The State of Skewed X Chromosome Inactivation is Retained in the Induced Pluripotent Stem Cells from a Female with Hemophilia B

Abstract

Skewed X chromosome inactivation (XCI) is a rare reason for hemophilia B in females. It is indefinite whether X chromosome reactivation (XCR) would occur when cells of hemophilia B patients with skewed XCI were reprogrammed into induced pluripotent stem cells (iPSCs). In this study, we investigated a female hemophilia B patient with a known F9 gene mutation: c.676C>T, p.Arg226Trp. We demonstrated that skewed XCI was the pathogenesis of the patient, and we successfully generated numerous iPSC colonies of the patient from peripheral blood mononuclear cells (PBMNCs), which was the first time for generating hemophilia-specific iPSCs from PBMNCs. Then we detected the XCI state of these iPSCs. Ninety-two iPSC lines were picked for XCI analysis. All of them retained an inactive X chromosome, which could be proved by amplification of the androgen receptor gene and XIST (X inactivation-specific transcript), expression of H3K27me3, and existence of XIST clouds in XIST RNA fluorescence in situ hybridization (FISH) analysis. We attempted to obtain iPSC lines with the wild-type F9 gene on the active X chromosome for further disease treatment. But it turned out that the patient's iPSCs were still skewed such as the somatic cells with 92 iPSC lines having mutant F9 on the active X chromosome. In conclusion, skewed XCI is one reason for hemophilia in females. PBMNCs are excellent somatic cell resources for hemophilia patients to do reprogramming. More attentions should be paid to generate naive iPSCs with two active X chromosomes for further clinical disease treatment. The state of skewed XCI is retained in the iPSCs from a female with hemophilia B.

Introduction

Usually, successfully reprogrammed murine-induced pluripotent stem cells (iPSCs) undergo X chromosome reactivation (XCR) and have two activated X chromosomes, and random X chromosome inactivation (XCI) occurs during subsequent in vitro differentiation [1]. However, the situation in human iPSCs is more complicated. Different results have been obtained from different laboratories. Several studies indicated that human iPSCs occurred without XCR after reprogramming, and all cells in each iPSC colony displayed the same inactive X chromosome as the original somatic cell [2 –5], while others observed that some human iPSC lines had the inactive X chromosome reactivated after reprogramming [6,7]. Reactivation of genes on the inactive X chromosome can be used to ameliorate human genetic diseases caused by heterozygous mutations of X chromosome genes in female patients, it might be useful to generate iPSCs with two active X chromosomes for further clinical studies.

Hemophilia B is a hereditary disorder caused by mutations of coagulation factor IX (F9) gene, affecting ∼1 in 25,000 males worldwide [8]. Being an X-linked recessive disorder, hemophilia B is inherited by heterozygous females who are defined as carriers, and generally does not affect females. However, female hemophilia does exist. There are two reasons for this: first, homozygous mutations and compound heterozygous mutations in females [9 –13]; second, skewed XCI, defined as the preferential inactivation of one of the two X chromosomes in female cells [14,15]. In the cells of normal females, there are two X chromosomes with wild-type F9 (X^F9-WT); while in the cells of female carriers of hemophilia B, there is an X^F9-WT chromosome and an X chromosome with mutant F9 (X^F9-mut). In mammals, one of the two X chromosomes is randomly inactivated in female cells to maintain a balance in X-linked gene dosage with males during early embryonic development [16]. The preferential inactivation of X^F9-WT chromosome induces the onset of hemophilia B in female carriers. The inactivation of X chromosome depends on the noncoding RNA XIST (X inactivation-specific transcript), which coats and silences the chromosome in which it is expressed [17 –19]. Skewed XCI can be caused by mutations of genes involved in XCI, a reduced number of precursor cells being present at the time of inactivation, or the selection of a small number of normal cells to contribute to the inner cell mass of the blastocyst [20].

In majority of studies, human iPSCs are generated from dermal fibroblasts [21]. Being a hemorrhagic disorder, hemophilia is not suitable for this invasive approach. Usually, iPSCs of hemophilia patients are generated from urine cells [22 –24]. However, peripheral blood mononuclear cells (PBMNCs) have been widely accepted as the best cell source for cell reprogramming due to their easy accessibility and better quality and quantity [25,26].

In this study, we investigated the pathogenesis of a female hemophilia B patient. We generated numerous iPSC colonies of the patient from PBMNCs, which was the first time for generating hemophilia-specific iPSCs from PBMNCs. Then, we detected the XCI state of these iPSCs. We attempted to obtain iPSC lines with X^F9-WT chromosome activated for further disease treatment.

Materials and Methods

Study participants

The female patient, admitted to our center in 2014, 46 years old, had suffered from bleeding episodes in the lower and upper limb muscles, elbow, knee, and hip joints, 4 to 5 times per year for 35 years. Her activated partial thromboplastin time was 57.3 s (normal value 23–33 s); prothrombin time was 14.4 s (normal value 10–14 s); FIX:C was 6% (normal value 50%–120%), FII:C (112.1%), FV:C (113.8%), FVII:C (103.6%), FVIII:C (106.9%), FX:C (102.8%), FXI:C (60%), FXII:C (91.7%), FXIII:C (blood clot did not dissolve after 24 h in urea), and von Willebrand factor antigen (Ag) (93.1%) were normal. Both the qualitative and quantitative detection of coagulation factor inhibitor were negative using the Bethesda assay. Based on these test results, the patient was clearly diagnosed as hemophilia B. As shown in the family pedigree (Fig. 1), there was no history of hemophilia B in her family. The patient's five relatives, including her mother (II8), two sisters (III1 and III3), and two brothers (III5 and III6), were enrolled in our study. The five relatives had no muscular or articulatory hemorrhage. The study was approved by the Ethics Committee of the Institute of Hematology and Blood Disease Hospital, Chinese Academy of Medical Sciences, and written informed consent was obtained from each study subject.

FIG. 1.

The pedigree of the female patient family. There was no hemophilia B history in this family. III4 was the female patient we investigated in the study (as the black arrow points). Her mother (II8), two sisters (III1 and III3), and two brothers (III5 and III6) were enrolled in the study.

High-throughput sequencing of the F9 gene

High-throughput sequencing (including library construction, capture, and sequencing) was carried out at BGI-Tianjin (Tianjin, China). The F9 mutation found by high-throughput sequencing was then verified by Sanger sequencing. The primer sequences were as follows: forward 5′-GAACACCTATTCTATTTCCGT-3′ and reverse 5′-TAGTGCCCTGAACCTGAG-3′.

XCI assay

The XCI state was determined by PCR analysis of a polymorphic trinucleotide repeat in the first exon of the androgen receptor (AR) gene [27]. Genomic DNA was digested with HapII enzyme, and complete digestion was assessed by amplification of the 5′ region of the MIC2 gene [28,29]. Then, both digested and undigested samples were amplified for AR gene using primers: forward 5′-FAM-AAGTGCAGTTAGGGCTGGGAAGG-3′ and reverse 5′-GTAGCCTGTGGGGCCTCTACGAT-3′. If XCR did not occur after reprogramming, AR gene would be amplified. Then PCR products were sized using capillary electrophoresis on an ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) [30]. In our study, the patient's alleles at the AR gene were 3 bp apart, and shadow bands of the first allele overlap with bands of the second allele. Shadow bands were calculated to represent 30% of the amplification from one allele, and peak area values were adjusted accordingly [30]. As determined by the previous study [29], the degree of skewing was determined as mild skewing (≥75%) and extreme skewing (≥90%).

Whole-genome sequencing

Whole-genome sequencing (WGS) was carried out at BGI-Shenzhen (Shenzhen, China), yielding 30× coverage. Sequencing was performed on HiSeq X Ten platform (Illumina, Santiago, CA). Raw image files were processed by Illumina pipeline for base calling with default parameters, and the sequences of each individual were generated as 150-bp paired-end reads.

Generation of the patient's iPSCs

The patient's iPSCs were generated from PBMNCs of the patient using four episomal vectors, as previously described [31]. The reprogramming process was completed under hypoxic conditions (4% O₂). The episomal vectors were gifted by Xiaobing Zhang from the Department of Medicine at Loma Linda University.

Karyotype analysis

For karyotype analysis, iPSCs were harvested after 10 passages. It was done according to a general protocol. The slides were visualized under a microscope, and 20 split cells were selected randomly.

Alkaline phosphatase staining

The Alkaline Phosphatase (AP) Staining Reagents Detection Kit was bought from SiDanSai Biotechnology Co., Ltd. (Shanghai, China). The staining procedures were done according to the protocol provided.

Reverse transcription PCR and quantitative real-time PCR

RNA was extracted using RNeasy Mini Kit (Qiagen, West Sussex, UK) following the manufacturer's instructions. RNA (3 μg) was reversely transcribed using a First Strand Synthesis Kit (Life Technologies, Carlsbad, CA). Quantitative real-time PCR (qRT-PCR) analysis was performed using a Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA). The primer sequences are presented in Table 1.

Table 1.

Primers used for Quantitative Real-Time-PCR and Reverse Transcription-PCR

Gene symbol	Sequence 5′→3′	Size (bp)	Annealing temperature (°C)	Accession number
OCT4	F: GACAACAATGAAAATCTTCAGGAGA	218	60	NM_001173531.2
	R: TTCTGGCGCCGGTTACAGAACCA
SOX2	F: AGCTACAGCATGATGCAGGA	126	60	NM_003106.3
	R: GGTCATGGAGTTGTACTGCA
NANOG	F: TGAACCTCAGCTACAAACAG	154	60	NM_024865.3
	R: TGGTGGTAGGAAGAGTAAAG
GAPDH	F: GAGTCCACTGGCGTCTTC	246	60	NM_001256799.2
	R: GACTGTGGTCATGAGTCCTTC
XIST	F: ACCACCACACGTCAAGCTCTT	171	60	NR_001564.2
	R: CTATCCTCAAGTGCTAGAGCCAG

F, forward; R, reverse.

Teratoma formation assay

iPSCs were injected intramuscularly into Nonobese Diabetic/Severe Combined Immunodeficiency Disease (NOD/SCID) mice. Teratomas formed within 6–8 weeks, and harvested samples were fixed in 4% paraformaldehyde overnight, the paraffin sections were stained with hematoxylin and eosin for histological determinations.

Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde for 30 min at room temperature (RT) and blocked with blocking buffer (phosphate-buffered saline +5% goat serum +0.3% bovine serum albumin) for 1 h at RT. Primary antibodies were incubated overnight at 4°C. Cells were incubated with secondary antibodies for 1 h at 37°C. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole for 5 min. Descriptions of the primary and secondary antibodies are listed in Table 2.

Table 2.

Antibodies Used for Immunofluorescence Staining

Antigen	Distributor	Host	Cat#	Dilution
TRI-1-60	Abcam	Mouse	ab16288	1:100
SSEA4	Abcam	Mouse	ab16287	1:100
OCT4	Abcam	Rabbit	ab19857	1:200
SOX2	Abcam	Rabbit	ab97959	1:200
H3K27me3	Abcam	Mouse	ab6002	1:200
Alexa Fluor^® 555, Anti-Mouse	Invitrogen	Goat	A21426	1:500
Alexa Fluor 488, Anti-Mouse	Invitrogen	Donkey	A21202	1:500
Alexa Fluor 488, Anti-Rabbit	Invitrogen	Donkey	A21206	1:500
Alexa Fluor 555, Anti-Mouse	Invitrogen	Goat	A21425	1:500

RNA fluorescence in situ hybridization analysis

iPSCs (6 × 10⁴) were spun onto slides using the cytospin. After adding probes (Empire Genomics, Buffalo, New York), slides were placed in ThermoBrite platform (Thermo Fisher Scientific, Waltham, MA) in the program: 73°C 10 min and 37°C 24 h. Finally, slides were visualized under a fluorescence microscope.

Results

F9 sequencing of the patient and her five relatives

The high-throughput sequencing results showed that the patient was a carrier with a known hemophilia B mutation: c.676C>T, p.Arg226Trp, which was verified by Sanger sequencing. Sanger sequencing showed that none of her relatives had this mutation (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/scd).

XCI assay of the patient, her mother, and two sisters

The results of capillary electrophoresis are shown in Figure 2. According to the formula, 100*(d1/u1)/((d1/u1) + (d2/u2)) [23], the percentage of skewing of the patient was 94.69% (Table 3), considered as extreme skewing. Because of the excessive amplification of the 306 bp fragment, we considered that the X chromosome with 306 bp fragment had excessive inactivation. As the female was a hemophilia B patient, we inferred that mutation c.676C>T, p.Arg226Trp was located at the X chromosome with 303 bp fragment. The percentages of skewing of her mother and two sisters were 64.20%, 59.12%, and 59.85%, respectively (Table 3). None of the three female relatives showed skewed XCI.

FIG. 2.

The XCI assay of the patient, her mother, and two sisters. The capillary electrophoresis results of II8 (Bi. without HapII digestion; Bii. with HapII digestion), III1 (Ci. without HapII digestion; Cii. with HapII digestion), III3 (Di. without HapII digestion; Dii. with HapII digestion), and III4 (Ai. without HapII digestion; Aii. with HapII digestion). XCI, X chromosome inactivation.

Table 3.

The X Chromosome Inactivation Assay in the Female Patient and Her Three Female Relatives

	Without HapII (AUC)			With HapII (AUC)
Participant	300	303	306	300	303	306	Percentage of skewing (%)
II8	283,829		270,950	164,973		87,811	64.20
III1	244,699	215,665		161,292	107,015		59.12
III3		253,791	197,212		155,288	86,349	59.85
III4		272,943	182,108		49,211	133,882	94.69

AUC, area under the curve.

WGS results for the patient and analysis of XIST and TSIX

According to previous studies [32], both XIST and TSIX (XIST antisense RNA) play important roles in the process of XCI. In our unpublished study, we found mutations of 1061G>A and 11947-130_11947-128delAAT in the XIST gene of this female patient by WGS, while no mutations were found in the TSIX gene. Both mutations were verified by Sanger sequencing and were also found in the XIST genes of her mother, a sister, and a brother (Supplementary Fig. S2). No copy number variations or structural variations were found in the XIST and TSIX gene.

Generation and characterization of the patient's iPSCs

More than 100 iPSC colonies were obtained from 2 × 10⁶ PBMNCs. The colonies exhibited the characteristic human embryonic stem cell morphology with a high nucleus to cytoplasm ratio (Fig. 3Ai) and were positive for AP staining (Fig. 3Aii). Ninety-two iPSC colonies were picked and expanded for further analysis. The iPSC lines were randomly chosen for characterization of pluripotency. They had normal karyotypes (Fig. 3B), and immunofluorescence staining showed expression of pluripotent markers, including TRA-1-60, SSEA4, OCT4, and SOX2 (Fig. 3C). The pluripotency of the iPSCs was further assessed by qRT-PCR analysis (Fig. 3D). Weeks after injection into NOD/SCID mice, iPSCs produced teratomas containing multiple derivatives of the three germ layers (Fig. 3E). Collectively, these results demonstrated that the iPSCs were well reprogrammed.

FIG. 3.

Characterization of the patient-specific iPSCs derived from PBMNCs with episomal vectors. All scale bars represent 100 μm. (Ai) The morphology of iPSC colonies was similar with human embryonic stem cell. (Aii) The alkaline phosphatase staining of iPSC colonies was positive. ( Bi and Bii) The karyotypes of two random chosen iPSC lines were normal (46, XX). (C) The expression of TRA-1-60, SSEA4, OCT4, and SOX2 was detected by immunofluorescence staining. (D) Quantitative real-time-PCR analysis showed the expression of OCT4, SOX2, and NANOG of two random chosen iPSC lines. The PBMNCs of the patient was used as a negative control, while H1 embryonic stem cells were used as a positive control. (E) The pluripotency was assessed by teratoma formation. Hematoxylin and eosin staining of teratoma demonstrated three embryonic germ layers (ectoderm: primitive neurotubules; mesoderm: bone and cartilage; and endoderm: bronchus). iPSCs, induced pluripotent stem cells; PBMNCs, peripheral blood mononuclear cells.

XCI assay of 92 patient's iPSC lines

Considering that prolonged passaging affects XCI characteristics [2], we analyzed the 92 iPSC lines before fifth passage. The nonamplification of MIC2 indicated the complete digestion by HapII enzyme (Supplementary Fig. S3A). Then, AR gene was amplified to see whether XCR occurred, as shown in Supplementary Figure S3B, all cell lines, even iPSCs from passage one, yielded amplified products of the AR gene after HapII enzyme digestion, indicating that XCR did not occur after reprogramming, and all iPSCs had one X chromosome activated and the other inactivated (XaXi).

Further proving the XaXi state of the patient's iPSCs

To further prove the XaXi state of these iPSCs, we amplified the noncoding XIST RNA. As shown in Figure 4A, XIST was expressed in all female patient's iPSC lines. FISH is an important non-radioactive in situ hybridization technique. If the detected DNA on the chromosome is complementary with the homologous nucleic acid probe, they will form hybrids. RNA–FISH analysis indicated that 93% of the cells showed one XIST cloud per nucleus (Fig. 4B; 200 cells were analyzed per cell line). Furthermore, H3K27me3 (trimethylation of histone H3 on lysine 27), a silencing marker on chromatin that correlates with XIST expression, was also detected in the patient's iPSCs (Fig. 4C).

FIG. 4.

The proving of the one X chromosome activated and the other inactivated state of the patient's iPSCs. (A) Reverse transcription-PCR of XIST showed XIST was expressed in all iPSC lines. The female patient's PBMNCs were used as a positive control (lane 1), and a male's PBMNCs were used as a negative control (lane 2). Lane 3–19: the patient's iPSC lines which were chosen at random. (B) XIST RNA-FISH analysis showed there was a red XIST cloud in iPSC nucleus. Scale bars: 100 μm. (C) Immunofluorescence staining showed the expression of H3K27me3. Scale bars: 100 μm. DAPI, 4′,6-diamidino-2-phenylindole; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; XIST, X inactivation-specific transcript.

The skewed XCI state of the patient's 92 iPSC lines

After we had evidence for the amplification of the AR gene, capillary electrophoresis was performed to assess which X chromosome in these iPSC lines was activated. Notably, all 92 iPSC lines had the same result, wherein the 306 bp fragment appeared in the electrophoresis graph (Fig. 5). Because 303 and 306 bp were 3 bp apart, the small peak at 303 bp in Figure 5B actually was the shadow of the peak of 306 bp. So the X chromosome with 303 bp fragment was activated; implying that all 92 iPSC lines had the X^F9-mut chromosome activated. The XCI state of the patient's iPSCs was still skewed such as the somatic cells, reprogramming did not change the skewed state of the patient.

FIG. 5.

The capillary electrophoresis results of iPSCs. All 92 iPSC lines had the 306 bp fragment appeared in the electrophoresis graph after HapII digestion, so one representative capillary electrophoresis image was shown to represent all. (A) Without HapII digestion. (B) With HapII digestion.

Discussion

Hemophilia mostly affects males and is transmitted by female carriers. Female carriers have normal phenotypes due to the random inactivation of one of the two X chromosomes in all the somatic cells. Therefore, in asymptomatic female carriers of hemophilia, the ratio of somatic cells with X^F9-WT chromosome activated to somatic cells with X^F9-mut activated is 50%–50% [33]. However, in our study, we diagnosed a female as hemophilia B and demonstrated that skewed XCI was the reason for the disease. Among the genetic mechanisms leading to skewed XCI [20,34], chromosomal abnormalities and parental origin effects could be ruled out because the karyotype of the patient was normal, and her mother had random XCI. The possible mechanism behind this female patient may be mutations associated with XCI-related genes such as XIST promoter mutations [35,36] and large deletions in XIST [37], or a genetically influenced choice over which X chromosome is inactivated as reported in mice [38]. TSIX noncoding RNA also participates in the process of XCI [32]. In our study, no mutations were found in the TSIX gene of this patient, while two new mutations (1061G>A and 11947-130_11947-128delAAT) were found in her XIST gene. But these mutations also existed in the patient's mother, a sister, and a brother. Therefore, the patient's skewed XCI is not caused by XIST mutations. Definite mechanisms that result in skewed XCI in the patient still need to be investigated.

After the verification of skewed XCI of the patient, we generated iPSCs using integration-free episomal vectors from PBMNCs of the patient, which was the first time for generating hemophilia-specific iPSCs from PBMNCs. In our study, more than 100 iPSC colonies occurred after reprogramming, and the iPSCs had normal karyotypes and good pluripotency. So PBMNCs are excellent somatic cell resources for hemophilia patients to do reprogramming.

Then, we analyzed the XCI state of 92 iPSC lines to see whether XCR occurred after reprogramming. As Tchieu et al. [2] and Pomp et al. [5] reported, all 92 iPSC lines retained an inactive X chromosome, which was proved by the amplification of the AR gene and the XIST gene, the existence of XIST cloud in XIST RNA-FISH analysis, and the expression of H3K27me3. Reasons that XCR does not occur might be due to different reprogramming techniques and the growth conditions, in which human iPSCs are generated and maintained, which generate “primed” rather than “naive” iPSCs [39,40]. In a recent study, it was found that culture of human iPSCs in defined conditions (naive human stem cell medium [NHSM]) resulted in more naive iPSCs and lead to efficient loss of XCI-specific markers, including XIST RNA and XCI-specific histone modifications [41]. We tried this method, domed-shaped colonies resembling murine naive cells could be seen after cultured in NHSM for three passages (Supplementary Fig. S4A), but we could still detect XIST expression by reverse transcription-PCR (Supplementary Fig. S4B). Maybe we did not get some detail points of culturing. We will improve our methods in further study.

Although XCR did not occur, considering that each iPSC colony comes from one somatic cell, we attempted to obtain two kinds of iPSC colonies after reprogramming, the ones with X^F9-WT chromosome activated and the ones with X^F9-mut chromosome activated. However, our actual results did not support our expected results. All 92 iPSC lines had the X^F9-mut chromosome activated. According to Pomp et al. [5], using balanced populations of female Rett Syndrome patient and control fibroblasts, all colonies made from the same donor fibroblasts contained the same inactive X chromosome. They found that the mosaic nature of female fibroblasts was lost during extended passaging in vitro as a consequence of the proliferative advantage of one type of cells to its counterparts. In our study, the ratio of somatic cells with X^F9-mut chromosome activated to somatic cells with X^F9-WT chromosome activated was 94.69%–5.31%, the former had absolute advantage to the latter. So maybe this was the reason we could not obtain iPSC lines with X^F9-WT chromosome activated. It suggests that iPSCs derived from PBMNCs have imprints of PBMNCs, which indicates that iPSCs have imprints of the original somatic cells. Thus, when using iPSCs to treat diseases limited to a specific organ, it might be a better choice to use somatic cells from the same organ to generate iPSCs.

In conclusion, skewed XCI is one reason for hemophilia in females, which should be kept in mind to avoid misdiagnosis and missed diagnosis. PBMNCs are excellent somatic cell resources for hemophilia patients to do reprogramming. And more attentions should be paid to generate naive iPSCs with two active X chromosomes for further clinical disease treatment, we will explore novel reprogramming techniques and growth conditions in further research. The state of skewed XCI is retained in the iPSCs from a female with hemophilia B, it indicates that iPSCs might have imprints of the original somatic cells, which is instructive for clinical application.

Footnotes

Acknowledgments

This study was supported by National Key Research and Development Program of China (2016ZY05002341), Ministry of Science and Technology of China (2016YFA0100600), National Natural Science Foundation of China (81470302 and 81421002), Tianjin Municipal Science and Technology Commission (15JCZDJC35800), CAMS Initiative for Innovative Medicine (2016-I2M-1-018, 2016-I2M-1-017, 2016-I2M-1-002, 2016-I2M-1-001, 2015PT310006), PUMC Youth Fund (332015129), and Novo Nordisk Hemophilia Research Fund in China.

Author Disclosure Statement

No competing financial interests exist.

References

Maherali

, Sridharan

, Xie

, Utikal

, Eminli

, Arnold

, Stadtfeld

, Yachechko

, Tchieu

, et al. (2007). Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell, 1:55–70.

Tchieu

, Kuoy

, Chin

, Trinh

, Patterson

, Sherman

, Aimiuwu

, Lindgren

, Hakimian

, et al. (2010). Female human iPSCs retain an inactive X chromosome. Cell Stem Cell, 7:329–342.

Cheung

, Horvath

, Grafodatskaya

, Pasceri

, Weksberg

, Hotta

, Carrel

and Ellis

. (2011). Isolation of MECP2-null Rett Syndrome patient hiPS cells and isogenic controls through X-chromosome inactivation. Hum Mol Genet, 20:2103–2115.

Mekhoubad

, Bock

, de Boer

, Kiskinis

, Meissner

and Eggan

. (2012). Erosion of dosage compensation impacts human iPSC disease modeling. Cell Stem Cell, 10:595–609.

Pomp

, Dreesen

, Leong

, Meller-Pomp

, Tan

, Zhou

and Colman

. (2011). Unexpected X chromosome skewing during culture and reprogramming of human somatic cells can be alleviated by exogenous telomerase. Cell Stem Cell, 9:156–165.

Lagarkova

, Shutova

, Bogomazova

, Vassina

, Glazov

, Zhang

, Rizvanov

, Chestkov

and Kiselev

. (2010). Induction of pluripotency in human endothelial cells resets epigenetic profile on genome scale. Cell Cycle, 9:937–946.

Marchetto

, Carromeu

, Acab

, Yu

, Yeo

, Mu

, Chen

, Gage

and Muotri

. (2010). A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells. Cell, 143:527–539.

de Brasi

, El-Maarri

, Perry

, Oldenburg

, Pezeshkpoor

and Goodeve

. (2014). Genetic testing in bleeding disorders. Haemophilia, 20(Suppl 4):54–58.

Shetty

, Ghosh

and Mohanty

. (2001). Hemophilia B in a female. Acta Haematol, 106:115–117.

10.

Pavlova

, Brondke

, Musebeck

, Pollmann

, Srivastava

and Oldenburg

. (2009). Molecular mechanisms underlying hemophilia A phenotype in seven females. J Thromb Haemost, 7:976–982.

11.

Martin-Salces

, Vencesla

, Alvarez-Roman

, Rivas

, Fernandez

, Butta

, Baena

, Fuentes-Prior

, Tizzano

and Jimenez-Yuste

. (2010). Clinical and genetic findings in five female patients with haemophilia A: identification of a novel missense mutation, p.Phe2127Ser. Thromb Haemost, 104:718–723.

12.

Cai

, Wang

, Dai

, Fang

, Ding

, Xie

and Wang

. (2006). Female hemophilia A heterozygous for a de novo frameshift and a novel missense mutation of factor VIII. J Thromb Haemost, 4:1969–1974.

13.

Windsor

, Lyng

, Taylor

, Ewenstein

, Neufeld

and Lillicrap

. (1995). Severe haemophilia A in a female resulting from two de novo factor VIII mutations. Br J Haematol, 90:906–909.

14.

Sellner

and Price

. (2005). Segmental isodisomy and skewed X-inactivation resulting in haemophilia B in a female. Br J Haematol, 131:410–411.

15.

Orstavik

, Scheibel

, Ingerslev

and Schwartz

. (2000). Absence of correlation between X chromosome inactivation pattern and plasma concentration of factor VIII and factor IX in carriers of haemophilia A and B. Thromb Haemost, 83:433–437.

16.

Lyon

. (1961). Gene action in the X-chromosome of the mouse (Mus musculus L.). Nature, 190:372–373.

17.

Chow

and Heard

. (2009). X inactivation and the complexities of silencing a sex chromosome. Curr Opin Cell Biol, 21:359–366.

18.

Marahrens

, Panning

, Dausman

, Strauss

and Jaenisch

. (1997). XIST-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev, 11:156–166.

19.

Wutz

and Jaenisch

. (2000). A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol Cell, 5:695–705.

20.

Brown

and Robinson

. (2000). The causes and consequences of random and non-random X chromosome inactivation in humans. Clin Genet, 58:353–363.

21.

, Vodyanik

, Smuga-Otto

, Antosiewicz-Bourget

, Frane

, Tian

, Nie

, Jonsdottir

, Ruotti

, et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science, 318:1917–1920.

22.

Jia

, Chen

, Zhao

, Liu

, Cai

, Qin

, Du

, Wu

, Chen

, et al. (2014). Modeling of hemophilia A using patient-specific induced pluripotent stem cells derived from urine cells. Life Sci, 108:22–29.

23.

Pang

, Wu

, Li

, Hu

, Wang

, Hu

, Wang

, Liu

, Zhou

, et al. (2016). Targeting of the human F8 at the multicopy rDNA locus in Hemophilia A patient-derived iPSCs using TALENickases. Biochem Biophys Res Commun, 472:144–149.

24.

Park

, Kim

, Son

, Sung

, Lee

, Bae

, Kim

and Kim

. (2015). Functional correction of large factor VIII gene chromosomal inversions in hemophilia A patient-derived iPSCs using CRISPR-Cas9. Cell Stem Cell, 17:213–220.

25.

Zhang

. (2013). Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics, 11:264–274.

26.

Dowey

, Huang

, Chou

, Ye

and Cheng

. (2012). Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc, 7:2013–2021.

27.

Allen

, Zoghbi

, Moseley

, Rosenblatt

and Belmont

. (1992). Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet, 51:1229–1239.

28.

Goodfellow

, Mondello

, Darling

, Pym

, Little

and Goodfellow

. (1988). Absence of methylation of a CpG-rich region at the 5′ end of the MIC2 gene on the active X, the inactive X, and the Y chromosome. Proc Natl Acad Sci U S A, 85:5605–5609.

29.

, Stanar

and Ma

. (2014). X-chromosome inactivation in female newborns conceived by assisted reproductive technologies. Fertil Steril, 101:1718–1723.

30.

Beever

, Stephenson

, Penaherrera

, Jiang

, Kalousek

, Hayden

, Field

, Brown

and Robinson

. (2003). Skewed X-chromosome inactivation is associated with trisomy in women ascertained on the basis of recurrent spontaneous abortion or chromosomally abnormal pregnancies. Am J Hum Genet, 72:399–407.

31.

, Neises

and Zhang

. (2016). Generation of iPS cells from human peripheral blood mononuclear cells using episomal vectors. Methods Mol Biol, 1357:57–69.

32.

Ohhata

, Matsumoto

, Leeb

, Shibata

, Sakai

, Kitagawa

, Niida

, Kitagawa

and Wutz

. (2015). Histone H3 lysine 36 trimethylation is established over the XIST promoter by antisense TSIX transcription and contributes to repressing XIST expression. Mol Cell Biol, 35:3909–3920.

33.

Puck

and Willard

. (1998). X inactivation in females with X-linked disease. N Engl J Med, 338:325–328.

34.

Renault

, Dyack

, Dobson

, Costa

, Lam

and Greer

. (2007). Heritable skewed X-chromosome inactivation leads to haemophilia A expression in heterozygous females. Eur J Hum Genet, 15:628–637.

35.

Plenge

, Hendrich

, Schwartz

, Arena

, Naumova

, Sapienza

, Winter

and Willard

. (1997). A promoter mutation in the XIST gene in two unrelated families with skewed X-chromosome inactivation. Nat Genet, 17:353–356.

36.

Tomkins

, McDonald

, Farrell

and Brown

. (2002). Lack of expression of XIST from a small ring X chromosome containing the XIST locus in a girl with short stature, facial dysmorphism and developmental delay. Eur J Hum Genet, 10:44–51.

37.

Marahrens

, Loring

and Jaenisch

. (1998). Role of the XIST gene in X chromosome choosing. Cell, 92:657–664.

38.

Chadwick

and Willard

. (2005). Genetic and parent-of-origin influences on X chromosome choice in XCE heterozygous mice. Mamm Genome, 16:691–699.

39.

Ohhata

and Wutz

. (2013). Reactivation of the inactive X chromosome in development and reprogramming. Cell Mol Life Sci, 70:2443–2461.

40.

Lessing

, Anguera

and Lee

. (2013). X chromosome inactivation and epigenetic responses to cellular reprogramming. Annu Rev Genomics Hum Genet, 14:85–110.

41.

Gafni

, Weinberger

, Mansour

, Manor

, Chomsky

, Ben-Yosef

, Kalma

, Viukov

, Maza

, et al. (2013). Derivation of novel human ground state naive pluripotent stem cells. Nature, 504:282–286.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.12 MB

0.22 MB

0.04 MB

0.07 MB