Priming Equine Bone Marrow-Derived Mesenchymal Stem Cells with Proinflammatory Cytokines: Implications in Immunomodulation–Immunogenicity Balance,Cell Viability,and Differentiation Potential

Abstract

Mesenchymal stem cells (MSCs) have a great potential for treating equine musculoskeletal injuries. Although their mechanisms of action are not completely known, their immunomodulatory properties appear to be key in their functions. The expression of immunoregulatory molecules by MSCs is regulated by proinflammatory cytokines; so inflammatory priming of MSCs might improve their therapeutic potential. However, inflammatory environment could also increase MSC immunogenicity and decrease MSC viability and differentiation capacity. The aim of this study was to assess the effect of cytokine priming on equine bone marrow-derived MSC (eBM-MSC) immunoregulation, immunogenicity, viability, and differentiation potential, to enhance MSC immunoregulatory properties, without impairing their immune-evasive status, viability, and plasticity. Equine BM-MSCs (n = 4) were exposed to 5 ng/mL of TNFα and IFNγ for 12 h (CK5-priming). Subsequently, expression of genes coding for immunomodulatory, immunogenic, and apoptosis-related molecules was analyzed by real-time quantitative polymerase chain reaction. Chromatin integrity and proliferation assays were assessed to evaluate cell viability. Trilineage differentiation was evaluated by specific staining and gene expression. Cells were reseeded in a basal medium for additional 7 days post-CK5 to elucidate if priming-induced changes were maintained along the time. CK5-priming led to an upregulation of immunoregulatory genes IDO, iNOS, IL-6, COX-2, and VCAM-1. MHC-II and CD40 were also upregulated, but no change in other costimulatory molecules was observed. These changes were not maintained 7 days after CK5-priming. Viability and differentiation potential were maintained after CK5-priming. These findings suggest that CK5-priming of eBM-MSCs could improve their in vivo effectiveness without affecting other eBM-MSC properties.

Introduction

Mesenchymal stem cells (MSCs) are a promising tool for treating musculoskeletal injuries in horses, but their mechanisms of action are not fully understood. Despite the low ability of MSCs for engrafting in tissues such as cartilage, these cells elicit therapeutic benefits. This effect has been attributed to the immunomodulatory and anti-inflammatory properties of MSCs, suggesting that these abilities are implied in their therapeutic role [1,2]. The MSC immunoregulatory mechanism is a multifactorial process involving both direct cell-to-cell contact and contact-independent paracrine signaling. The expression of several molecules implied in MSC immunomodulation is regulated by proinflammatory molecules, such as interferon γ (IFNγ) and tumor necrosis factor α (TNFα) [3]. Since MSC priming through exposure to an inflammatory environment may be needed for developing their full regulatory function, stimulating MSCs with proinflammatory cytokines in vitro, before their in vivo administration, is an interesting approach for improving their therapeutic potential [4]. Nevertheless, inflammatory exposure could also increase MSC immunogenicity [5], impair MSC differentiation capacity [6 –8], and diminish MSC viability [9]. Therefore, possible caveats must be considered for the use of primed MSCs, especially for their allogeneic implantation. Previous reports showed these effects on equine bone marrow-derived MSCs (eBM-MSCs) after inflammatory stimulation, which induced immunoregulation, but also upregulated MHC expression and impaired viability and plasticity [10,11]. Therefore, testing lower cytokine dose and shorter times of exposure for enhancing MSC immunoregulatory properties, without compromising immune-evasive status, viability, and plasticity, could increase MSC therapeutic efficacy.

The aim of this study was to assess the effects of cytokine priming on eBM-MSC immunoregulation, immunogenicity, viability, and differentiation potential, in search of a balance between stimulation of their immune-suppressive capacity without related induction of negative effects on other properties.

Materials and Methods

Animals

Four Shetland pony geldings (aged 4–7 years, weight 138–162 kg) were used as bone marrow (BM) donors. All horses were determined to be in good health. All procedures were carried out within the Project License 31/11 approved by the in-house Ethics Committee for Animal Experiments from the University of Zaragoza. The care and use of animals were performed accordingly with the Spanish Policy for Animal Protection RD53/2013, which meets the European Union Directive 2010/63.

Harvesting and characterization of eBM-MSCS

Twenty microliters of BM from sternum were obtained using a 4″ 11G Jamshidi needle in heparinized syringes. Equine BM-MSCs were isolated using a gradient density separation technique as previously described [12]. Cells were seeded in a culture medium consisting of low-glucose Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich) supplemented with 1% Glutamine (Sigma-Aldrich), 1% Streptomycin/Penicillin (Sigma-Aldrich), and 10% Fetal Bovine Serum (FBS; Sigma-Aldrich). Cells were expanded until passage three and characterized by phenotype determination and trilineage differentiation as previously described [12]. Subsequently, cells were frozen in 10% DMSO (Sigma-Aldrich)-90% FBS medium and cryopreserved until experiments started.

Priming of eBM-MSCs

Cryopreserved eBM-MSCs (n = 4) were thawed and seeded at 5,000 cells/cm² in the basal medium at 37°C and 5% CO₂ for 5 days, allowing readjustments of conditions before initiating the experiments. A preliminary assay was conducted to select the optimal time of exposure to cytokines (Supplementary Data and Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/scd) and eBM-MSCs were exposed for 12 h to 5 ng/mL of TNFα (R&D Systems) plus 5 ng/mL of IFNγ (R&D Systems), added to the basal culture medium described above (CK5-medium). The basal medium was used as negative control (Control medium). Both control and CK5 conditions were tested in triplicate. After the 12-h exposure, eBM-MSCs were detached with 0.25% trypsin-EDTA (Sigma-Aldrich) and used for subsequent assays. Part of the cells from both control and CK5 conditions were reseeded in the basal medium for additional 7 days to assess if priming-induced changes in CK5 cells were maintained in time over control cells by reanalyzing the genes that were significantly upregulated at 12 h.

Real-time quantitative polymerase chain reaction

Expression of genes related with immunoregulation, immunogenicity, apoptosis, and differentiation markers was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR). Total mRNA from approximately 10⁶ eBM-MSCs from each sample was isolated with the RNAspin Mini RNA Isolation Kit (GE Healthcare). Genomic DNA was removed with the kit DNAse Turbo (Ambion) and 1 μg of mRNA from each sample was retrotranscripted to cDNA by using the Superscript Reverse Trancriptase Kit (Life Technologies). Isolation of mRNA and cDNA retrotranscription were performed with the kit Cells-to-cDNA II (Ambion) in eBM-MSC samples from differentiation assays and 7-day postpriming assessment. All procedures were performed according to manufacturer's instructions.

RT-qPCRs were performed and monitored using a StepOne Real-Time PCR System device (Applied Biosystems). All reactions were carried out using Fast SYBR Green Master Mix (Applied Biosystems) and 2 μL of cDNA as template. Amplification was performed in triplicate following the protocol: 20 s at 95°C, followed by 40 cycles consisting of 3″ at 95°C and 30″ at 60°C. A dissociation curve protocol was run after every reaction. Levels of gene expression were obtained using the comparative Ct method. Normalization factor (NF) was calculated as the geometric mean of the quantity of two housekeeping genes, GAPDH and B2 M [12]. Primers were designed with the Primer Express 2.0 software based on known equine sequences. Information about primers is shown in Table 1.

Table 1.

Primers Used for Gene Expression by Real-Time Quantitative Polymerase Chain Reaction

Gene	Accession number	Primer sequence (5′–3′)	Amplicon size
Housekeeping
GAPDH	NM_001163856	F:GGCAAGTTCCATGGCACAGT	128
		R:CACAACATATTCAGCACCAGCAT
B2M	NM_001082502.2	F: TCGTCCTGCTCGGGCTACT	102
		R: ATTCTCTGCTGGGTGACGTGA
Immunomodulation-related molecules
IDO	XM_001490681	F: TCATGACTACGTGGACCCAAAA	104
		R: CGCCTTCATAGAGCAGACCTTC
iNOS	AY027883	F: CCAACAATGGCAACATCAGGT	85
		R: TGAGCATTCCAGATCCGGA
IL-6	EU438770	F: AACAGCAAGGAGGTACTGGCA	95
		R: CAGGTCTCCTGATTGAACCCA
COX-2	AB041771	F: GTTTGCATTTTTTGCCCAGC	103
		R: ACTTAAATCCACCCCGTGACC
IL-10	EU438771	F: GACATCAAGGAGCACGTGAACT	140
		R: TGGAGCTTACTGAAGGCACTCT
TGFβ-1	AF175709	F: GTCCTTTGATGTCACCGGAGT	137
		R: TGGAACTGAACCCGTT
VCAM-1 (CD106)	DQ246452	F: TCTATGCTACGCTCTGGCTACG	127
		R: TTGATGGTCTCCCCGATGA
CXCR4	XM_001490165	F: TGCAGCAGCAGGTAGCAAAGT	97
		R: ATATACGGAACCCGTCCATGG
Antigen-presenting-related molecules
MHC-I	AB525081	F: CGTGAGCATCATTGTTGGC	92
		R: TCCCTCTTTTTTCACCTGAGG
MHC-II	NM_001142816	F: AGCGGCGAGTTGAACCTACAGT	172
		R: CGGATCAGACCTGTGGAGATGA
CD40	AY514017	F: ACAAATACTGCGACCCCAACC	114
		R: TTTCACAGGCATCGCTGGA
CD80	Krampera 2006	F: CAGGAAAGTTGGCTCTGACCA	135
		R: TCTCCATTGTGATCCTGGCTC
CD86	De Schauwer 2014	F: AGTATAAAGGCCGCACAAGC	247
		R: CCTTGGGTAGATGAGCAGGT
CD40L	XM_001490011	F: AGTTCGAAGGCTTCGTCAAGG	101
		R: CGCAATTTGAGGCTCCTGAT
Molecules implied in apoptosis
BAX	XM_005596728.1	F: AGTGTCTCAAGCGCATCGG	104
		R: CACTCGGAAAAAGACCTCGC
BCL-2	Ryhner, 2008	F: GCCTATCTGGGCCACAAGT	200
		R:TTTCCCTTTGGCAGTAAATAGC
Osteogenic markers
ALP	XM_001504312	F: GATGGCCTGAACCTCATCGA	92
		R: AGTTCGGTCCGGTTCCAGAT
RUNX2	XM_001502519.3	F: CTCCAACCCACGAATGCACTA	80
		R: CGGACATACCGAGGGACATG
Adipogenic markers
LPL	XM_001489577	F:TGTATGAGAGTTGGGTGCCAAA	70
		R:GCCAGTCCACCACAATGACAT
PPARγ	XM_001492411	F:TGCAAGGGTTTCTTCCGGA	104
		R:GCAAGGCATTTCTGAAACCG
Chondrogenic markers
ACAN	AF019756	F: CTACGACGCCATCTGCTACA	96
		R: ACCGTCTGGATGGTGATGTC
COL2A1	XM_005611082.1	F: TTAGACGCCATGAAGGTTTTCTG	101
		R: CTCTTGCTGCTCCACCAGTTCT

GenBank accession numbers of the sequences used for primers design. Primers (F: forward and R: reverse) and length of the amplicon in base pair (bp). Genes were grouped in agreement with the functions and implications of encoded molecules.

Proliferation

Proliferation after CK5-priming was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (Sigma-Aldrich) for 6 days as previously described [13]. Triplicates of each sample were seeded in the basal medium at 5,000 cells/cm² in 96-well plates. The basal medium was used as a blank. Biotek Synergy HT spectrophotometer was used to measure the optical density (570 nm) in each well.

Viable cell numbers were determined by extrapolating from a standard curve consisting of nine triplicated points of increasing quantity of cells (0–15,000 cells/cm²) as previously reported [13]. Calibration curve equation for cell number extrapolation was y = 1 × 10⁻⁵ × −0.0349, r ² = 0.997 (y = optical density of the well; x = amount of cells). Cell doubling times (DT) were calculated according to the formulae: CD = ln [(Nf/Ni)/ln2] and DT = CT/CD, where DT = cell doubling time; Nf = final number of cells; Ni = initial number of cells; and CD = cell doubling number.

Assessment of chromatin integrity

Chromatin integrity was evaluated by the chromatin dispersion test making use of the D3-Max Kit (Halotech DNA). This methodology was designed to assess DNA damage in MSCs through minor modification of the previously described technique for somatic cumulus cells [14] to MSCs. DNA damage was visualized using a Proyser fluorescent microscope (Proyser) employing SyberGreen II fluorochrome (Biotium) at 40× magnification. Cells showing a large halo of chromatin dispersion were considered to contain highly fragmented DNA (Supplementary Fig. S2). The percentages of normal cells and eBM-MSCs with fragmented DNA were determined in each sample by fluorescence microscope count by two independent observers. Equine BM-MSCs from one control were treated with hydrogen peroxide to perform a positive control of DNA damage through exposition to oxidative stress.

Trilineage differentiation assay

Equine BM-MSCs from both control and CK5 samples were exposed to the induction medium (differentiation) and basal medium (negative control) in triplicates according to each differentiation assay.

Osteogenic differentiation

Equine BM-MSCs were seeded at 20,000 cells/cm² density in 24-well plates. The osteogenic medium consisted of 10 nM dexamethasone (Sigma-Aldrich), 10 mM β-glycerophosphate (Sigma-Aldrich), and 100 μM ascorbate-2-phosphate-supplemented (Sigma-Aldrich) basal medium. After 7 days, differentiation was assessed by Alizarin Red staining. Cells were fixed with 70% ethanol for 1 h at room temperature (RT), stained with 2% Alizarin Red stain (pH 4.6) (Sigma-Aldrich) for 10 min (RT), and washed with PBS (Gibco Invitrogen Corporation).

Adipogenic differentiation

Equine BM-MSCs were seeded at 5,000 cells/cm² density in 12-well plates. The adipogenic medium consisted of 1 μM dexamethasone (Sigma-Aldrich), 500 μM 3-isobutyl-1-methylxanthine (Sigma-Aldrich), 200 μM indomethacin (Sigma-Aldrich), and 15% rabbit serum-supplemented (Sigma-Aldrich) basal medium. After 15 days, differentiation was evaluated by Oil Red O staining. The cells were fixed with 10% formalin (Sigma-Aldrich) for 15 min at RT, stained with 0.3% Oil Red O (Sigma-Aldrich) stain (dissolved in 60:40; isopropanol:distilled water) for 30 min at 37°C, and washed with distilled water.

Chondrogenic differentiation

For chondrogenic differentiation assay, both control and CK5-eBM-MSCs were exposed to a chondrogenic induction medium, but due to the number of available cells, culture in the basal medium was not carried out. Approximately, 300,000 eBM-MSCs from each sample were transferred to conic bottom 15 mL tube and 400 μL of chondrogenic differentiation medium was added and centrifuged at 1,750 rpm for 5 min to pellet the cells. The chondrogenic medium consisted of 10% FBS, 10 ng/mL TGFβ-3 (R&D Systems), ITS+ premix (Beckton Dickinson), 40 μg/mL proline (Sigma-Aldrich), 50 μg/mL ascorbate-2-phosphate (Sigma-Aldrich), and 0.1 μM dexamethasone-supplemented (Sigma-Aldrich) high-glucose DMEM (Sigma-Aldrich).

After 21 days, chondrogenic differentiation was evaluated by specific staining with Alcian Blue stain. Pellets were fixed in 10% formalin, embedded in paraffin, and sectioned into 5-μm sections. The sections were hydrated with increasing gradients of alcohols, stained with Mayer's hematoxylin and 3% Alcian Blue dyes, rinsed with distilled water, dehydrated with decreasing amounts of alcohol, and mounted.

Statistical analysis

Statistical analysis was performed using the SPSS 15.0 (SPSS, Inc.). Normality of each data group was tested with the Shapiro–Wilk test. Differences in mean cell numbers between control and CK5 eBM-MSCs along the proliferation assay were analyzed by the nonparametric ANOVA Kruskall–Wallis test with Dunn's post hoc test. Kruskall–Wallis test was also used to analyze differences between control-nondifferentiated, control-differentiated, CK5-nondifferentiated, and CK5-differentiated eBM-MSCs from trilineage differentiation assays. Differences in gene expression between CK5-eBM-MSCs and their controls were analyzed by Mann–Whitney test. Differences in percentages of normal (nonfragmented DNA) and DNA-damaged cells were analyzed between control and CK5-exposed cells by student's t test. Significance level was set at P < 0.05 for all analyses.

Results

Equine BM-MSC immunomodulation after cytokine priming

Cytokine priming induced significant upregulation of the immunoregulatory-related genes Vascular Cell Adhesion Molecule 1 (VCAM-1), Indoleamine 2,3-dioxygenase (IDO), Inducible Nitric Oxide Synthase (iNOS) (P < 0.01), and Interleukin 6 (IL-6) (P < 0.05) by eBM-MSCs. In addition, nonsignificant upregulation of Cyclooxygenase 2 (COX-2) and significant downregulation of Interleukin 10 (IL-10) (P < 0.05) were observed (Fig. 1A). Expression of significantly upregulated genes was evaluated 7 days after CK5-priming and IL-6, IDO, iNOS, and COX-2 expression remained similar to unstimulated control and VCAM expression significantly decreased (P < 0.05) (Fig. 2).

FIG. 1.

Gene expression data are reported as mean (n = 4) fold increase or decrease of CK5-stimulated eBM-MSC gene expression over unstimulated control eBM-MSC. (A) Immunomodulatory related molecule expression after 12 h of CK5 priming; (B) immunogenic related molecule expression after 12 h of CK5-priming. (* = P < 0.05; ** = P < 0.01). eBM-MSCs, equine bone marrow-derived mesenchymal stem cells.

FIG. 2.

Immunomodulatory and immunogenic related molecule expression 7 days after CK5-priming. Gene expression data are reported as mean (n = 4) fold increase or decrease of CK5-stimulated eBM-MSC gene expression over unstimulated control eBM-MSCs. (* = P < 0.05).

Equine BM-MSC immunogenicity after cytokine priming

Cytokine priming induced a significant increase in the expression of MHC-II (P < 0.05) and the costimulatory molecule CD40 (P < 0.01) by eBM-MSCs. MHC-I was upregulated in a nonsignificant manner and the expression level of costimulatory molecules CD80, CD86, and CD40L remained unchanged (Fig. 1B). Seven days after the 12-h cytokine priming, the expression level of most relevant immunogenic molecules was assessed and MHC-I and MHC-II expression decreased, reaching similar values than in control cells (Fig. 2).

Equine BM-MSC viability after cytokine priming

Proliferation assay

Proliferation data are presented in Fig. 3A. CK-exposed cells grew in a similar manner to control cells: significant differences in the number of cells were not observed between control and CK5-exposed cells and cell DT was similar between control cells (3.071 ± 1.316 days) and CK5-stimulated eBM-MSCs (3.280 ± 1.307 days).

FIG. 3.

Data from viability assays. (A) Proliferation data are presented as mean (n = 4) ± SEM cell count of CK5-stimulated and CK5-unstimulated control eBM-MSCs at each time point. (B) Gene expression of apoptosis-related genes BAX and BCL-2 in control and CK5-exposed eBM-MSCs. Data are reported as mean (n = 4) fold increase or decrease of CK5-stimulated eBM-MSC gene expression over unstimulated control eBM-MSCs. (C) Chromatin integrity assessment data are presented as percentage of normal (nonfragmented DNA) and DNA-damaged eBM-MSCs for both control and CK5-stimulated samples.

Apoptosis gene expression

Proapoptotic gene BCL2-Associated X Protein (BAX) was downregulated in CK5-eBM-MSCs compared to control cells (P < 0.005), whereas there were no significant differences between control and stimulated cells for the antiapoptotic gene BCL-2 (Fig. 3B).

Chromatin integrity

Percentage of normal cells (nonfragmented chromatin) and DNA-damaged cells (dispersed chromatin fragments) did not show significant differences between control and CK5-eBM-MSC samples (Fig. 3C).

Equine BM-MSC differentiation after cytokine priming

Osteogenic, adipogenic, and chondrogenic differentiation were achieved in control cells from all animals. Spontaneous differentiation was not observed in any of the nondifferentiated controls (Fig. 4A, B).

FIG. 4.

Staining for osteogenic, adipogenic, and chondrogenic differentiation of control and CK5-stimulated eBM-MSCs. Control (A) and CK5-stimulated (B) undifferentiated cells (magnification 4 × ); Alizarin Red staining of eBM-MSCs differentiated into osteoblasts, control (C), and CK5 exposed (D); Oil Red O staining of eBM-MSCs differentiated into adipocytes, control (E), and CK5 exposed (F) (magnification 10 × ); Alcian Blue staining of pellets from eBM-MSCs undergoing chondrogenic differentiation, control (G), and CK5 exposed (H) (magnification 20 × ).

Osteogenic differentiation

Osteogenic differentiation was confirmed in both control and CK5-exposed eBM-MSCs by positive staining of the calcium deposits with Alizarin Red (Fig. 4C, D). Alkaline phosphatase (ALP) and Runt-related transcription factor 2 (RUNX2) gene expression was significantly higher (P < 0.05) in both control and CK5-differentiated samples over their corresponding nondifferentiated cells. In addition, expression of RUNX2 was significantly higher (P < 0.05) in differentiated control eBM-MSCs over differentiated CK5-exposed cells (Fig. 5A1–2)

FIG. 5.

Gene expression results of trilineage differentiation assay. Results from osteogenesis (A.1–2) and adipogenesis (B.1–2) are expressed as mean ± SEM (n = 4) fold increase or decrease of differentiated control eBM-MSCs (CTRL.DIF), nondifferentiated CK5-exposed eBM-MSCs (CK5.NON-DIF), and differentiated CK5-exposed eBM-MSCs (CK5.DIF) over control nondifferentiated cells (CTRL.NON-DIF). Results from chondrogenic assay (C) are presented as mean ± SEM (n = 4) mRNA relative expression of CTRL.DIF and CK5.DIF eBM-MSCs. (* = P < 0.05; N.E = no expression).

Adipogenic differentiation

Lipid droplets were detected in both control and CK5-exposed eBM-MSCs under adipogenic induction by Oil red O staining (Fig. 4E, F). Lipoprotein lipase (LPL) mRNA level was significantly higher only in differentiated CK5-eBM-MSCs over correspondent nondifferentiated cells (P < 0.05) (Fig. 5B1).

Chondrogenic differentiation

Chondrogenic phenotype was achieved by both control and CK5-exposed cells, detected by positive blue staining of the extracellular matrix by Alcian Blue staining and lacunae formation (Fig. 4G, H). Both aggrecan (ACAN) and collagen type II alpha I (COL2A1) showed similar level of mRNA relative expression in both differentiated control and CK5-eBM-MSCs (Fig. 5C).

Discussion

TNFα and IFNγ synergistically induce eBM-MSC immunoregulatory abilities [10], but certain cytokine concentrations and time of exposure also produce a decrease in their proliferation and differentiation abilities [11]. Therefore, eBM-MSC stimulation with a lower cytokine dose and a shorter time of exposure was tested to reach immunoregulatory induction without impairing viability and plasticity or increasing immunogenicity. Concentration of cytokines was chosen from a previous report in other species [3] and the time of exposure was set according to a preliminary assay.

Both cell–cell contact and paracrine signaling mechanisms are implied in the immunoregulatory functions of MSCs [2]. The adhesion molecule VCAM-1 participates in immunosuppression exerted by MSCs [15] and it was upregulated by CK5 priming, supporting the participation of direct cell-contact pathways in the eBM-MSC immunoregulatory mechanisms. Adhesion molecules are also related to MSC recruitment and migration, and these processes are particularly complex in inflammatory environments, showing both enhancement [16] and impairment of this ability [17]. The chemokine receptor CXCR4 participates in MSC migration in other species [18], but this is not evident in equine MSCs according to our findings and previous reports [10].

Paracrine signaling immunomodulation mechanism is mainly governed by molecules such as IDO, iNOS, IL-6, and COX-2, eliciting different mechanisms on immune cells [2], and TNFα and IFNγ are reported as inductors of these molecules by MSCs from different species and sources [19,20]. CK5-priming of eBM-MSCs led to a significant increase in the expression of immunomodulatory-related genes, similar to previous reports in equine species using higher cytokine concentrations [10]. IL-10 and TGF-β1 could also participate in MSC immune mechanisms [2,21], but other reports have shown that inflammatory exposure could elicit different effects on these molecules, ranging from increases in their production [22], no change of their expression/secretion [23], or even a significant reduction [24]. CK5-priming did not alter TGF-β1, but downregulated IL-10 expression, similar to previous findings in eBM-MSCs stimulated with higher cytokine doses [10].

Since immunoregulatory mechanisms can vary between different species and MSC sources [20], a variety of factors could participate in the MSC immunosuppression mechanisms. Our findings suggest that IL-10 and TGF-β1 may not have a major role in eBM-MSC immunoregulation, whereas IDO, iNOS, IL-6, or COX-2 would be mainly involved. Changes induced in eBM-MSC immunoregulatory-related gene expression by CK5-priming confirmed that a lower dose and a shorter time of exposure to proinflammatory cytokines can induce a similar enhancement in the eBM-MSC immunomodulatory profile to that described using higher cytokine concentrations and longer exposure [10].

Inflammatory environments could also produce a rise in MSC immunogenicity, with adverse safety and efficacy implications for their allogeneic use. Allogeneic MSC therapy is especially interesting when cell therapy is needed immediately or there are handicaps for autologous MSC use, such as aged and/or diseased patients [25,26].

Therefore, preservation of low immunogenicity after inflammatory stimulation is important to allow safe MSC allogeneic transplantation. Inflammatory stimuli, particularly IFNγ, might induce MHC expression [5,27]. CK5-priming induced a significant increase of MHC-II expression in eBM-MSCs, as it was observed with higher doses and longer exposure [10]. Even so, IFNγ-induced MHC upregulation may not lead to an increase in immunogenicity because of the lack of costimulatory molecules CD40, CD40L, CD80, and CD86 MSC expression, needed for antigenic recognition [28,29]. Nevertheless, inflammatory conditions might upregulate CD40 expression in human MSCs without affecting the expression of CD80, CD86, and CD40L [27,30]. In a similar manner, CD40 significant upregulation was detected after CK5-priming. However, absence of changes on costimulatory molecules CD80, CD86, and CD40L expression, combined with the upregulation of immunoregulatory molecules, suggests that eBM-MSCs might conserve their immune-evasive status after inflammatory priming [31].

Immunoregulatory functions of MSCs might be improved by proinflammatory cytokine priming, but how long these changes are maintained for after the stimulation remains unknown. Our results showed that the overexpression of VCAM-I, IL-6, iNOS, and COX-2 achieved by CK5-priming was not maintained after 7 days. In the same way, MHC-II upregulation did not remain after 7 days. These facts suggest that changes induced by cytokine priming might be short-term events, which may not remain for long after the in vivo implantation.

Furthermore, TNFα and IFNγ may synergistically induce apoptosis in murine MSCs [8]. However, there are conflicting reports showing that these cytokines can also promote human and murine MSC proliferation [24,32]. CK5-priming did not alter the regular growth of eBM-MSCs and relevant changes in the expression of genes involved in apoptosis [33] or chromatin integrity [34] were not induced. These findings suggest that CK5-priming is well tolerated and does not hamper eBM-MSC viability.

Impairment of MSC differentiation ability by inflammatory environment has been well documented [6]. TNFα inhibits RUNX2 expression in human and rat [7,35] and IFNγ might prevent MSC osteogenesis in vivo in allogeneic implants in mice [36]. High level of TNFα leads to a reduction in PPARγ expression by rat MSCs undergoing adipogenesis [37] and might also impair the chondrogenesis of murine and rat MSCs [6]. Possible mechanisms participating in the differentiation inhibition by inflammatory environment have been described in human MSCs [38], but on the other hand, TNFα might have osteogenic promotive effects. Indeed, TNFα enhanced human MSC osteogenic differentiation as measured by increases in the ALP activity and matrix mineralization [7], increasing Osteocalcin [39], RUNX2, Osterix, and bone morphogenetic protein 2 (BMP-2) expression [32].

In eBM-MSCs, adverse effects of TNFα and IFNγ exposure on trilineage differentiation have been reported when using higher cytokine doses and exposure time [11]. Nevertheless, eBM-MSCs were able to differentiate into the three lineages after CK5-priming. Previous studies describing differentiation impairment generally used cytokine concentrations similar to those used in this study, but these were added to the culture medium along the differentiation induction [6,7,35], whereas we pretreated cells and induced differentiation without adding these cytokines. Other studies using cytokine pretreatment and subsequent regular differentiation induction also reported negative effects, but these studies used higher amounts of cytokines for priming MSCs [11,40].

In summary, the effect of proinflammatory cytokines on MSC differentiation is considered detrimental, but under certain conditions, they can promote an enhancing effect. Our results suggest that a short cytokine exposure with low doses is well tolerated by eBM-MSCs, without abolishing their differentiation mechanisms or allowing its recovery after CK5-priming.

In conclusion, priming eBM-MSCs with 5 ng/mL of TNFα and IFNγ for 12 h showed an upregulation of immunoregulatory-related genes without a significant increase of most of the immunogenic ones and without eBM-MSC viability and plasticity impairment. Since the inflammatory environment in a naturally occurring disease, like in equine joint injury, could be heterogeneous and may not consistently induce changes in the immunoregulatory MSC profile [10], eBM-MSC CK5-priming enables this induction.

The stimulation with TNFα and IFNγ of MSC populations with initially different immunosuppressive capacity increases regulatory ability to a similar level, leading to homogenous MSC immunosuppressive capacity between different cell populations [41]. Consequently, prior ex vivo priming of eBM-MSCs could improve the effectiveness of cellular therapy. In addition, immunogenicity, viability, and plasticity of eBM-MSCs after cytokine priming must be considered. Viability and differentiation abilities of eBM-MSCs were preserved after CK5-priming. Furthermore, the possible effect of upregulated MHC-II might be attenuated by the lack of costimulatory molecules and by the enhancement in the immunomodulatory expression profile by eBM-MSCs. This work contributes to clarify the effects of inflammatory exposure on eBM-MSCs and constitutes a previous step to enhance their therapeutic use. Further studies will be needed to clarify the effect of cytokine priming on the safety and efficacy of eBM-MSCs.

Footnotes

Acknowledgments

We acknowledge the Veterinary Hospital of the University of Zaragoza for allowing the use of its facilities for sample collection. Authors thank Dr. J.A. Castillo for facilitating access to fluorescence microscope for chromatin integrity assessment.

Author Disclosure Statement

None of the authors have any financial or personal relationships that could inappropriately influence or bias the content of article.

References

Lopez

and Jarazo

. (2015). State of the art: stem cells in equine regenerative medicine. Equine Vet J, 47:145–154.

, Xie

, Li

, Yuan

, Shi

and Wang

. (2014). Immunobiology of mesenchymal stem cells. Cell Death Differ, 21:216–225.

Zimmermann

and McDevitt

. (2014). Pre-conditioning mesenchymal stromal cell spheroids for immunomodulatory paracrine factor secretion. Cytotherapy, 16:331–345.

Cuerquis

, Romieu-Mourez

, Francois

, Routy

, Young

, Zhao

and Eliopoulos

. (2014). Human mesenchymal stromal cells transiently increase cytokine production by activated T cells before suppressing T-cell proliferation: effect of interferon-gamma and tumor necrosis factor-alpha stimulation. Cytotherapy, 16:191–202.

Chan

, Lau

, Li

, Law

, Lau

and Chan

. (2008). MHC expression kinetics and immunogenicity of mesenchymal stromal cells after short-term IFN-gamma challenge. Exp Hematol, 36:1545–1555.

Lacey

, Simmons

, Graves

and Hamilton

. (2009). Proinflammatory cytokines inhibit osteogenic differentiation from stem cells: implications for bone repair during inflammation. Osteoarthritis Cartilage, 17:735–742.

Ding

, Ghali

, Lencel

, Broux

, Chauveau

, Devedjian

, Hardouin

and Magne

. (2009). TNF-alpha and IL-1beta inhibit RUNX2 and collagen expression but increase alkaline phosphatase activity and mineralization in human mesenchymal stem cells. Life Sci, 84:499–504.

Liu

, Wang

, Kikuiri

, Akiyama

, Chen

, Xu

, Yang

, Chen

, Wang

and Shi

. (2011). Mesenchymal stem cell-based tissue regeneration is governed by recipient T lymphocytes via IFN-gamma and TNF-alpha. Nat Med, 17:1594–1601.

Wang

, Zhao

, Liu

, Akiyama

, Chen

, Qu

, Jin

and Shi

. (2013). IFN-gamma and TNF-alpha synergistically induce mesenchymal stem cell impairment and tumorigenesis via NFkappaB signaling. Stem Cells, 31:1383–1395.

10.

Barrachina

, Remacha

, Romero

, Vazquez

, Albareda

, Prades

, Ranera

, Zaragoza

, Martin-Burriel

and Rodellar

. (2016). Effect of inflammatory environment on equine bone marrow derived mesenchymal stem cells immunogenicity and immunomodulatory properties. Vet Immunol Immunopathol, 171:57–65.

11.

Barrachina

, Remacha

, Romero

, Vazquez

, Albareda

, Prades

, Ranera

, Zaragoza

, Martin-Burriel

and Rodellar

. (2016). Inflammation affects the viability and plasticity of equine mesenchymal stem cells: possible implication in intra-articular treatments. J Vet Sci [Epub ahead of print].

12.

Ranera

, Lyahyai

, Romero

, Vazquez

, Remacha

, Bernal

, Zaragoza

, Rodellar

and Martin-Burriel

. (2011). Immunophenotype and gene expression profiles of cell surface markers of mesenchymal stem cells derived from equine bone marrow and adipose tissue. Vet Immunol Immunopathol, 144:147–154.

13.

Ranera

, Ordovas

, Lyahyai

, Bernal

, Fernandes

, Remacha

, Romero

, Vazquez

, Osta

, et al. (2012). Comparative study of equine bone marrow and adipose tissue-derived mesenchymal stromal cells. Equine Vet J, 44:33–42.

14.

Barcena

, Lopez-Fernandez

, Garcia-Ochoa

, Obradors

, Vernaeve

, Gosalvez

and Vassena

. (2015). Detection of DNA damage in cumulus cells using a chromatin dispersion assay. Syst Biol Reprod Med, 61:277–285.

15.

Ren

, Zhao

, Zhang

, L'Huillier

, Ling

, Roberts

, Le

, Shi

, Shao

and Shi

. (2010). Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression. J Immunol, 184:2321–2328.

16.

Shi

, Li

, Liao

, Chen

, Li

, Chen

, Jia

and Zhao

. (2007). Regulation of CXCR4 expression in human mesenchymal stem cells by cytokine treatment: role in homing efficiency in NOD/SCID mice. Haematologica, 92:897–904.

17.

Waterman

, Tomchuck

, Henkle

and Betancourt

. (2010). A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an immunosuppressive MSC2 phenotype. PLoS One, 5:e10088.

18.

Honczarenko

, Le

, Swierkowski

, Ghiran

, Glodek

and Silberstein

. (2006). Human bone marrow stromal cells express a distinct set of biologically functional chemokine receptors. Stem Cells, 24:1030–1041.

19.

Meisel

, Zibert

, Laryea

, Gobel

, Daubener

and Dilloo

. (2004). Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenase-mediated tryptophan degradation. Blood, 103:4619–4621.

20.

Carrade

and Borjesson

. (2013). Immunomodulation by mesenchymal stem cells in veterinary species. Comp Med, 63:207–217.

21.

Aggarwal

and Pittenger

. (2005). Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood, 105:1815–1822.

22.

Liu

, Kemeny

, Heng

, Ouyang

, Melendez

and Cao

. (2006). The immunogenicity and immunomodulatory function of osteogenic cells differentiated from mesenchymal stem cells. J Immunol, 176:2864–2871.

23.

Carrade

, Lame

, Kent

, Clark

, Walker

and Borjesson

. (2012). Comparative analysis of the immunomodulatory properties of equine adult-derived mesenchymal stem cells. Cell Med, 4:1–11.

24.

Mohammadpour

, Pourfathollah

, Nikougoftar Zarif

and Hashemi

. (2016). Increasing proliferation of murine adipose tissue-derived mesenchymal stem cells by TNF-alpha plus IFN-gamma. Immunopharmacol Immunotoxicol, 38:68–76.

25.

Chen

and Tuan

. (2008). Mesenchymal stem cells in arthritic diseases. Arthritis Res Ther, 10:223.

26.

Lin

, Gibon

, Loi

, Pajarinen

, Cordova

, Nabeshima

, Lu

, Yao

and Goodman

. (2016). Decreased osteogenesis in mesenchymal stem cells derived from the aged mouse is associated with enhanced NF-kappaB activity. J Orthop Res; [Epub ahead of print]; DOI: 10.1002/jor.23270.

27.

Najar

, Raicevic

, Fayyad-Kazan

, De Bruyn

, Bron

, Toungouz

and Lagneaux

. (2012). Immune-related antigens, surface molecules and regulatory factors in human-derived mesenchymal stromal cells: the expression and impact of inflammatory priming. Stem Cell Rev, 8:1188–1198.

28.

Tse

, Pendleton

, Beyer

, Egalka

and Guinan

. (2003). Suppression of allogeneic T-cell proliferation by human marrow stromal cells: implications in transplantation. Transplantation, 75:389–397.

29.

Wang

, Qiu

, Ni

, Qiu

, Lin

, Wu

, Xie

, Lin

, Min

, et al. (2014). Immunological characteristics of human umbilical cord mesenchymal stem cells and the therapeutic effects of their transplantion on hyperglycemia in diabetic rats. Int J Mol Med, 33:263–270.

30.

Raicevic

, Najar

, Najimi

, El Taghdouini

, van Grunsven

, Sokal

and Toungouz

. (2015). Influence of inflammation on the immunological profile of adult-derived human liver mesenchymal stromal cells and stellate cells. Cytotherapy, 17:174–185.

31.

Ankrum

, Ong

and Karp

. (2014). Mesenchymal stem cells: immune evasive, not immune privileged. Nat Biotechnol, 32:252–260.

32.

Yang

and Dai

. (2015). Expression of PADI4 in patients with ankylosing spondylitis and its role in mediating the effects of TNF-alpha on the proliferation and osteogenic differentiation of human mesenchymal stem cells. Int J Mol Med, 36:565–570.

33.

Hotchkiss

, Strasser

, McDunn

and Swanson

. (2009). Cell death. N Engl J Med, 361:1570–1583.

34.

Wang

. (2001). DNA damage and apoptosis. Cell Death Differ, 8:1047–1048.

35.

Gilbert

, He

, Farmer

, Rubin

, Drissi

, van Wijnen

, Lian

, Stein

and Nanes

. (2002). Expression of the osteoblast differentiation factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) is inhibited by tumor necrosis factor-alpha. J Biol Chem, 277:2695–2701.

36.

Dighe

, Yang

, Madhu

, Balian

and Cui

. (2013). Interferon gamma and T cells inhibit osteogenesis induced by allogeneic mesenchymal stromal cells. J Orthop Res, 31:227–234.

37.

Cortez

, Carmo

, Rogero

, Borelli

and Fock

. (2013). A high-fat diet increases IL-1, IL-6, and TNF-alpha production by increasing NF-kappaB and attenuating PPAR-gamma expression in bone marrow mesenchymal stem cells. Inflammation, 36:379–386.

38.

Wang

, Zhou

, Wu

, Liu

, Yin

, Pan

and Yu

. (2016). TNF-alpha-induced NF-kappaB activation upregulates microRNA-150-3p and inhibits osteogenesis of mesenchymal stem cells by targeting beta-catenin. Open Biol, 6:150258.

39.

Marupanthorn

, Tantrawatpan

, Tantikanlayaporn

, Kheolamai

and Manochantr

. (2015). The effects of TNF-alpha on osteogenic differentiation of umbilical cord derived mesenchymal stem cells. J Med Assoc Thai, 98 Suppl 3:S34–S40.

40.

Liu

, Wang

, Hendricks

, Lee

, Bohnlein

, Junker

and Mosca

. (2013). Comparison of drug and cell-based delivery: engineered adult mesenchymal stem cells expressing soluble tumor necrosis factor receptor II prevent arthritis in mouse and rat animal models. Stem Cells Transl Med, 2:362–375.

41.

Szabo

, Fajka-Boja

, Kriston-Pal

, Hornung

, Makra

, Kudlik

, Uher

, Katona

, Monostori

and Czibula

. (2015). Licensing by inflammatory cytokines abolishes heterogeneity of immunosuppressive function of mesenchymal stem cell population. Stem Cells Dev, 24:2171–2180.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.19 MB