodies (Abgent) were diluted at 1:5,000. The signals were assessed using Chemiluminescent HRP Substrate (Millipore) and a Bioshine ChemiQ imaging scanner (Bioshine).

5-ethynyl-2′-deoxyuridine incorporation assays

Five-ethynyl-2′-deoxyuridine (EdU) incorporation assay was carried out according to the following procedure. hUC-MSC were plated into 48-well plates. When cells reach 70% confluent, the medium was changed containing 50 μM EdU and incubated for 4 h at 37°C. After the incubation, cells were washed twice with phosphate-buffered saline (PBS) and fixed in 4% poly formaldehyde for 30 min. Then, the cells were stained with Apollo 567 and Hoechst 33342 solution according to the manufacturer's instructions.

Cell cycle analysis

Cell cycle distribution was analyzed using flow cytometry. hUC-MSC treated with miR-26b-3p mimics or inhibitor were harvested using trypsin/EDTA and washed twice with PBS. Aliquots of at least 2 × 10⁶ cells were centrifuged, fixed in 70% ethanol, and stained with 500 μL propidium iodide solution. Labeled cells were analyzed using a BD FACSCalibur (BD Biosciences) system and the data were analyzed using CellQuest software.

Growth curve

hUC-MSC transfected by miR-26b-3p were seeded to 96-well plates with three replicates for each group. Cells were counted by cytometry, and the mean value was calculated for 7 consecutive days. The medium was changed at a 3-day interval for uncounted cells.

Cell differentiation assay

hUC-MSC were induced with DMEM supplemented with 10% FBS, 50 mg/mL ascorbate-2 phosphate, 10⁻⁸ M dexamethasone, and 10 mM β-glycerophosphate to differentiate into osteoblasts. DMEM supplemented with 10% FBS, 50 mg/mL ascorbate-2 phosphate, 10⁻⁷ M dexamethasone, 50 mM indomethacin, 0.45 mM 3-isobutyl-1-methylxanthine, and 10 mg/mL insulin to differentiate into adipocytes, respectively. After 3 weeks of induction, cells treated with osteoblast induction medium were stained with alizarin red S, and cells treated with adipocyte induction medium were stained with oil red O. Samples were run in triplicates.

Statistical analysis

Each experiment was repeated at least three times independently. Statistical significance was assessed by comparing mean values ± standard deviation using a Student's t-test for independent groups and was assumed for *P < 0.05.

Results

The expression level of miR-26b-3p was associated with hUC-MSC proliferation and cellular senescence in vitro

The surface markers of the primary hUC-MSC were first detected by flow cytometry. The cells isolated and cultured were of hUC-MSCs traits, which were positive for CD29, CD44, and CD90 while negative for CD14, CD34, and CD45 (Fig. 1A). Serial passage of the primary hUC-MSC resulted in poor morphology (a more flattened and spiked morphology) and delayed doubling time as we assessed (Fig. 1B). This phenotype is accompanied by a reduction in expression of cell cycle promoting genes like CCND1, CCNE1, CDK2, and CDK4 (Fig. 1C), while a relative upregulation of negative factors (Fig. 1D).

FIG. 1.

The expression level of miR-26b-3p is associated with lowered proliferation ability of human umbilical cord-derived mesenchymal stem cells (hUC-MSC). (A) Flow cytometry analysis of the surface markers of primary cultured hUC-MSC. An isotype IgG antibody was used as control. (B) Representative images showing different morphology of early and late passaged hUC-MSC (left panels). Scale bars represent 200 nm. The mean doubling time of different passaged hUC-MSC were assessed by cell counting (right panels), *P < 0.05, **P < 0.01. (C, D) Assessment of the expression level of positive regulators (C) and negative regulators (D) in cell cycle between early passaged (passage 2) and late passaged (passage 6) hUC-MSC, *P < 0.05, **P < 0.01. (E) Assessment of candidate microRNAs in early passaged (passage 2) and late passaged (passage 6) hUC-MSC using quantitative polymerase chain reaction (qPCR), **P < 0.01. (F) Expression level of miR-26b-3p during serial in vitro passage of hUC-MSC were assessed using qPCR, *P < 0.05, **P < 0.01. Data are represented as mean ± standard deviation (SD), n = 3.

To unveil the roles of miRNAs in such phenotypic change of hUC-MSC during serial cultivation in vitro, we screened a set of miRNAs that were reported to have strong influences in MSC lineage commitment [11 –16]. By assessing their expression change in early-passage (passage 2) and late-passage (passage 6) hUC-MSC, we found the expression level of miR-26b-3p was significantly increased in late-passage hUC-MSC (Fig. 1E), and further assessment showed that miR-26b-3p expression significantly increased after passage 4 (Fig. 1F), contrary to the proliferation ability of hUC-MSC with passage. These results indicated the proliferation ability of hUC-MSC was in inverse association with the expression level of miR-26b-3p. It made us suppose that potential relationship may exist between miR-26b-3p and the proliferation ability of hUC-MSC, which is worth further investigation.

miR-26b-3p regulated hUC-MSC proliferation and cellular senescence in vitro

To analysis the effect of miR-26b-3p on hUC-MSC proliferation, we synthesized miR-26b-3p mimics and inhibitors. Their efficacy was tested by qPCR (Fig. 2A, C). The proliferation ability, cell cycle, and cell growth curve were tested by EdU assay, flow cytometry, and growth curve analysis, respectively. The results showed EdU-positive cells were significantly lowered in 26b-3p^OE group than negative control (NC^OE) group (Fig. 2B), while the miR-26b-3p inhibitors transfected group has significantly more EdU-positive cells than negative control (NC^Inh) group (Fig. 2D). Flow cytometry showed the 26b-3p^OE group has lower percentage of G2/M phase cells, while the 26b-3p^Inh group has more percentage of G2/M phase cells compared with relative control groups (Fig. 2E). The cell growth curve showed that the number of cells were significantly lower in the 26b-3p^OE group than its control group (Fig. 2F, upper panel), while they significantly increased in the 26b-3p^Inh group (Fig. 2F, lower panel) at 72 h. The RNA levels of cell senescence and cell cycle-related genes were significantly increased in the 26b-3p^OE group compared with the control group (Fig. 2G), while it significantly decreased in the 26b-3p^Inh group. These findings confirm that miR-26b-3p could inhibit hUC-MSC proliferation, while miR-26b-3p inhibitors promoted the proliferation of hUC-MSC in vitro.

FIG. 2.

miR-26b-3p regulated hUC-MSC proliferation and cellular senescence. (A) The overexpression efficiency of miR-26b-3p in 26b-3p^OE group was assessed using qPCR. A scramble oligo RNA with the same length was used as negative control (NC), **P < 0.01. (B) Representative immunofluorescence images of 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay in 26b-3p^OE group is shown in the left panels. The quantification of EdU-positive cells in five random microscopy field was counted and the measurement results were shown in the right panels. Scale bars represent 200 nm. **P < 0.01. (C) The inhibition efficiency of miR-26b-3p in 26b-3p^Inh group was assessed using qPCR. A scramble inhibitor RNA was used as negative control (NC), **P < 0.01. (D) The EdU incorporation rate of 26b-3p^Inh group compared with inhibitor control was shown. *P < 0.05. (E) The cell cycle analyses of 26b-3p^OE group (upper) and 26b-3p^Inh group (lower) were shown, and the quantified G2 cell distribution percentage is shown in the right panels. **P < 0.01. (F) The hUC-MSC growth curve was shown in 26b-3p^OE group (upper) and 26b-3p^Inh group (lower). **P < 0.01. (G, H) The expression level of negative (G) and positive (H) cell cycle regulators in 26b-3p^OE group were assessed using qPCR. *P < 0.05, **P < 0.01. Data are represented as mean ± SD, n = 3.

miR-26b-3p directly targets the CDS region of ESR1 mRNA

To find out the target of miR-26b-3p, which may play an important role in mediating hUC-MSCs proliferation, we used TargetMiner database to search for putative targets of miR-26b-3p. To increase the probability of the prediction, we chose proliferation-related genes with more than 10 putative target sites as effective candidates (Table 1). The mRNA level of these candidates were analyzed using qPCR (Fig. 3A), among which the RNA level of ESR1 was found significantly decreased in the 26b-3p^OE group. To further confirm the effect of miR-26b-3p on ESR1, we analyzed ESR1 protein and mRNA expression using western blot and qPCR respectively in both 26b-3p^OE and 26b-3p^Inh groups. The ESR1 protein and mRNA expression in the 26b-3p^Inh group were significantly higher than that in the 26b-3p^OE group (Fig. 3B). These results confirmed that miR-26b-3p indeed affects ESR1 expression.

FIG. 3.

miR-26b-3p directly inhibit estrogen receptor 1 (ESR1) message RNA (mRNA) by targeting its coding sequence (CDS) region. (A) The effect of miR-26b-3p on putative target RNAs were assessed using qPCR. **P < 0.01, n = 5. (B) Verification of the effect of miR-26b-3p on ESR1 expression in both RNA (upper panels) and protein level (lower panels) in 26b-3p^OE and 26b-3p^Inh group compared to their relative control. **P < 0.01, n = 3. (C) The expression change of ESR1 in different passaged hUC-MSC was assessed in both RNA (left panels) and protein (right panels) levels. *P < 0.05, **P < 0.01, n = 3. (D) Dual luciferase reporter assay validating putative miR-26b-3p target sites in ESR1 mRNA. **P < 0.01, n = 5. (E) A scheme showing the validated target site of miR-26b-3p in ESR1 mRNA CDS region. The mutated sequence used in (F) is indicated. (F) The relative luciferase activities in 26b-3p^OE and 26b-3p^Inh groups with wild-type (wt) or mutated miR-26b-3p binding sites in ESR1 CDS region. **P < 0.01, n = 5. Data are represented as mean ± SD.

Table 1.

Primers Used in This Article

Gene	Primer for qRT-PCR primer (5′-3′)
CCND1	5′: AGTGGAAACCATCCGCCG
	3′:TCTGTTCCTCGCAGACCTCC
CCNE1	5′: GCCCGGCCTATATATTGGGTT
	3′: GGGCTGCTGCTTAGCTTGTA
CDK2	5′: CTTTGCTGAGATGGTGACTCG
	3′: TGTTAGGGTCGTAGTGCAGC
CDK4	5′:GTGAGGGTCTCCCTTGATCTG
	3′: CAGTCGCCTCAGTAAAGCCA
SOX17	5′: TTCGTGTGCAAGCCTGAGAT
	3′: TAATATACCGCGGAGCTGGC
GATA4	5′: CCAATCTCGATATGTTTGACGACT
	3′: ACAGATAGTGACCCGTCCCA
NKX2.5	5′: GAGAGTTTGTGGCGGCGATT
	3′: CGACGGCGAGATAGCAAAGG
NESTIN	5′: TCAGCTTTCAGGACCCCAAG
	3′: GGTGTCTCAAGGGTAGCAGG
ESR1	5′: ATGAAAGGGATACGAAAAGACCG
	3′: TTGGCAGCTCTCATGTCTCC
MET	5′: GCTTTGTGAGCAGATGCGG
	3′: AGGTTTATCTTTCGGTGCCCAG
SMAD2	5′: CAATCGCCCATTCCCCTCTT
	3′: AGTCTCTTCACAACTGGCGG
NTRK2	5′: GCTCCCGGAATTGGGTTGG
	3′: CGCAGATTCCTTGTTAGATGCG
INSR	5′: AGACGTCCCGTCAAATATTGC
	3′: CCATCTGGCTGCCTCTTTCT
TSC1	5′: CTGAACCACCACAAGCTACTCT
	3′: CCTGCAGTTGTACCAAAGACT
IGF1R	5′: GGCTAAACCCGGGGAACTAC
	3′: AGTTTTCATATCTTTTGGCCTGGAC
JUN	5′: GTGCCGAAAAAGGAAGCTGG
	3′: CTGCGTTAGCATGAGTTGGC
HDAC1	5′: GTTCTGTGGCAAGTGCTGTG
	3′: TGCCTCGGACTTCTTTGCA
PRB	5′:CCTCATGCTGTTCAGGAGACAT
	3′: GGCTTCGAGGAATGTGAGGT
NRIP1	5′: AGAGCTTGGAGACAGACGAAC
	3′: TTCTACGCAAGGAGGAGGAG
XBP1	5′: CAGACTACGTGCACCTCTGC
	3′: GACTGGGTCCAAGTTGTCC
BRAF	5′: TTCACCGCAGTGCATCAGAA
	3′: GTGGACAGGAAACGCACCA
miR-26b-3p	5′: GGCCTGTTCTCCATTACTTGG
	3′: CGCTTCACGAATTTGCGTGTCAT
U6	5′: GCTTCGGCAGCACATATACTAAAAT
	3′: CGCTTCACGAATTTGCGTGTCAT

	Primer for reverse transcription (5′-3′)
ESR1	5′: CCCAAGCTTGGGCCCACTCAACAGCGTGTCTC
	3′: GACTAGTCAGGTTGGCAGCTCTCATGTC
ESR1 variant	5′: CTGCAGCCCCACGGCCAGCAGGTGCCCTACTACCACC TCTTGGAGCCCAGCGGCTACACGGTGCGCGAGGCC
	3′: GGCCTCGCGCACCGTGTAGCCGCTGGGCTCCAAGAGG TGGTAGTAGGGCACCTGCTGGCCGTGGGGCTGCG
miR-26b-3p RT	GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGAATTG
	CACTGGATACGACGAGCC
u6 RT	AACGCTTCACGAATTTGCGT

5′, forward primers; 3′, reverse primers; ESR1, estrogen receptor 1; qRT-PCR, quantitative real-time polymerase chain reaction.

Since miR-26b has been implicated to take vital roles in cell proliferation control in several tumor cell lines [17 –22], we again evaluated the gene expressions of other reported targets in early and late passaged hUC-MSC. Results showed that none has significant changes in expression between passages as strengthened by analyzing the high-throughput profiles of their transcriptome expressions of passage 9 and passage 18 human MSCs (Supplementary Fig. S1A, B). However, the levels of ESR1 mRNA and protein during serial cultivation in vitro were decreased significantly (Fig. 3C), this change is also confirmed by the high-throughput profiles (Supplementary Fig. S1A). These results showed that among the reported targets and the newly tested targets of miR-26b-3p, only ESR1 showed a negative correlation with miR-26b-3p during serial passage of hUC-MSC.

It is unclear, however, whether miR-26b-3p directly target ESR1. Through TargetMiner prediction, we found 13 putative binding sites, among which ten 6mer and one 7mer-m8 sites were located in the 3′UTR region, and the 8mer site was located in the coding sequence (CDS) region of ESR1 mRNA. We thus constructed one CDS region and two separated 3′UTR region luciferase reporters as indicated in the Fig. 3D. Through dual-luciferase assay, we found only the luciferase activities of CDS region reporter were downregulated upon miR-26b-3p transfection (Fig. 3D). These results indicated that the predicted 8mer site may contribute most to the targeting of miR-26b-3p. To validate this binding site, we cloned the CDS of ESR1, which contained the wild-type or the mutated miR-26b-3p binding site (including its flanking sequences) into a new luciferase reporter plasmid (Fig. 3E). Luciferase activities of the wild-type reporter were significantly decreased in 26b-3p^OE group while increased in 26b-3p^Inh group compared with control. However, no significant difference of the luciferase activities were observed among the mutated ESR1 CDS groups (Fig. 3F). The results validated that miR-26b-3p regulates the expression of ESR1 via directly binding to the CDS region of ESR1 mRNA.

ESR1 is essential for the function of miR-26b-3p

ESR1 is an important nuclear receptor and transcript factor that plays an important role in various cellular processes. To further validate miR-26b-3p exerts its function of proliferation regulation through ESR1, we analyzed the EdU incorporation rate of hUC-MSC treated by 17β-estradiol (E2), an ESR1 agonist, or ESR1 antagonist fulvestrant (F). The results showed that the EdU incorporation rate was increased significantly in E2 (0.1 nM) treated hUC-MSC, while ESR1 antagonist fulvestrant (1 nM) decreased the EdU incorporation rate (Fig. 4A). To further analyze ESR1 perturbation affected the function of miR-26b-3p, we added F to the 26b-3p^Inh transfected cells and reduced the EdU incorporation rate, which partially reversed the effect of miR-26b-3p inhibition to a normal level (Fig. 4B). As expected, the lowered EdU incorporation rate was significantly reversed by adding E2 to the 26b-3p^OE transfected cells (Fig. 4C). These results indicate that miR-26b-3p inhibits hUC-MSC proliferation at least partially through inhibiting ESR1 expression.

FIG. 4.

miR-26b-3p exert proliferation regulatory function through ESR1. (A) The EdU incorporation assay of 17β-estradiol (E2), fulvestrant (F), and DMSO-treated group. Representative immunofluorescence images were shown in the left panels and the measurement results shown in right. (B) The EdU incorporation assay of 26b-3p^Inh, 26b-3p^Inh+F, NC^Inh+F, and NC^Inh group. (C) The EdU incorporation assay of 26b-3p^OE, 26b-3p^OE+E2, NC^OE+E2, and NC^OE group. Data are represented as mean ± SD, **P < 0.01, n = 5. NS, not significant.

CCND1 is mainly regulated by miR-26b-3p-ESR1 axis

To further explore the downstream target of miR-26b-3p, we examined the expression of ESR1 regulated genes, among which CCND1 showed strong correlation with miR-26b-3p perturbation (Fig. 5A). It is known that CCND1 plays an important role in regulating proliferation and cell cycle, and the RNA level of CCND1 was significantly increased in E2 group, which is consistent with the previous findings that CCND1 is regulated by ESR1 (Fig. 5B). When adding E2 to miR-26b-3p^OE transfected cells, the lowered expression of CCND1 caused by miR-26b-3p overexpression was significantly reversed (Fig. 5C). And opposite change was observed in 26b-3p^Inh group treated with F compared with miR-26b-3p inhibition alone (Fig. 5D, E). In conclusion, miR-26b-3p could inhibit hUC-MSC proliferation via ESR1 by changing the expression level of ESR1 downstream effector CCND1.

FIG. 5.

CCND1 was regulated by miR-26b-3p-ESR1 axis. (A) Assessment of the expression level of ESR1 downstream effectors in 26b-3p^OE, 26b-3p^Inh, and NC groups. **P < 0.01. (B) The expression level of CCND1 in E2 treatment group. **P < 0.01. (C) The level of CCND1 in 26b-3p^OE, 26b-3p^OE+E2, and NC^OE group. **P < 0.01. (D) The level of CCND1 in F group. *P < 0.05. (E) The level of CCND1 in 26b-3p^Inh, 26b-3p^Inh+F, and NC^Inh group. **P < 0.01. Data are represented as mean ± SD, n = 3.

miR-26b-3p promotes adipogenic differentiation in hUC-MSC by modulating estrogen signaling

To further explore the effect of miR-26b-3p in hUC-MSC differentiation, and to clarify the function of miR-26b-3p regulated estrogen signaling during differentiation, we setup osteogenic and adipogenic differentiation model by using commercially available induction medium. By overexpressing miR-26b-3p, we found that the adipogenic differentiation-related gene expression upregulated significantly, while osteogenic-related genes downregulated to some extent (Fig. 6A, B). The relative staining of the adipogenic and osteogenic induction cells also supported this change. However, inhibiting miR-26b-3p showed inversed effect to that of miR-26b-3p overexpression (Fig. 6C, D). These results indicated that miR-26b-3p may play a role in promoting adipogenic differentiation of hUC-MSCs.

FIG. 6.

miR-26b-3p promotes adipogenic differentiation by modulating estrogen signaling. (A, C) Assessment of both the expression level of adipogenic differentiation-related gene PPAR, lipoprotein lipase expression, and the differentiation level by red oil O staining of the treated cells. **P < 0.01, the scale bar represents 200 nm. (B, D) Assessment of both the expression level of osteogenic differentiation-related gene RUNX2, IBSP expression, and the differentiation level by Safranin red staining of the treated cells. **P < 0.01, the scale bar represents 200 nm. Data are represented as mean ± SD, n = 3.

To test whether modulation of estrogen signaling is required for this effect, we added E2 to the miR-26b-3p overexpression group, and found that the elevated PPARγ and lipoprotein lipase decreased upon treatment and the osteogenic factors increased compared with miR-26b-3p overexpression group (Fig. 6A, B). While adding F to the miR-26b-3p inhibiting group showed significant induction of adipogenic genes' expression and decreased osteogenic genes' expression (Fig. 6C, D). These results together implied that miR-26b-3p promoted adipogenic differentiation through modulating estrogen signaling, and probably by direct modulation of ESR1.

Discussion

MSC-based therapy is a fast-growing field that has proven safe and effective in the treatment of various degenerative diseases and tissue injuries [23]. Self-renewal and multipotency are the key hallmarks of MSC, which features establish MSC as the most promising tool for regenerative medicine [24,25]. However, it remains difficult to culture sufficient numbers of effective MSC for treatment. On the one hand, the large number of MSC needed for clinical application limited its usage. On the other hand, after cells passage cultivation, MSCs become large and flatten, and may lose therapeutic properties gradually. And in general, administered MSCs were limited in passage 1–5 in reported clinical trials [26,27]. In this study, we observed cell morphology become longer and larger, proliferation become slower, and proliferation relative gene was decreased in late passages of hUC-MSC. This is consistent with the results of the published report. The mechanism for this phenomenon remains elusive.

MicroRNAs (miRNAs) participate in the regulation of a large variety of cellular processes including proliferation, differentiation, migration, metabolism, and apoptosis [27,28]. We screened a set of reported functional miRNAs in MSCs and found miR-26b is significantly upregulated during continued passages in hUC-MSC, and correlates negatively with cell cycle promoting genes.

miR-26b encoded in an intron of the CTDSP2 [17], was indicated recently a downregulation in many cancer cells. miR-26b is downregulated in epithelial ovarian carcinoma, and directly targets KPNA2. miR-26b/KPNA2 axis suppresses tumor proliferation and metastasis through decreasing OCT4 expression [18]. Overexpression of miR-26b dramatically inhibited proliferation, invasion, and migration of HCC cells by targeting EphA2 [19]. miR-26b regulates β-catenin and cyclin D1 levels by inhibiting GSK-3β expression, which in turn alters the Wnt/GSK-3β/β-catenin pathway to lower rheumatoid arthritis fibroblast-like synoviocyte proliferation and elevate cell apoptosis and the secretion of TNF-α, IL-1β, and IL-6 cytokines [20]. miR-26b exerts a tumor suppressive role in breast cancer and the miR-26b-mediated growth inhibition is achieved through suppression of a new target gene CDK8 [21]. miR-26b promoted differentiation and, at least partly by targeting cyclin D2, attenuated cell proliferation via arresting the G1/S transition [22]. Cancer cells share some characteristics with stem cells, including self-renewal and differentiation. One more important feature of stem cell is that it may accumulate genetic changes during prolonged culturing in vitro. Some of those changes resemble the ones found in tumors. Therefore, for safety issues, there is also a need to confirm their stem cell genetic integrity [29]. It has been reported that human germline stem cell (SSC) line was able to colonize and proliferate in vivo in the recipient mice. Neither Y chromosome microdeletions of numerous genes nor tumor formation was observed in human line although there was abnormal karyotype in this cell line [30]. Although these studies have demonstrated the effects of miR-26b on inhibiting proliferation of various cancer cells, its effects on hUC-MSC were unknown. In this study, we found miR-26b-3p inhibits cell proliferation and miR-26b-3p could inversely regulate the mRNA and protein level of ESR1 through directly binding to CDS of ESR1.

ESR1 is transcript factors and mediate the growth effect of estrogen. E2 treatment stimulates proliferation in cultured bovine satellite cells (BSCs) through interaction with ESR1 as E2-stimulated BSC proliferation completely suppresses estrogen receptor (ER) blocker and E2 does not stimulate proliferation in BSC cultures once ESR1 expression has been silenced, which establish that ESR1 is required for E2 to stimulate proliferation of cultured BSCs [31,32]. Studies have identified the proliferation promotion of estrogen on MSC in rats and human [33 –35]. Estrogen stimulates MSC proliferation and ESR1 expression [36]. In this study, we also observed that E2 could stimulate hUC-MSC proliferation. Estrogen exerts its effects on cell growth and function via intracellular ERs and eventually by activating particular gene [37 –39], ESR1 could interact with special DNA sequence referred as estrogen-responsive elements located within the promoter of genes, thus regulating the expression of target genes [40], such as NRIP-1 [41]. We also detect signal molecule expression of ESR1 pathway, we found the level of CCND1 and NRIP1 decreased in 26b-3p^OE group and increased in 26b-3p^Inh group, which suggested that miR-26b-3p could change biology of ESR1. The association of CCND and CDKs can promote the progression of cell cycle by accelerating the transition of G1/S phase [42], thus promoting cell proliferation. In the study, we found that miR-26b-3p can regulate the expression of ESR1 and influence the level of CCND1 to inhibit the hUC-MSC proliferation.

In this study, we identified that miR-26b-3p regulate MSC proliferation through ESR1-CCND1 pathway. It suggests the inhibition of miR-26b-3p could be a potential, novel tool for increasing the growth of MSC and have benefits for clinical application of MSC. We also believe that there are other miRNAs or miRNA/mRNA pairs involved in MSC proliferation. More intensive studies are required to further illustrate the cellular and molecular mechanisms that regulate the proliferation of hUC-MSC.

Footnotes

Acknowledgments

This study was supported by the National Key Basic Research and Development Project (Beijing, China) (no. 2011CB965101), National Natural Science Foundation of China (no. 31371507), and the Foundation of Science and Technology Commission of Shanghai Municipality (no. 13JC1407101).

Author Disclosure Statement

No competing financial interests exist.

References

Wang

, Qu

and Zhao

. (2012). Clinical applications of mesenchymal stem cells. J Hematol Oncol, 5:19.

Mundra

, Gerling

and Mahato

. (2013). Mesenchymal stem cell-based therapy. Mol Pharm, 10:77–89.

Caplan

and Correa

. The MSC: an injury drugstore. Cell Stem Cell, 9:11–15.

Yim

, Lee

, Bow

, Meij

, Leung

, Cheung

, Vavken

and Samartzis

. (2014). A systematic review of the safety and efficacy of mesenchymal stem cells for disc degeneration: insights and future directions for regenerative therapeutics. Stem Cells Dev, 23:2553–2567.

EI Omar

, Beroud

, Stoltz

, Menu

, Velot

and Decot

. (2014). Umbilical cord mesenchymal stem cells: the new gold standard for mesenchymal stem cell-based therapies?. Tissue Eng Part B Rev, 20:523–544.

Ikebe

and Suzuki

. (2014). Mesenchymal stem cells for regenerative therapy: optimization of cell preparation protocols. Biomed Res Int, 2014:951512.

Bartel

. (2009). MicroRNAs: target recognition and regulatory functions. Cell, 136:215–233.

Friedman

, Farh

, Burge

and Bartel

. (2009). Most mammalian mRNAs are conserved targets of microRNAs. Genome Res, 19:92–105.

Clark

, Kalomoiris

, Nolta

and Fierro

. (2014). Concise review: MicroRNA function in multipotent mesenchymal stromal cells. Stem Cells, 32:1074–1082.

10.

Trompeter

, Dreesen

, Hermann

, Iwaniuk

, Hafner

, Renwick

, Tuschl

and Wernet

. (2013). MicroRNAs miR-26a, miR-26b, and miR-29b accelerate osteogenic differentiation of unrestricted somatic stem cells from human cord blood. BMC Genomics, 14:111.

11.

Zhao

, Jiang

, Liu

, Xiang

, Zhou

and Chen

. (2015). MiR-124 promotes bone marrow mesenchymal stem cells differentiation into neurogenic cells for accelerating recovery in the spinal cord injury. Tissue Cell, 47:140–146.

12.

Yang

, Guo

, Zhang

, Chen

, Ying

and Dong

. (2011). MicroRNA-145 regulates chondrogenic differentiation of mesenchymal stem cells by targeting Sox9. PLoS One, 6:e21679.

13.

Hamam

, Ali

, Vishnubalaji

, Hamam

, Al-Nbaheen

, Chen

, Kassem

, Aldahmash

and Alajez

. (2014). microRNA-320/RUNX2 axis regulates adipocytic differentiation of human mesenchymal (skeletal) stem cells. Cell Death Dis, 5:e1499.

14.

Duan

, Sun

, Li

, Huang

, Xu

, Han

, Xing

and Yan

. (2014). miR-29a modulates neuronal differentiation through targeting REST in mesenchymal stem cells. PLoS One, 9:e97684.

15.

Zhang

, Xie

, Gordon

, LeBlanc

, Stein

, Lian

, van Wijnen

and Stein

. (2012). Control of mesenchymal lineage progression by microRNAs targeting skeletal gene regulators Trps1 and Runx2. J Biol Chem, 287:21926–21935.

16.

Zhang

, Wang

and Lü

. (2014). An integrated study of natural hydroxyapatite-induced osteogenic differentiation of mesenchymal stem cells using transcriptomics, proteomics and microRNA analyses. Biomed Mater, 9:045005.

17.

Hamam

, Ali

, Kassem

, Aldahmash

and Alajez

. (2015). microRNAs as regulators of adipogenic differentiation of mesenchymal stem cells. Stem Cells Dev, 24:417–425.

18.

Lin

, Zhang

, Huang

, et al. (2015). MiR-26b/KPNA2 axis inhibits epithelial ovarian carcinoma proliferation and metastasis through downregulating OCT4. Oncotarget, 6:23793–23806.

19.

, Sun

, Han

, Yu

, Hu

and Hu

. (2015). MiR-26b inhibits hepatocellular carcinoma cell proliferation, migration, and invasion by targeting EphA2. Int J Clin Exp Pathol, 8:4782–4790.

20.

Sun

, Yan

, Chen

, Yang

, Xu

, Mao

and Qiu

. (2015). MicroRNA-26b inhibits cell proliferation and cytokine secretion in human RASF cells via the Wnt/GSK-3β/β-catenin pathway. Diagn Pathol, 10:72.

21.

, Li

, Kong

, Luo

, Zhang

and Fang

. (2014). MiRNA-26b inhibits cellular proliferation by targeting CDK8 in breast cancer. Int J Clin Exp Med, 7:558–565.

22.

, Ji

, Song

, Shi

, Shen

, Chen

, Yang

, Zhao

and Guo

. (2015). Obesity-associated microRNA-26b regulates the proliferation of human preadipocytes via arrest of the G1/S transition. Mol Med Rep, 12:3648–3654.

23.

Das

, Sundell

and Koka

. (2013). Adult mesenchymal stem cells and their potency in the cell-based therapy. J Stem Cells, 8:1–16.

24.

Rehman

. (2010). Empowering self-renewal and differentiation: the role of mitochondria in stem cells. J Mol Med (Berl), 88:981–986.

25.

Wagers

. (2012). The stem cell niche in regenerative medicine. Cell Stem Cell, 10:362–369.

26.

Tsai

, Su

, Huang

, Yew

and Hung

. (2012). Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells. Mol Cell, 47:169–182.

27.

Tome

, Lopez-Romero

, Albo

, Sepulveda

, Fernandez-Gutierrez

, Dopazo

, Bernad

and Gonzalez

. (2011). miR-335 orchestrates cell proliferation, migration and differentiation in human mesenchymal stem cells. Cell Death Differ, 18:985–995.

28.

Garofalo

, Di Leva

and Romano

. (2009). miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN andTIMP3 downregulation. Cancer Cell, 16:498–509.

29.

Damdimopoulou

, Rodin

, Stenfelt

, Antonsson

, Tryggvason

and Hovatta

. (2015). Human embryonic stem cells. Best Pract Res Clin Obstet Gynaecol. S1521–S6934.

30.

Hou

, Niu

, Liu

, et al. (2015). Establishment and characterization of human germline stem cell line with unlimited proliferation potentials and no tumor formation. Sci Rep, 5:16922.

31.

Kamanga-Sollo

, White

, Hathaway

, Chung

, Johnson

and Dayton

. (2008). Roles of IGF-I and the estrogen, androgen and IGF-I receptors in estradiol-17beta- and trenbolone acetate-stimulated proliferation of cultured bovine satellite cells. Domest Anim Endocrinol, 35:88–97.

32.

Kamanga-Sollo

, White

, Weber

and Dayton

. (2013). Role of estrogen receptor-α (ESR1) and the type 1 insulin-like growth factor receptor (IGFR1) in estradiol-stimulated proliferation of cultured bovine satellite cells. Domest Anim Endocrinol, 44:36–45.

33.

Hong

, Zhang

, Sultana

, Yu

and Wei

. (2011). The effects of 17-β estradiol on enhancing proliferation of human bone marrow mesenchymal stromal cells in vitro. Stem Cells Dev, 20:925–931.

34.

Holzer

, Einhorn

and Majeska

. (2002). Estrogen regulation of growth and alkaline phosphatase expression by cultured human bone marrow stromal cells. J Orthop Res, 20:281–288.

35.

DiSilvio

, Jameson

, Gamie

, Giannoudis

and Tsiridis

. (2006). In vitro evaluation of the direct effect of estradiol on human osteoblasts (HOB) and human mesenchymal stem cells (h-MSCs). Injury 37, (Suppl. 3)::S33–S42.

36.

Chen

, Hu

and Wang

. (2013). Estrogen modulates osteogenic activity and estrogen receptor mRNA in mesenchymal stem cells of women. Climacteric, 16:154–160.

37.

Glass

. (1994). Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev, 15:391–407.

38.

Beato

, Herrlich

and Schütz

. (1995). Steroid hormone receptors: many actors in search of a plot. Cell, 83:851–857.

39.

Rickard

, Subramaniam

and Spelsberg

. (1999). Molecular and cellular mechanisms of estrogen action on the skeleton. J Cell Biochem Suppl, 32–33:123–132.

40.

Gao

and Dahlman-Wright

. (2010). The gene regulatory networks controlled by estrogens. Mol Cell Endocrinol, 334:83–90.

41.

Carroll

, Liu

, Brodsky

, et al. (2005). Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell, 122:33–43.

42.

Lucas

, Lazari

and Porto

. (2014). Differential role of the estrogen receptors ESR1 and ESR2 on the regulation of proteins involved with proliferation and differentiation of Sertoli cells from 15-day-old rats. Mol Cell Endocrinol, 382:84–96.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.06 MB

0.02 MB