The Forkhead Transcription Factor FOXC2 Is Required for Maintaining Murine Spermatogonial Stem Cells

Abstract

Continuous spermatogenesis from puberty to old age in males relies on spermatogonial stem cells (SSCs) that possess the property of self-renewal and differentiation. The delicate balance between self-renewal and differentiation is of great importance. In mice, SSCs exist as a subpopulation of undifferentiated spermatogonia. SSCs are controlled by intrinsic molecular pathways that can be activated by extrinsic signals. Our results here first show that the expression of forkhead box C2 (FOXC2) is restricted to GFRα1-positive spermatogonia in the testis. Whole-mount immunofluorescence results reveal that FOXC2 is expressed predominately in A_s and A_pr spermatogonia. Reduction of Foxc2 gene expression by shRNA lentivirus treatment significantly impairs the maintenance of SSCs in vitro. Furthermore, knock-down of Foxc2 decreases SSC colonization to only 10.42% compared to the control by transplantation. Reverse transcription and real-time quantitative PCR gene analyses following knock-down of Foxc2 indicate that Foxc2 may act as a suppressor for SSC differentiation. Extrinsic stimuli treatments show that glial cell line-derived neurotrophic factor and retinoic acid act in opposite ways to regulate FOXC2 expression and subsequent SSC property. These results suggest that FOXC2 is a critical intrinsic regulator of SSC self-renewal and differentiation.

Introduction

Continuous spermatogenesis from puberty to old age in males relies on a pool of spermatogonial stem cells (SSCs). SSCs are formed from neonatal gonocytes immediately after their migration to the basement membrane of the seminiferous epithelium [1]. This conversion occurs in mice around postnatal day (P) 3 [2]. Some gonocytes may also directly convert to A₁ spermatogonia [3]. SSCs being male germ-line stem cells share two characteristics with other adult stem cells. They can self-renew and also provide daughter cells, which differentiate into one or more terminal cell types [3]. In mice, SSCs exist as a subpopulation of undifferentiated spermatogonia. Undifferentiated spermatogonia are classified as A_single (A_s), A_paired (A_pr), or A_aligned (A_al) according to the number of cells in the clones [1]. The A_s spermatogonia divide into a pair of spermatogonia (A_pr) that do not complete cytokinesis and stay connected by an intercellular bridge. Cytokinesis in all subsequent divisions will also be incomplete, leading to the formation of increasingly large syncytia of spermatogonia. The A_pr spermatogonia further divide to form chains of 4, 8, 16, and occasionally up to 32 A_aligned (A_al) spermatogonia. The intercellular bridge is considered to be the first visible sign of spermatogonia differentiation [1]. The A_al spermatogonia go through a differentiation step without mitotic division and become A₁ spermatogonia. This differentiation step involves slight morphological changes and brings about changes in cell cycle characteristics of the spermatogonia. In mice, there are six divisions following A₁ formation: A₂, A₃ A₄, intermediate (In), and then B spermatogonia that divide into preleptotene spermatocytes, the immediate precursor cell type of meiotic germ cells. A_1-4, In, and B spermatogonia are identified as “differentiating spermatogonia” [1].

The study of SSC biology was difficult initially because of their rarity in the testis, estimated to be 0.02%–0.03% of all germ cells in mouse testis and the complex niche microenvironment [4]. Fortunately, a robust transplantation technique developed in 1994 made it possible to unequivocally quantify and characterize SSCs based on their functional ability to reestablish spermatogenesis [5,6]. In 2003, a long-term in vitro culture system that supports self-renewal and differentiation of mouse SSCs was established [7]. Although the number of SSCs in testes is very low, this culture system allows SSCs to proliferate rapidly in vitro and to be collected for molecular and biochemical analyses.

The prevailing mouse SSC model assumes that the stem cell population resides in the A_s population and that cyst length reflects the extent of differentiation [3,8,9]. A corollary of this “A_s model” is that all A_s spermatogonia are homogeneous. This “A_s model,” proposed in 1971, has provided the framework of SSC research in mice and other animals for many years. However, several recent studies show that undifferentiated spermatogonia were heterogeneous in the expression of several genes such as NANOS2, GFRα1, NANOS3, and NGN3 [10 –12]. GFRα1 and NANOS2 are expressed in large subsets of A_s and A_pr and in small subsets of A_al. Conversely, NGN3 and NANOS3 are expressed mainly in A_al while rarely in A_s and A_pr. The A_s spermatogonia are not homogeneous. Thus, A_s, A_pr, and A_al populations can be stratified both morphologically (cyst length) and by gene expression. NANOS2⁺ or GFRα1⁺ SSCs are called “actual stem cells,” while NANOS3⁺ or NGN3⁺ SSCs are referred to as “potential stem cells” [12 –15]. Potential stem cells possess the potential to self-renew but do not do so in undisturbed testes. However, during regeneration after damage, they retain latent self-renewing potential.

Forkhead box (FOX) proteins are a family of transcription factors present in various organs and tissues during development and play crucial roles in a variety of processes such as cell growth, proliferation, differentiation, and longevity [16 –18]. FOX proteins are characterized by the FOX, a sequence of around 100 amino acids forming a motif that binds to DNA [19,20]. Because of the butterfly-like appearance of the loops in the protein structure of the domain, this forkhead motif is also known as the winged helix [21]. Forkhead box C2 (FOXC2), also known as mesenchyme forkhead protein (MFH1), belongs to the forkhead “C” subfamily [22]. FOXC2 is required for cardiovascular development, early organogenesis of the kidney and adipocyte differentiation [23 –25]. Recently, FOXC2 was found to be associated with epithelial–mesenchymal transition and stem cell properties in breast cancer [26]. FOXO1, another FOX family transcription factor, plays a critical role in control of SSC self-maintenance and spermatogenesis initiation [27]. Foxc2 was found to be overexpressed in GFRα1-positive cells of the 6-day-old mouse testis [28]. However, the role of FOXC2 in SSCs has yet to be explored. In this study, we investigated the expression and function of FOXC2 in SSCs and demonstrated that FOXC2 is required for maintaining murine SSCs.

Materials and Methods

Animals

DBA/2, C57BL/6 and C57BL/6-Tg (CAG-EGFP) 131Osb mice were used in this study. All animals were kept in a specific pathogen-free environment. All animal procedures were approved by State Key Laboratory of Agrobiotechnology, China Agricultural University.

Immunofluorescence

Mouse testes were fixed in 4% PFA for 2–12 h according to their size at 4°C, incubated in 30% sucrose in phosphate-buffer saline (PBS) overnight at 4°C and embedded in O.C.T. compound. Ten micrometers sections were washed in PBS and blocked in 10% normal donkey serum in PBS for 1 h at room temperature (RT). Then, the sections were incubated with primary antibodies against FOXC2 (1:100; AF6989; R&D) and PLZF (1:100; sc-22839; Santa Cruz) in PBS overnight at 4°C. After washing, the sections were incubated with secondary antibodies of NL557-conjugated donkey anti-sheep IgG (1:200; NL010; R&D) and Alexa Fluor 488-conjugated donkey anti-rabbit IgG (1:200; A-21206; Invitrogen) in PBS for 2 h at RT. After washing, the sections were counterstained with DAPI (1:500; 10236276001; Roche) for 15 min and observed using a fluorescence microscope photograph system (IX73; Olympus). Immunofluorescence of other cell markers was performed according to the same protocol using primary antibodies against GFRα1 (1:50; MAB560; R&D), STRA8 (1:150; ab-49405; Abcam), KI67 (1:400; 9129; Cell Signaling), and G3G4-anti-BrdU (1:200; AB 2314035; DSHB). For 5-Bromo-2′-deoxyuridine (BrdU) labeling experiment, mice were injected intraperitoneally with 100 mg/kg BrdU (B5002; Sigma) 4 h before they were killed.

Whole-mount immunofluorescence

Seminiferous tubules of 35-day-old mouse testis were removed from tunica albuginea, untangled mechanically and fixed in 4% PFA for 2 h at 4°C. The seminiferous tubules were incubated in 0.3% Triton X-100 in PBS for 30 min and blocked in 10% normal donkey serum in PBS for 1 h at RT. Then, the seminiferous tubules were incubated with primary antibodies against FOXC2 (1:100; AF6989; R&D) and PLZF (1:100; sc-22839; Santa Cruz) in 0.3% Triton X-100 in PBS overnight at 4°C. After washing, the samples were incubated with secondary antibodies of NL557-conjugated donkey anti-sheep IgG (1:200; NL010; R&D) and Alexa Fluor 488-conjugated donkey anti-rabbit IgG (1:200; A-21206; Invitrogen) in 0.3% Triton X-100 in PBS for 2 h at RT. The seminiferous tubules were attached to slide glass and observed using laser scanning microscopy (LSM710; Zeiss).

Cell culture

SSCs cultured in vitro are designated as germ-line stem (GS) cells [7]. Mouse GS cell cultures were established from THY1⁺-enriched germ cells. Briefly, mouse testes were harvested from 5 to 7 day-postpartum (dpp) C57BL/6♀ × DBA/2♂ F1 (BDF1) or C57BL/6-Tg (CAG-EGFP) 131Osb♀ × DBA/2♂ F1 (BDF1-GFP) pups and tunica albuginea was removed. Single-cell suspension was prepared by digestion with 0.125% Trypsin (25200072; Gibco) for 10 min and 5 μg/mL of DNase I (DN25; Sigma) for 5 min at 37°C. CD90.2 (THY1.2) MicroBeads (130-049-101; Miltenyi Biotec) were used to enrich the THY1⁺ germ cells by magnetic activated cell sorting (130-042-201; Miltenyi Biotec). THY1⁺ cells were seeded at a density of 2 × 10⁵ cells/well on 12-well plate containing mitomycin C-inactivated mouse embryonic fibroblasts (MEFs) [29]. Culture medium for the long-term GS cells self-renewal and proliferation was StemPro-34 SFM (10640019; Gibco) supplemented with StemPro-34 Nutrient Supplement (10641025; Gibco), N-2 Supplement (17502048; Gibco), 20 μg/mL insulin (I5500; Sigma), 5 mg/mL bovine serum albumin (A3803; Sigma), 6 mg/mL D-(+)-glucose, 2 mM l-glutamine, 30 μg/mL sodium pyruvate, 0.1 mM ascorbic acid, 10 μg/mL d-biotin, 1 μL/mL sodium DL-lactate (L7900; Sigma), 50 μM 2-mercaptoethanol, MEM nonessential amino acids solution (11140050; Gibco), MEM vitamin solution (11120052; Gibco), 30 ng/mL β-estradiol (E2758; Sigma), 60 ng/mL progesterone (P8783; Sigma), 15 ng/mL recombinant murine Glial cell line-derived neurotrophic factor (GDNF) (450-44; Peprotech), 10 ng/mL recombinant murine FGF2 (450-33; Peprotech), and 1% FBS (SH30084.03E; Hyclone) [7]. The cells were maintained at 37°C in an atmosphere of 5% CO₂ in air and subcultured onto fresh MEFs every 5–7 days. GS cells used in this study were cultured between 1 and 3 months after establishment [30].

Lentivirus infection

Lentivirus-mediated short hairpin RNA (shRNA) was used to permanently knockdown Foxc2 gene expression in GS cells. To create lentivirus particles, pLKO.1-puro vector (Addgene plasmid # 8453) containing Foxc2 shRNA or pLKO.1-scramble shRNA vector (Addgene plasmid # 1864) was co-transfected with packaging vector psPAX2 (Addgene plasmid # 12260) and envelope vector pMD2.G (Addgene plasmid # 12259) into 293FT cells (R70007; Invitrogen) using Lipofectamine 2000 (11668019; Invitrogen) [31,32]. The virus supernatant was concentrated by ultracentrifuge (Optima L-100XP; Beckman). Five Foxc2 shRNAs were designed using BLOCK-iT RNAi Designer (Invitrogen). The shRNA with the highest knock-down efficiency was used in this study and the sequence was GCAACTCGCAGGTAACTTATCCTCGAGGATAAGTTACCTGCGAGTTGC (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/scd). GS cells were seeded at a density of 1 × 10⁵ cells/well on 12-well plate and incubated with Foxc2 shRNA lentivirus or control shRNA lentivirus overnight. The medium was changed the next day. At 72 h after infection, puromycin (1 μg/mL) was supplemented for approximately 48 h to select cells that had stably incorporated the transgene. For puromycin selection, mitomycin C-inactivated MEFs of DR4 mouse were used. To creat lentivirus overexpressing FOXC2, pLenti-CMV-GFP-Puro vector (Addgene plasmid #17448) was used. For the gene to be expressed in GS cells, EF1α promoter was cloned into the vector to replace CMV promoter [33]. Full-length mouse Foxc2 was cloned into the new vector containg EF1α promoter.

Transplantation

Transplantation procedures were performed as described in [34]. Six-week-old BDF1 mice were injected intraperitoneally with 45 mg/kg busulfan (B2635; Sigma). Four weeks later, endogenous germ cells were depleted from the seminiferous tubules and the mice were used for transplantation (Supplementary Fig. S2A). BDF1-GFP GS cells were collected by trypsin digestion and counted under fluorescence microscope to distinguish them from MEFs. Cells were resuspended at a concentration of 2 × 10⁶ GS cells/mL in culture medium containing 0.4% trypan blue. Approximately 10 μL of cell suspension (2 × 10⁴ GS cells) was injected into the seminiferous tubules of a recipient testis (Supplementary Fig. S2B). GS cells infected with control shRNA lentivirus and GS cells infected with Foxc2 shRNA lentivirus were injected into the left and right testis of the same mouse, respectively. Recipient mouse testes were recovered 2 months after GS cell transplantation and donor GS cells regenerated GFP-labeled germ cells (Supplementary Fig. S2C). To count colonies, recipient testes were analyzed by observing fluorescence under a laser dissecting microscope (Olympus SZX16) [35,36]. Donor germ cells were identified specifically because recipient testis cells had no fluorescence. A cluster of germ cells was defined as a colony when it occupied the entire circumference of the tubule and was at least 0.1 mm long [7,36,37].

Reverse transcription and real-time quantitative PCR

GS cells were separated from MEFs by gentle pipetting and total RNA was extracted from GS cells using RNAiso Plus (9109; Takara) according to the manufacturer's instructions. Reverse transcription was performed using M-MLV Reverse Transcriptase (M1701; Promega). qPCR was performed using FastSYBR Mixture (CW2621 M; CWBIO) in the ABI 7500 Real-Time PCR System (Applied Biosystems). qPCR conditions were 95°C for 5 min, followed by 40 cycles of 95°C for 5 s and 60°C for 34 s. Transcript levels were normalized to endogenous control Gapdh. qPCR primers used in this study are listed in Supplementary Table S1.

Western blot

GS cells were separated from MEFs by gentle pipetting and lysed with RIPA buffer (C1053; Applygen) containing 10 mM DTT (7016; Cell Signaling) and 1 mM PMSF (8553; Cell Signaling). The protein concentration was determined using BCA Protein Assay Kit (P001; Vigorous) according to the manufacturer's instructions. Total protein was separated by 12% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (IPVH00010; Millipore). The membranes were blocked in 5% (w/v) nonfat dry milk for 3 h and incubated with primary antibodies against FOXC2 (1:2,000; AF6989; R&D) or GAPDH (1:5,000; AM4300; Ambion) in 0.1% Tween-20 in tris-buffered saline (TBST) overnight at 4°C. After washing, the membranes were incubated with secondary antibodies of HRP-conjugated donkey anti-sheep IgG (1:5,000; HAF016; R&D) or HRP-conjugated goat anti-mouse IgG (1:10,000; ZB-2305; Zhongshan) in TBST for 2 h at RT. After washing, the membranes were treated with West Pico Chemiluminescent Substrate (34080; Thermo) and photographed using a chemiluminescent imaging system (5200; Tanon). ImageJ Software was used to assay the relative intensity of each blot. The intensity values of each group were normalized to endogenous control GAPDH in the same group.

Extrinsic stimuli treatment

For growth factor treatment, GS cells were cultured without growth factors for 24 h. Then, PBS, GDNF (15 ng/mL) or FGF2 (10 ng/mL) was supplemented for 24 h and samples were collected for reverse transcription and real-time quantitative PCR (RT-qPCR) or western blot analysis [38]. For retinoic acid (RA) treatment, GS cells were treated with DMSO or RA (100 nM) for 24 h and samples were collected for RT-qPCR or western blot analysis [39]. For inhibitor of signaling pathways treatment, GS cells were cultured without growth factors for 24 h. Then, GS cells were pretreated with DMSO, PD98059 (25 μM; 9900; Cell Signaling) or LY294002 (33 μM; 9901; Cell Signaling) for 1 h, and PBS or GDNF (15 ng/mL) was supplemented for 24 h [40]. Samples were collected for RT-qPCR or western blot analysis.

Statistical analysis

Data are presented as means ± SEM. Statistical analysis was performed using SPSS Statistics. Comparisons between two groups were analyzed by Student's t-test. A value of P < 0.05 was considered to be statistically significant.

Results

The expression of FOXC2 in testis is restricted to GFRα1-positive spermatogonia and is mainly in A_s and A_pr spermatogonia

We examined the expression of FOXC2 in testes of 1-, 4-, 7-, 14-, 21-, and 35-day (d)-old mice. In 1-d-old testis, FOXC2 was expressed in the gonocytes in the luminal compartment of seminiferous tubules. Gonocytes resume proliferation around postnatal day (P) 3, migrate to the seminiferous tubule basement membrane and differentiate into SSCs [2]. In 4-, 7-, 14-, 21-, and 35-d-old testis, FOXC2 was expressed in the spermatogonia on the basal membrane of seminiferous tubules. To detect FOXC2 expressing spermatogonial cell types, double immunofluorescence was performed. The expression of PLZF is restricted to undifferentiated spermatogonia [2]. We found that FOXC2 was expressed in a subpopulation of PLZF-expressing-undifferentiated spermatogonia (Fig. 1A and Supplementary Fig. S3). FOXC2 was expressed in 90.17%, 78.64%, 51.56%, 41.77%, 29.97%, and 26.62% of undifferentiated spermatogonia in 1-, 4-, 7-, 14-, 21, and 35-d-old testes, respectively (Fig. 1B). With the development of testis, the proportion of FOXC2-expressing spermatogonia decreased in the undifferentiated spermatogonia. GFRα1 is expressed in large subsets of A_s and A_pr spermatogonia and in small subsets of A_al spermatogonia [11]. STRA8 is expressed in differentiating spermatogonia and spermatocytes, and its expression begins shortly before spermatogonial differentiation [41]. Interestingly, we found that FOXC2 was expressed in the same cells with GFRα1 and in the different cells with STRA8 (Fig. 1C, D and Supplementary Fig. S4). These results confirm the undifferentiated state of FOXC2-expressing spermatogonia.

FIG. 1.

Expression of FOXC2 and PLZF/GFRα1/STRA8 within the seminiferous epithelium of testes from postnatal mice. (A) Representative images of immunofluorescent staining for the expression of FOXC2 (red) in cross sections of testes from 7- to 35-d-old mice. Staining was associated with undifferentiated spermatogonia that were labeled by the marker PLZF (green). DAPI (blue) was used to stain nuclei. Scale bars: 50 μm for all images. (B) Summarized cell counts from immunofluorescent staining shown in (A), shown as proportion of FOXC2⁺/PLZF⁺. Fifty seminiferous tubule cross sections were counted in each stage of testes. Data are means ± SEM (n = 50). (C) Representative images of double immunofluorescent staining for the expression of FOXC2 (red) and GFRα1 (green) in cross sections of testes from 7-d-old mice. DAPI (blue) was used to stain nuclei. Scale bar: 50 μm. (D) Representative images of double immunofluorescent staining for the expression of FOXC2 (red) and STRA8 (green) in cross sections of testes from 7-d-old mice. DAPI (blue) was used to stain nuclei. Scale bar: 50 μm. Color images available online at www.liebertpub.com/scd

To detect the proliferation status of FOXC2-expressing spermatogonia, double immunofluorescence of FOXC2 and KI67 was performed. However, no obvious relationship was found between FOXC2 and KI67. Some of the FOXC2-expressing spermatogonia were KI67 positive, but others were KI67 negative (Supplementary Fig. S5A). Further, we performed BrdU labeling experiments to label cells in the S phase. Double immunofluorescence of FOXC2 and BrdU showed that most of the FOXC2-expressing spermatogonia were BrdU negative (Supplementary Fig. S5B). These results suggest that FOXC2 may not affect the proliferation of SSCs.

Undifferentiated spermatogonia are classified as A_single (A_s), A_paired (A_pr), and A_aligned (A_al) according to the number of cells in the clones. Whole-mount double immunofluorescent staining of seminiferous tubules was performed to investigate the expression of FOXC2 in undifferentiated spermatogonia. We found that FOXC2 was expressed preferentially in A_s and A_pr spermatogonia (Fig. 2A). A small amount of A_al-4 spermatogonia also expressed FOXC2 (Fig. 2A). FOXC2 was very rarely expressed in A_al-8 spermatogonia and the expression level was much lower than those of A_s and A_pr spermatogonia (Fig. 2B). In A_al-16 spermatogonia, FOXC2 expression was not detected (Fig. 2C). FOXC2 was expressed in 85.41% of A_s spermatogonia, 68.48% of A_pr spermatogonia, 22.11% of A_al-4 spermatogonia, 11.67% of A_al-8 spermatogonia, and 0% A_al-16 spermatogonia (Fig. 2D). These results suggest that FOXC2-expressing spermatogonia are even further undifferentiated than other undifferentiated spermatogonia.

FIG. 2.

Expression of FOXC2 and PLZF within the seminiferous tubules of testes from 35-d-old mice. (A–C) Images of whole-mount immunofluorescent staining for the expression of FOXC2 (red) in seminiferous tubules of testes from 35-d-old mice. Staining was associated with undifferentiated spermatogonia that were labeled by the marker PLZF (green). Scale bars: 50 μm for all images. (D) Summarized cell counts from immunofluorescent staining shown in (A–C), shown as a proportion of FOXC2⁺/PLZF⁺ with the indicated number of cells. Fifty cysts were counted in each type of undifferentiated spermatogonia. Cysts of other than 2ⁿ cells were omitted. Data are means ± SEM (n = 3). Color images available online at www.liebertpub.com/scd

Reduction of the Foxc2 transcript level affects SSC clump maintenance in vitro and decreases SSC colonization

SSC culture provides an excellent method for studying SSC function in vitro. These cells are designated as germ-line stem (GS) cells [7]. To investigate the function of FOXC2, we used GS cells from BDF1 and BDF1-GFP mice. Before beginning functional studies, immunocytochemistry was performed to obtain the makeup of the germ cells present in BDF1 GS cells [42]. Immunocytochemistry staining of the GS cells showed that all GS cells expressed PLZF while only a portion of them expressed FOXC2, which was consistent with the testis immunofluorescence and whole-mount results (Fig. 3A).

FIG. 3.

Expression of FOXC2 and PLZF in the GS cells and the evaluation of FOXC2 function in GS cell maintenance in vitro. (A) Images of immunocytochemistry for expression of FOXC2 (red) in GS cells. Staining was associated with undifferentiated spermatogonia that were labeled by the marker PLZF (green). DAPI (blue) was used to stain nuclei. Scale bars: 50 μm. (B) RT-qPCR analysis for relative Foxc2 transcript abundance in cultures of GS cells 72 h after treatment with control shRNA or Foxc2 shRNA lentivirus. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. (C) Western blot analysis for relative FOXC2 protein levels in cultures of GS cells 72 h after treatment with control shRNA or Foxc2 shRNA lentivirus. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. (D) Treatment of GS cells with Foxc2 shRNA lentivirus dramatically reduced the clump size and number during 10 days of culture compared with GS cells infected with control shRNA lentivirus. Scale bars: 50 μm. (E) Number of GS cells at 5 and 10 days after control or Foxc2 shRNA lentivirus treatment. Data are means ± SEM (n = 3). GS, germ-line stem. Color images available online at www.liebertpub.com/scd

To demonstrate its biological significance, we examined the effects of FOXC2 on SSC maintenance in vitro. BDF1-GFP GS cells allow for readily distinguishable GS cells by means of GFP, which allows them to be easily distinguished from MEFs when doing cell counts. To suppress the mRNA level of Foxc2, cultured GS cells were stably transduced by lentivirus containing a Foxc2 shRNA transgene. The mRNA level of Foxc2 in cultures treated with Foxc2 shRNA lentivirus (designated as Foxc2i) was significantly reduced to only 21.58% of that in control cultures treated with nontargeting shRNA lentivirus (designated as control) as measured by qRT-PCR after 72 h (Fig. 3B).The FOXC2 protein level of Foxc2i was reduced to 28.93% compared with control, similarly (Fig. 3C). Next, puromycin (1 μg/mL) was supplemented for approximately 48 h to select cells that had stably incorporated the transgene. At 10 days after transduction with the Foxc2 shRNA lentivirus, there was a significant reduction in both the clump size and number of GS cells compared with cells transduced with the negative control shRNA lentivirus. As a result, viable GS cells in Foxc2 shRNA-treated cultures proliferated much more slowly compared with negative control shRNA-treated cultures (Fig. 3D). The number of GS cells in the negative control shRNA-treated cultures and Foxc2 shRNA-treated cultures was 2.51 × 10⁵ and 1.89 × 10⁵ at 5 days after transduction, and 10.84 × 10⁵ and 2.59 × 10⁵ at 10 days after transduction, respectively (Fig. 3E). These data demonstrate that inhibiting of Foxc2 has a significant impact on SSC maintenance in vitro and suggest that FOXC2 is an important transcription factor for SSC self-renewal and survival.

To determine the effects that Foxc2 knock-down has on the SSC population, we used BDF1-GFP GS cells and performed transplantation experiments. Foxc2 shRNA-treated GS cells and control shRNA-treated GS cells were selected by puromycin (1 μg/mL) for 48 h and were transplanted into the testes of busulfan-treated recipient BDF1 mice (approximately 2 × 10⁴ GS cells per testis). As previously reported, this approach enables quantification of SSCs in vivo and allows us to determine the reduction in the number of SSCs that occur in the GS cell cultures following knock-down of Foxc2. We performed six transplantation experiments and four busulfan-treated mice were used in each experiment. Approximately 2 months following transplantation, the mice were killed and the testes were observed using a laser dissecting microscope to determine the number of donor-cell-derived colonies. Knock-down of Foxc2 within GS cell cultures significantly decreased the formation of donor-cell-derived colonies (Fig. 4A). The control shRNA-treated GS cells formed 103.96 colonies per 10⁵ cells while the Foxc2 shRNA-treated GS cells formed only 10.83 colonies per 10⁵ cells, about 10.42% of the control (Fig. 4B and Table 1). The findings presented here further validate the importance of FOXC2 in maintaining the SSC population and demonstrate that the loss of FOXC2 reduces the number of SSCs in GS cell cultures in vitro.

FIG. 4.

Colonization of recipient testes by GS cells. (A) The macroscopic appearance of recipient testes that were transplanted with GS cells treated with control or Foxc2 shRNA lentivirus. Green tubules indicate spermatogenesis from donor SSCs. The colonizing ability of Foxc2 shRNA lentivirus-treated GS cells was dramatically reduced compared to the control. (B) Colony counts after lentivirus treatment and transplantation of GS cells. Results of six experiments (n = 24). Data are means ± SEM. *Significant difference at P < 0.05. SSC, spermatogonial stem cell. Color images available online at www.liebertpub.com/scd

Table 1.

Data of Transplantation Experiments

	Colonies(/10⁵ cells)			Colonies(/10⁵ cells)
Number of experiments	Control	Foxc2i	Number of experiments	Control	Foxc2i
1	140	25	4	25	5
	165	45		65	0
	60	15		135	15
	65	10		145	0
2	45	10	5	25	0
	110	0		35	0
	200	60		25	0
	175	35		115	0
3	55	0	6	275	15
	50	0		80	10
	55	5		105	0
	15	0		330	10

Further, we did the overexpression experiments using lentivirus. FOXC2 was overexpressed in both mRNA and protein level in GS cells (Supplementary Fig. S6A, B). However, the number of Foxc2-OE GS cells was almost the same compared to control-OE at 15 days after infection (Supplementary Fig. S6C, D). The colonization ability of Foxc2-OE GS cells slightly improved, but the statistical analysis showed no significant difference (Supplementary Fig. S6E, F).

Gene expression changes following knock-down of Foxc2

Knock-down of Foxc2 impaired SSC maintenance and reduced SSC colonization. This may be caused by a decrease in self-renewal, a decline in homing ability, differentiation of SSCs, or a combination of all three. Since a number of factors, including Plzf, Etv5, c-Ret, Gfrα1, Bcl6b, Pin1, Oct4, Foxo1, Atm, Csf1r, Hras, Fbxw7, Itgb1, Cdh1, Cxcr4, Rac1, Ngn3, Nanos2, Nanos3, Id4, Dazl, Dmc1, Sycp3, Sohlh1, Sohlh2, Sox3, Rarg, Stat3, Dmrt1, Sall4, Stra8, and c-Kit [2,27,30,38,41,43 –68], have been reported to be involved in regulating SSC self-renewal, homing, or differentiation, we examined the effects of Foxc2 knock-down on the expression of these genes in GS cell cultures. The reason for the small degree of change of the indicated genes is that the GS cells in the culture were heterogeneous and only a small portion of them expressed Foxc2. RT-qPCR results showed that there were no significant changes in the genes associated with SSC self-renewal (Fig. 5A) and homing (Fig. 5B). However, the levels of Stra8 and c-Kit that are involved in SSC differentiation increased, especially Stra8 (Fig. 5C). Stra8 and its inducer, RA, have been reported to promote spermatogonia differentiation [41]. c-Kit is also known as a spermatogonia differentiation marker [68]. Of the genes whose levels were reduced, Nanos2 decreased most (Fig. 5C). Nanos2 has been reported to act downstream of GDNF signaling to suppress differentiation of SSCs [56]. These results indicate that Foxc2 may play an important role in suppressing SSC differentiation. Stra8 had the biggest change degree and may have a close relationship with Foxc2.

FIG. 5.

RT-qPCR analysis of the indicated genes following knock-down of Foxc2. (A) Analysis of genes associated with SSC self-renewal. Cells were recovered 3 days after infection. Data are means ± SEM (n = 3). (B) Analysis of genes associated with SSC homing. Cells were recovered 3 days after infection. Data are means ± SEM (n = 3). (C) Analysis of genes associated with SSC differentiation. Cells were recovered 3 days after infection. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. RT-qPCR, reverse transcription and real-time quantitative PCR. Color images available online at www.liebertpub.com/scd

FOXC2 is upregulated by GDNF and downregulated by RA

GDNF and basic fibroblast growth factor (FGF2) are critical regulators of SSC self-renewal and survival. In particular, GS cells do not survive and proliferate in vitro without GDNF [69]. GS cells were cultured without cytokines for 24 h, and samples were collected 24 h after GDNF or FGF2 supplementation. RT-qPCR and western blot results showed that FOXC2 was significantly upregulated by GDNF and slightly upregulated by FGF2 (Fig. 6A, C). It is also known that RA and its target gene Stra8 regulate the initiation of spermatogonia differentiation in mice [41]. We therefore treated cultured GS cells with 100 nM RA for 24 h. RT-qPCR and western blot results showed that FOXC2 was downregulated by RA (Fig. 6B, D).

FIG. 6.

Regulation of FOXC2 expression in GS cells by extrinsic stimuli. (A, C) RT-qPCR analysis of Foxc2 mRNA levels (A) and western blot analysis of FOXC2 protein levels (C) by growth factor withdrawal and supplementation in GS cells. GS cells were cultured without growth factors for 24 h and samples were collected 24 h after growth factor supplementation. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. (B, D) RT-qPCR analysis of Foxc2 mRNA levels (B) and western blot analysis of FOXC2 protein levels (D) by RA treatment in GS cells. GS cells were treated with 100 nM RA for 24 h. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. (E) RT-qPCR analysis of Foxc2 mRNA levels by inhibitors of signaling pathways and GDNF treatment in GS cells. Data are means ± SEM (n = 3). *Significant difference at P < 0.05. NS, no significant difference. GDNF, glial cell line-derived neurotrophic factor; RA, retinoic acid. Color images available online at www.liebertpub.com/scd

To identify the intracellular signaling pathway of GDNF that regulates Foxc2 expression in GS cells, GS cells cultured without cytokines for 24 h were pretreated with DMSO, PD98059 (MEK inhibitor), or LY294002 (PI3K inhibitor) for 1 h, followed by treatment with PBS or GDNF for 24 h. The Foxc2 mRNA levels were detected by RT-qPCR and the results showed that upregulation of Foxc2 by GDNF stimulation was blocked by LY294002 (Fig. 6E). These results suggest that GDNF upregulates Foxc2 expression through PI3K-Akt pathway.

Discussion

The prevailing SSC model for many years is the “A_s model” [3,8,9]. This model assumes that the stem cell population resides in the A_s spermatogonia, whereas A_pr and A_al do not have the stem cell function of self-renewal and are irreversibly committed to differentiation. However, this theory was challenged. Nakagawa et al. showed that Ngn3⁺ spermatogonia could revert to SSCs [13]. When Ngn3/CreER™; CAG-CAT-Z mice are injected with tamoxifen for lineage tracing most of the labeled colonies disappear within 3 months. However, a small fraction of them still exist and are maintained for 14 months, which suggests that Ngn3-expressing cells revert to SSCs. Similarly, Barroca et al. showed that KIT-expressing spermatogonia appear to retain some stem cell potential [70]. Several genes were found to be heterogeneously expressed in undifferentiated spermatogonia. GFRα1 and NANOS2 are expressed in large subsets of A_s and A_pr and in small subsets of A_al [10,11]. Conversely, NGN3 and NANOS3 are expressed mainly in A_al while rarely in A_s and A_pr [10,11]. OCT4 is heterogeneously expressed in GS cells, but in adult mice, OCT4 is also present in Sertoli cells [48,71]. Even the A_s spermatogonia is not a homogeneous stem cell population and it can be classified by gene expression. GFRα1⁺ spermatogonia are shown to function as stem cells that possess the ability to self-renew in steady state and can therefore be referred to as “actual stem cells.” NGN3⁺ spermatogonia exit from the stem cell compartment and tend to differentiate. This population possesses the potential to self-renew but does not normally do so in steady-state spermatogenesis. During regeneration after damage, NGN3⁺ cells reverse to GFRα1⁺ and restore their ability to self-renew. This functional compartment is referred to as “potential stem cells” [13 –15].

In our research, we found that FOXC2 is expressed mainly in A_s and A_pr spermatogonia. A small amount of A_al-4 spermatogonia also express FOXC2. FOXC2 is very rarely expressed in A_al-8 spermatogonia and the expression level is much lower than those of A_s and A_pr spermatogonia. In A_al-16 spermatogonia, FOXC2 expression was not detected. Additionally, the proportion of FOXC2-expressing spermatogonia decreases in the undifferentiated spermatogonia with testicular postnatal development. When gonocytes convert to SSCs around postnatal day (P) 3, most germ cells are SSCs. With testicular development and SSC differentiation, the proportion of SSCs decreases to 0.02%–0.03% of all germ cells in adult testis [4]. The decreasing proportion of FOXC2-expressing spermatogonia is consistent with this phenomenon. In GS cells cultured in vitro, FOXC2 is expressed in only some of the GS cells. The expression pattern of FOXC2 is the same as that of GFRα1, so it can also be considered as a marker for actual stem cells in testis. To our knowledge, FOXC2 is the first transcription factor that was found expressing in this pattern and is therefore thought to play an important role in SSCs.

To demonstrate the functional importance of FOXC2 on SSC survival and self-renewal, further analysis was done. Using lentivirus-mediated reduction of Foxc2 transcript levels in self-renewing GS cells, we found a dramatic effect on SSC maintenance in vitro. Because of the heterogeneous nature of cultured GS cells, treatments in vitro must be coupled with transplantation assays to unequivocally draw conclusions about effects on SSCs since the capability to reestablish and support spermatogenesis defines SSCs. The transplantation results show that there are fewer SSCs in the Foxc2 shRNA-treated GS cells than those in the negative control shRNA-treated GS cells. These results suggest that FOXC2 plays an important role in maintaining the SSC population.

To indicate the mechanism by which Foxc2 affects GS cell biology, we analyzed genes associated with SSC self-renewal, homing and differentiation. The RT-qPCR results show that Foxc2 may play an important role in suppressing SSC differentiation and may have a close relationship with Stra8. An important feature of GS cells in culture is that there is a considerable level of cell death [48]. The main reason is that the current conditions cannot support the viability of differentiating spermatogonia. Therefore, the impaired SSC maintentance in vitro following knock-down of Foxc2 may be caused by increased differentiation of SSCs and these differentiating spermatogonia die due to current culture conditions.

The results of withdrawal and supplementation of the growth factors show that FOXC2 levels are significantly upregulated by GDNF and slightly upregulated by FGF2. GDNF has been established as the primary regulator of SSC cell fate. Undifferentiated spermatogonia accumulate in the seminiferous tubules of mice overexpressing GDNF, whereas spermatogenesis gradually declines in the heterozygous knockout (KO) mice, which leads to male infertility [72]. GFRα1 is the membrane receptor of GDNF and FOXC2 is expressed in the same cells with GFRα1. The dramatic alteration in FOXC2 expression levels resulting from withdrawal and supplementation of these growth factors indicates that FOXC2 acts as an important molecule in SSCs. The signaling pathway experiments show that GDNF signals via the GFRα1/RET co-receptor through activation of PI3K-Akt pathway and subsequently induces several target genes in SSCs, with Foxc2 being one of them [40,73 –75]. RA is known to trigger the differentiation of spermatogonia [76]. Vitamin A-deficient mice and rats are infertile because the differentiation of spermatogonia is inhibited, and treating them with either vitamin A or RA results in the recovery of spermatogonia differentiation [77 –79]. FOXC2 is also downregulated by RA.

In conclusion, our results can be interpreted as schematic depicted in Fig. 7. SSCs are controlled by intrinsic molecular pathways that can be activated by extrinsic signals such as growth factors. FOXC2 is a transcription factor that plays a critical role in the survival and fate decision of SSCs. FOXC2 is predominately expressed in A_s and A_pr spermatogonia to safeguard the delicate balance between actual and potential stem cells. When FOXC2 expression level is high, SSCs possess the stem cell properties and self-renew to maintain their population. When FOXC2 is not expressed or the expression level is very low, SSCs differentiate to produce daughter cells that go through several steps of mitosis and meiosis and eventually become spermatozoa. GDNF and RA, locally produced by Sertoli cells of testis, act in opposite ways to regulate FOXC2 expression and SSC property in postnatal germ cells. GDNF upregulates FOXC2 expression and promotes SSCs to self-renew, while RA downregulates FOXC2 expression and induces SSCs to differentiate.

FIG. 7.

Model of FOXC2 function in SSC fate decision. When FOXC2 expression level is high, SSCs act as actual stem cells and self-renew to maintain their population. When FOXC2 is not expressed or the expression level is very low, SSCs act as potential stem cells and differentiate to produce daughter cells in normal steady-state spermatogenesis. GDNF and RA locally produced by testis Sertoli cells act in opposite ways to regulate FOXC2 expression and SSC property in postnatal germ cells. GDNF upregulates FOXC2 expression and promotes SSCs to self-renew, while RA downregulates FOXC2 expression and induces SSCs to differentiate. Color images available online at www.liebertpub.com/scd

Footnotes

Acknowledgments

This work was supported by the National Basic Research Program of China (2014CB138505) and the Natural Science Foundation of China (31172287 and 31372393).

Author Disclosure Statement

The authors indicate no competing financial interests exist.

References

de Rooij

. (2001). Proliferation and differentiation of spermatogonial stem cells. Reproduction, 121:347–354.

Costoya

, Hobbs

, Barna

, Cattoretti

, Manova

, Sukhwani

, Orwig

, Wolgemuth

and Pandolfi

. (2004). Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet, 36:653–659.

de Rooij

and Russell

. (2000). All you wanted to know about spermatogonia but were afraid to ask. J Androl, 21:776–798.

Tegelenbosch

and de Rooij

. (1993). A quantitative study of spermatogonial multiplication and stem cell renewal in the C3H/101 F1 hybrid mouse. Mutat Res, 290:193–200.

Brinster

and Zimmermann

. (1994). Spermatogenesis following male germ-cell transplantation. Proc Natl Acad Sci U S A, 91:11298–11302.

Brinster

and Avarbock

. (1994). Germline transmission of donor haplotype following spermatogonial transplantation. Proc Natl Acad Sci U S A, 91:11303–11307.

Kanatsu-Shinohara

, Ogonuki

, Inoue

, Miki

, Ogura

, Toyokuni

and Shinohara

. (2003). Long-term proliferation in culture and germline transmission of mouse male germline stem cells. Biol Reprod, 69:612–616.

Huckins

. (1971). The spermatogonial stem cell population in adult rats. I. Their morphology, proliferation and maturation. Anat Rec, 169:533–557.

Oakberg

. (1971). Spermatogonial stem-cell renewal in the mouse. Anat Rec, 169:515–531.

10.

Suzuki

, Sada

, Yoshida

and Saga

. (2009). The heterogeneity of spermatogonia is revealed by their topology and expression of marker proteins including the germ cell-specific proteins Nanos2 and Nanos3. Dev Biol, 336:222–231.

11.

Nakagawa

, Sharma

, Nabeshima

, Braun

and Yoshida

. (2010). Functional hierarchy and reversibility within the murine spermatogenic stem cell compartment. Science, 328:62–67.

12.

Sada

, Suzuki

and Saga

. (2009). The RNA-binding protein NANOS2 is required to maintain murine spermatogonial stem cells. Science, 325:1394–1398.

13.

Nakagawa

, Nabeshima

and Yoshida

. (2007). Functional identification of the actual and potential stem cell compartments in mouse spermatogenesis. Dev Cell, 12:195–206.

14.

Yoshida

, Nabeshima

and Nakagawa

. (2007). Stem cell heterogeneity: actual and potential stem cell compartments in mouse spermatogenesis. Ann N Y Acad Sci, 1120:47–58.

15.

Hara

, Nakagawa

, Enomoto

, Suzuki

, Yamamoto

, Simons

and Yoshida

. (2014). Mouse spermatogenic stem cells continually interconvert between equipotent singly isolated and syncytial states. Cell Stem Cell, 14:658–672.

16.

Birkenkamp

and Coffer

. (2003). Regulation of cell survival and proliferation by the FOXO (Forkhead box, class O) subfamily of Forkhead transcription factors. Biochem Soc Trans, 31:292–297.

17.

Calnan

and Brunet

. (2008). The FoxO code. Oncogene, 27:2276–2288.

18.

Obsil

and Obsilova

. (2008). Structure/function relationships underlying regulation of FOXO transcription factors. Oncogene, 27:2263–2275.

19.

Hacker

, Grossniklaus

, Gehring

and Jackle

. (1992). Developmentally regulated Drosophila gene family encoding the fork head domain. Proc Natl Acad Sci U S A, 89:8754–8758.

20.

Kaufmann

and Knochel

. (1996). Five years on the wings of fork head. Mech Dev, 57:3–20.

21.

Clark

, Halay

, Lai

and Burley

. (1993). Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature, 364:412–420.

22.

Miura

, Wanaka

, Tohyama

and Tanaka

. (1993). MFH-1, a new member of the fork head domain family, is expressed in developing mesenchyme. FEBS Lett, 326:171–176.

23.

Kume

, Jiang

, Topczewska

and Hogan

. (2001). The murine winged helix transcription factors, Foxc1 and Foxc2, are both required for cardiovascular development and somitogenesis. Genes Dev, 15:2470–2482.

24.

Kume

, Deng

and Hogan

. (2000). Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required for the early organogenesis of the kidney and urinary tract. Development, 127:1387–1395.

25.

Davis

, Moldes

and Farmer

. (2004). The forkhead transcription factor FoxC2 inhibits white adipocyte differentiation. J Biol Chem, 279:42453–42461.

26.

Hollier

, Tinnirello

, Werden

, Evans

, Taube

, Sarkar

, Sphyris

, Shariati

, Kumar

, et al. (2013). FOXC2 expression links epithelial-mesenchymal transition and stem cell properties in breast cancer. Cancer Res, 73:1981–1992.

27.

Goertz

, Wu

, Gallardo

, Hamra

and Castrillon

. (2011). Foxo1 is required in mouse spermatogonial stem cells for their maintenance and the initiation of spermatogenesis. J Clin Invest, 121:3456–3466.

28.

Kokkinaki

, Lee

, He

, Jiang

, Golestaneh

, Hofmann

, Chan

and Dym

. (2009). The molecular signature of spermatogonial stem/progenitor cells in the 6-day-old mouse testis. Biol Reprod, 80:707–717.

29.

Kubota

and Brinster

. (2008). Culture of rodent spermatogonial stem cells, male germline stem cells of the postnatal animal. Methods Cell Biol, 86:59–84.

30.

Oatley

, Kaucher

, Avarbock

and Brinster

. (2010). Regulation of mouse spermatogonial stem cell differentiation by STAT3 signaling. Biol Reprod, 83:427–433.

31.

Stewart

, Dykxhoorn

, Palliser

, Mizuno

, Yu

, An

, Sabatini

, Chen

, Hahn

, et al. (2003). Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA, 9:493–501.

32.

Sarbassov

, Guertin

, Ali

and Sabatini

. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 307:1098–1101.

33.

Wang

, Liang

, Jiang

, Qin

and Yang

. (2008). Promoter-dependent EGFP expression during embryonic stem cell propagation and differentiation. Stem Cells Dev, 17:279–289.

34.

Ogawa

, Arechaga

, Avarbock

and Brinster

. (1997). Transplantation of testis germinal cells into mouse seminiferous tubules. Int J Dev Biol, 41:111–122.

35.

Okabe

, Ikawa

, Kominami

, Nakanishi

and Nishimune

. (1997). 'Green mice' as a source of ubiquitous green cells. FEBS Lett, 407:313–319.

36.

Kanatsu-Shinohara

, Ogonuki

, Inoue

, Ogura

, Toyokuni

, Honjo

and Shinohara

. (2003). Allogeneic offspring produced by male germ line stem cell transplantation into infertile mouse testis. Biol Reprod, 68:167–173.

37.

Nagano

, Avarbock

and Brinster

. (1999). Pattern and kinetics of mouse donor spermatogonial stem cell colonization in recipient testes. Biol Reprod, 60:1429–1436.

38.

Kanatsu-Shinohara

, Onoyama

, Nakayama

and Shinohara

. (2014). Skp1-Cullin-F-box (SCF)-type ubiquitin ligase FBXW7 negatively regulates spermatogonial stem cell self-renewal. Proc Natl Acad Sci U S A, 111:8826–8831.

39.

Wang

, Wang

, Ma

, Lin

, Zhang

, Li

, Wu

, Zheng

, Feng

, et al. (2016). Retinoic acid is sufficient for the in vitro induction of mouse spermatocytes. Stem Cell Rep, 7:80–94.

40.

Lee

, Kanatsu-Shinohara

, Inoue

, Ogonuki

, Miki

, Toyokuni

, Kimura

, Nakano

, Ogura

and Shinohara

. (2007). Akt mediates self-renewal division of mouse spermatogonial stem cells. Development, 134:1853–1859.

41.

Endo

, Romer

, Anderson

, Baltus

, de Rooij

and Page

. (2015). Periodic retinoic acid-STRA8 signaling intersects with periodic germ-cell competencies to regulate spermatogenesis. Proc Natl Acad Sci U S A, 112:E2347–E2356.

42.

Wang

, Wang

, Wu

and Han

. (2015). IGF-1R signaling is essential for the proliferation of cultured mouse spermatogonial stem cells by promoting the G(2)/M progression of the cell cycle. Stem Cells Dev, 24:471–483.

43.

, Goodyear

, Tobias

, Avarbock

and Brinster

. (2011). Spermatogonial stem cell self-renewal requires ETV5-mediated downstream activation of Brachyury in mice. Biol Reprod, 85:1114–1123.

44.

Jain

, Naughton

, Yang

, Strickland

, Vij

, Encinas

, Golden

, Gupta

, Heuckeroth

, Johnson

Jr. and Milbrandt

. (2004). Mice expressing a dominant-negative Ret mutation phenocopy human Hirschsprung disease and delineate a direct role of Ret in spermatogenesis. Development, 131:5503–5513.

45.

Naughton

, Jain

, Strickland

, Gupta

and Milbrandt

. (2006). Glial cell-line derived neurotrophic factor-mediated RET signaling regulates spermatogonial stem cell fate. Biol Reprod, 74:314–321.

46.

Oatley

, Avarbock

, Telaranta

, Fearon

and Brinster

. (2006). Identifying genes important for spermatogonial stem cell self-renewal and survival. Proc Natl Acad Sci U S A, 103:9524–9529.

47.

Atchison

and Means

. (2003). Spermatogonial depletion in adult Pin1-deficient mice. Biol Reprod, 69:1989–1997.

48.

Dann

, Alvarado

, Molyneux

, Denard

, Garbers

and Porteus

. (2008). Spermatogonial stem cell self-renewal requires OCT4, a factor downregulated during retinoic acid-induced differentiation. Stem Cells, 26:2928–2937.

49.

Takubo

, Ohmura

, Azuma

, Nagamatsu

, Yamada

, Arai

, Hirao

and Suda

. (2008). Stem cell defects in ATM-deficient undifferentiated spermatogonia through DNA damage-induced cell-cycle arrest. Cell Stem Cell, 2:170–182.

50.

Oatley

, Oatley

, Avarbock

, Tobias

and Brinster

. (2009). Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal. Development, 136:1191–1199.

51.

Lee

, Kanatsu-Shinohara

, Morimoto

, Kazuki

, Takashima

, Oshimura

, Toyokuni

and Shinohara

. (2009). Genetic reconstruction of mouse spermatogonial stem cell self-renewal in vitro by Ras-cyclin D2 activation. Cell Stem Cell, 5:76–86.

52.

Kanatsu-Shinohara

, Takehashi

, Takashima

, Lee

, Morimoto

, Chuma

, Raducanu

, Nakatsuji

, Fassler

and Shinohara

. (2008). Homing of mouse spermatogonial stem cells to germline niche depends on beta1-integrin. Cell Stem Cell, 3:533–542.

53.

Kanatsu-Shinohara

, Inoue

, Takashima

, Takehashi

, Ogonuki

, Morimoto

, Nagasawa

, Ogura

and Shinohara

. (2012). Reconstitution of mouse spermatogonial stem cell niches in culture. Cell Stem Cell, 11:567–578.

54.

Takashima

, Kanatsu-Shinohara

, Tanaka

, Takehashi

, Morimoto

and Shinohara

. (2011). Rac mediates mouse spermatogonial stem cell homing to germline niches by regulating transmigration through the blood-testis barrier. Cell Stem Cell, 9:463–475.

55.

Kaucher

, Oatley

and Oatley

. (2012). NEUROG3 is a critical downstream effector for STAT3-regulated differentiation of mammalian stem and progenitor spermatogonia. Biol Reprod, 86:164, 1–11.

56.

Sada

, Hasegawa

, Pin

and Saga

. (2012). NANOS2 acts downstream of glial cell line-derived neurotrophic factor signaling to suppress differentiation of spermatogonial stem cells. Stem Cells, 30:280–291.

57.

Lolicato

, Marino

, Paronetto

, Pellegrini

, Dolci

, Geremia

and Grimaldi

. (2008). Potential role of Nanos3 in maintaining the undifferentiated spermatogonia population. Dev Biol, 313:725–738.

58.

Sun

, Xu

, Zhao

and Degui Chen

. (2015). Id4 marks spermatogonial stem cells in the mouse testis. Sci Rep, 5:17594.

59.

Schrans-Stassen

, Saunders

, Cooke

and de Rooij

. (2001). Nature of the spermatogenic arrest in Dazl -/- mice. Biol Reprod, 65:771–776.

60.

Pittman

, Cobb

, Schimenti

, Wilson

, Cooper

, Brignull

, Handel

and Schimenti

. (1998). Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmc1, a germline-specific RecA homolog. Mol Cell, 1:697–705.

61.

Yuan

, Liu

, Zhao

, Brundell

, Daneholt

and Hoog

. (2000). The murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility. Mol Cell, 5:73–83.

62.

Ballow

, Meistrich

, Matzuk

and Rajkovic

. (2006). Sohlh1 is essential for spermatogonial differentiation. Dev Biol, 294:161–167.

63.

Hao

, Yamamoto

, Richardson

, Chapman

, Denard

, Hammer

, Zhao

and Hamra

. (2008). Sohlh2 knockout mice are male-sterile because of degeneration of differentiating type A spermatogonia. Stem Cells, 26:1587–1597.

64.

Raverot

, Weiss

, Park

, Hurley

and Jameson

. (2005). Sox3 expression in undifferentiated spermatogonia is required for the progression of spermatogenesis. Dev Biol, 283:215–225.

65.

Gely-Pernot

, Raverdeau

, Celebi

, Dennefeld

, Feret

, Klopfenstein

, Yoshida

, Ghyselinck

and Mark

. (2012). Spermatogonia differentiation requires retinoic acid receptor gamma. Endocrinology, 153:438–449.

66.

Matson

, Murphy

, Griswold

, Yoshida

, Bardwell

and Zarkower

. (2010). The mammalian doublesex homolog DMRT1 is a transcriptional gatekeeper that controls the mitosis versus meiosis decision in male germ cells. Dev Cell, 19:612–624.

67.

Hobbs

, Fagoonee

, Papa

, Webster

, Altruda

, Nishinakamura

, Chai

and Pandolfi

. (2012). Functional antagonism between Sall4 and Plzf defines germline progenitors. Cell Stem Cell, 10:284–298.

68.

Yoshinaga

, Nishikawa

, Ogawa

, Hayashi

, Kunisada

, Fujimoto

and Nishikawa

. (1991). Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development, 113:689–699.

69.

Kubota

, Avarbock

and Brinster

. (2004). Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A, 101:16489–16494.

70.

Barroca

, Lassalle

, Coureuil

, Louis

, Le Page

, Testart

, Allemand

, Riou

and Fouchet

. (2009). Mouse differentiating spermatogonia can generate germinal stem cells in vivo. Nat Cell Biol, 11:190–196.

71.

, Oatley

, Kaucher

, Avarbock

and Brinster

. (2010). The POU domain transcription factor POU3F1 is an important intrinsic regulator of GDNF-induced survival and self-renewal of mouse spermatogonial stem cells. Biol Reprod, 82:1103–1111.

72.

Meng

, Lindahl

, Hyvonen

, Parvinen

, de Rooij

, Hess

, Raatikainen-Ahokas

, Sainio

, Rauvala

, et al. (2000). Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science, 287:1489–1493.

73.

Braydich-Stolle

, Kostereva

, Dym

and Hofmann

. (2007). Role of Src family kinases and N-Myc in spermatogonial stem cell proliferation. Dev Biol, 304:34–45.

74.

, Jiang

, Kokkinaki

, Golestaneh

, Hofmann

and Dym

. (2008). GDNF upregulates c-fos transcription via the Ras/ERK1/2 pathway to promote mouse spermatogonial stem cell proliferation. Stem Cells, 26:266–278.

75.

Oatley

, Avarbock

and Brinster

. (2007). Glial cell line-derived neurotrophic factor regulation of genes essential for self-renewal of mouse spermatogonial stem cells is dependent on src family kinase signaling. J Biol Chem, 282:25842–25851.

76.

Raverdeau

, Gely-Pernot

, Feret

, Dennefeld

, Benoit

, Davidson

, Chambon

, Mark

and Ghyselinck

. (2012). Retinoic acid induces Sertoli cell paracrine signals for spermatogonia differentiation but cell autonomously drives spermatocyte meiosis. Proc Natl Acad Sci U S A, 109:16582–16587.

77.

Vanpelt

AMM

and Derooij

. (1990). The Origin of the Synchronization of the Seminiferous Epithelium in Vitamin-a-Deficient Rats after Vitamin-a Replacement. Biol Reprod, 42:677–682.

78.

van Pelt

and de Rooij

. (1990). Synchronization of the seminiferous epithelium after vitamin A replacement in vitamin A-deficient mice. Biol Reprod, 43:363–367.

79.

Vanpelt

AMM

, Vandisselemiliani

FMF

, Gaemers

, Vanderburg

MJM

, Tanke

and Derooij

. (1995). Characteristics of a-spermatogonia and preleptotene spermatocytes in the vitamin-a-deficient rat testis. Biol Reprod, 53:570–578.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.07 MB

0.21 MB

0.27 MB

0.15 MB

0.31 MB

0.23 MB

0.02 MB

The Forkhead Transcription Factor FOXC2 Is Required for Maintaining Murine Spermatogonial Stem Cells

Abstract

Introduction

Materials and Methods

Animals

Immunofluorescence

Whole-mount immunofluorescence

Cell culture

Lentivirus infection

Transplantation

Reverse transcription and real-time quantitative PCR

Western blot

Extrinsic stimuli treatment

Statistical analysis

Results

The expression of FOXC2 in testis is restricted to GFRα1-positive spermatogonia and is mainly in As and Apr spermatogonia

Reduction of the Foxc2 transcript level affects SSC clump maintenance in vitro and decreases SSC colonization

Gene expression changes following knock-down of Foxc2

FOXC2 is upregulated by GDNF and downregulated by RA

Discussion

Footnotes

Acknowledgments

Author Disclosure Statement

References

Supplementary Material

The expression of FOXC2 in testis is restricted to GFRα1-positive spermatogonia and is mainly in A_s and A_pr spermatogonia