Calcium,Sodium,and Transient Receptor Potential Channel Expression in Human Fetal Midbrain-Derived Neural Progenitor Cells

Abstract

Voltage-gated sodium and calcium channels as well as transient receptor potential (TRP) channels are expressed during the differentiation of human neural progenitor cells (hNPCs) and are likely to be involved in regulating neurogenesis. However, the molecular composition of these ion channels in proliferating and differentiating hNPCs is largely unknown. In this study, we investigated fetal mesencephalic hNPCs in respect to their sodium, calcium, and TRP channel subunit expression and function. Quantitative real-time polymerase chain reaction indicated a significant upregulation of voltage-gated sodium and calcium channel subunits in hNPCs after differentiation for 3 weeks in vitro. In contrast, the TRP channel expression did not increase significantly during hNPC maturation. Intracellular Ca²⁺ measurements showed the marked reduction of KCl-induced Ca²⁺ transients through inhibition of voltage-gated Ca²⁺ channels by verapamil and mibefradil in differentiated hNPCs. Application of TRP channel agonists induced intracellular Ca²⁺ peaks already in proliferating hNPCs without affecting their cell division. The coincubation of hNPCs with TRP channel agonists pregnenolone sulfate or RN1747 did not have any significant effect on their proliferation and differentiation. These data indicate that hNPCs derived from fetal midbrain tissue acquire essential voltage-gated sodium and calcium channel properties during neuronal maturation in vitro. An early role of TRP channels in neurogenesis which may be important for regenerative clinical applications or cellular models could not be elucidated using hNPCs.

Introduction

Previous findings demonstrate that electrical activity is not only important at later stages of neurogenesis but also in early neuronal development. Proliferation, migration, and differentiation of neural stem cells all depend to various extents on forms of electrical activity, both in the prenatal and adult central nervous system (CNS) [1,2]. Voltage- and ligand-gated ion channels maintain the homeostasis of the most abundant ions in the cell and play key roles in regulating the physiological function of the nervous system and processing of neuronal signals [3 –5].

Besides the generation of action potentials in neurons, in which the inward current is conducted by voltage-dependent sodium channels, at early stages of neural development (before synapse formation), voltage-gated calcium channels are also of particular importance. Proliferation, migration, ion channel expression, neurotransmitter specification, axon pathfinding, and dendrite outgrowth of human neural progenitor cells (hNPCs) are all, in part, regulated by the expanded repertoire of excitability. Further critical ion channel species are the transient receptor potential (TRP) channels that for example are involved in spontaneous Ca²⁺ activity during proliferation of hNPCs and generation of growth cone calcium transients [6 –12].

Nine isoforms of the most relevant voltage-gated sodium channel alpha subunits (Nav), Nav1.1 to Nav 1.9, have been identified so far, which differ in their function and tissue presence, for example, action potential forwarding in the CNS or nociception in the peripheral nervous system [13 –15]. In contrast to Nav, voltage-gated calcium channels (Cav) can be detected predominantly in the CNS [16 –18]. To date, the three main families Cav1 (L-type), Cav2 (P/Q-, N-, R-type), and Cav3 (T-type) containing primary alpha1 subunits as well as several auxiliary subunits have been identified [19].

TRP channels are a receptor family with 28 members, spread over several subfamilies: TRPA (ankyrin), TRPC (canonical), TRPM (melastatin), TRPML (mucolipin), TRPN (no mechanoreceptor potential), TRPP (polycystin), and TRPV (vanilloid) [20 –23]. TRP channels have a relatively low selectivity for monovalent and divalent cations and are permeable to Ca²⁺ in addition to Na⁺ [24]. TRPC channels have been reported to act as essential cellular sensors in multiple processes during neuronal development, including neural stem cell proliferation and differentiation, neuronal survival, neurite outgrowth and axon path finding, and synaptogenesis [10,25].

Even though ion channel properties of hNPC-derived neurons generated in vitro are of high relevance for preclinical and clinical studies, these investigations are rare. Midbrain-derived hNPCs have the capacity to self-renew and to differentiate into functional (dopaminergic) neurons [27 –31]. Clinical trials will determine if fetal cell-based therapy is a promising treatment for Parkinson's disease (Neural transplantation in the treatment of patients with Parkinson's disease, www.transeuro.org.uk). In this study, we analyzed the expression profile and functionality of voltage-gated calcium and sodium channels as well as TRP channels in undifferentiated and differentiated hNPCs to elucidate their role during neurogenesis.

Materials and Methods

Cultivation and differentiation of human fetal mesencephalic neural progenitor cells

hNPCs were isolated from aborted fetal midbrain tissue as described previously [26 –30]. The hNPCs were derived from CNS tissue of aborted human fetuses (gestational week 10–16) with mother's consent. Experiments using hNPCs were approved by the Ethics Committees of Hannover Medical School (No. 776) and the University of Leipzig (Reg. No. 066/2002), Germany and are in accordance with all state and federal guidelines.

For subsequent experiments up to six hNPC lines from four different donors were used as indicated. Three independent experiments were mostly performed for each cell line used as stated in the respective figure legends. The cells were cultivated under reduced oxygen (3%) on polyornithine/fibronectin-coated (Sigma-Aldrich) culture flasks in proliferation medium composed of Dulbecco's modified Eagle's medium (DMEM)/Ham's F12, 1xN2, 1xB27, 1% penicillin/streptomycin (all from Life Technologies), 20 ng/mL epidermal growth factor (EGF), and 20 ng/mL fibroblast growth factor 2 (FGF2; both from Peprotech). hNPCs were passaged after reaching confluency using accutase (Life Technologies).

For differentiation, the medium of confluent cultures was replaced by Neurobasal medium containing 2% B27, gentamicin, l-alanyl-l-glutamine, 100 pg/mL interleukin-1β, and 5 μM forskolin (Sigma-Aldrich). The medium was changed every 3 days for a total of 3 weeks, because hNPCs develop functional neuronal properties after this maturation time [27 –29].

RNA isolation and quantitative real-time polymerase chain reaction

Total RNA was extracted from proliferating as well as differentiated hNPCs using the RNeasy Mini Kit (Qiagen) and reversely transcribed using oligo-dT primer and Superscript II reverse transcriptase (both from Life Technologies) according to manufacturers' instructions. Quantitative real-time polymerase chain reaction (PCR) experiments were performed as previously described [31].

Complementary DNA (cDNA) from 50 ng total RNA, 1.75 μM forward and reverse primer, and Power SYBR-Green PCR Master Mix (Life Technologies) were used in a StepOnePlus instrument (Applied Biosystems, Darmstadt, Germany) under the following amplification conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The specificity of the PCR products was ensured by melting curve analysis. Equal PCR efficiency of all primer pairs was validated by serial cDNA dilution. Please refer to Stanslowsky et al. [32] for primer sequences of voltage-gated sodium and calcium channel subunits and Table 1 for primer details of TRP channel subunits. Target gene expressions were normalized to the endogenous references β2-microglobulin [Ct (target) − Ct (reference) = ΔCt] and are given as means ± standard errors of the mean (SEM).

Table 1.

Primer Pairs Used for Quantitative Real-Time Polymerase Chain Reaction

Target	Primer sequence 5′→3′
TRPC1	F: TCTACCCAAGCCCCATGCAGTTG, R: AGACGAAACCTGGAATGCCGGAG
TRPC3	F: GTCCATGGAGGGAAGCCCAT, R: TGGTGCCGCGGTCATTGAACA
TRPC4	F: TTGTTCCTGCTGCTGCTTGCCTC, R: TATGAAGCCCAGGACCCACGGTAAT
TRPC5	F: TGGTGGGGCTCGGGCCAAAT, R: GGCACCACTGGACCTTGGCA
TRPC6	F: CGACAGCAGACAATGGCGGTCA, R: TTCCCCATCTTGCTGCATGGAGC
TRPM2	F: GAAAGCTGGCTCGGAGCAGGA, R: TTGCTGCGCCGGAGATTGGA
TRPM3	F: TGCCGTGGCTGCCAAACACC, R: GAGTTCTTGCGCATGCGGAGCC
TRPM4	F: GATGCGCCTGGCCCAACTCT, R: GGCTTTGGTGCCTGCGCTGT
TRPM7	F: GCCCCGTGAGGAGAATGTCCC, R: AGGCATCTGTGAGGGTCCTTGGA
TRPML1	F: TCTGCTGCTGCGGAAGGGAC, R: GCAGTCCAGGGCCTACGGTC
TRPP2/PKD2	F: AGCTGGGGAGTGGAGCCTGG, R: GAGAGGCCCCGTGCTGGAGA
TRPV4	F: TCGAACCCGGACGAGGTGGT, R: CAGTCCCTAGAGCGGGGCGT
TRPV5	F: CCCATCTCTTGCTCAGTTGCTGTCA, R: CCGGGCCCTTCTGCCTTAGGT
TRPV6	F: TGGTTCCTGCGGGTGGAAGACAG, R: AAATCCTCAGAGCCCCGGGTGTG

F, forward; R, reverse.

Calcium imaging

Measurement of intracellular calcium transients was carried out as described previously [31]. In brief, proliferating or differentiated hNPCs were incubated with Fura 2-AM (Sigma-Aldrich) for 30 min at 37°C. Cytosolic Ca²⁺ changes upon application of 50 mM KCl were imaged by exciting Fura 2-AM at 340 and 380 nm and monitoring its emission at 510 nm with the Life Acquisition Software (T.I.L.L. Photonics) coupled to an upright microscope (Axioskop 2 FS plus; Zeiss).

To antagonize the KCl-induced Ca²⁺ influx through voltage-gated calcium channels, the KCl solution was supplemented with the nonselective blockers mibefradil (3 μM) or verapamil (100 μM). TRP channel-mediated Ca²⁺ flux was initiated by application of 5 μM pregnenolone sulfate (TRPM3 agonist) or 1 μM RN1747 (TRPV4-specific agonist [33]). After background subtraction of individual cells, the 340/380 nm excitation ratio for Fura 2-AM was calculated, which increases as a function of the cytosolic free Ca²⁺ ([Ca²⁺]i).

Immunofluorescence

Immunofluorescent stainings were conducted following standard protocols [31]. The applied primary antibodies were mouse anti-Nestin IgG1 (1:500; R&D), rabbit anti-Sox1 IgG (1:500; Millipore), mouse anti-beta III tubulin IgG2 (Tuj1, 1:500; Millipore), rabbit anti-beta III tubulin IgG (1:1,000; Abcam), mouse anti-tyrosine hydroxylase (TH) IgG1 (1:500; Millipore), rabbit polyclonal anti-GABA (1:1,000; Sigma), and rabbit anti-Ki67 IgG (1:1,000; Abcam). Appropriate Alexa Fluor 488 or 555 labeled secondary antibodies (1:500; Life Technologies) were incubated 1 h at room temperature and nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 10 mg/mL; Life Technologies). Images were taken with an Olympus DP72 camera under an Olympus BX61 fluorescent microscope using the image-analysis software Cell^F (Olympus).

Coincubation of hNPCs with TRP channel agonists

To investigate the influence of TRP channel agonists on proliferating hNPCs, the undifferentiated cultures were treated with 5 μM pregnenolone sulfate (TRPM3 agonist) or 1 μM RN1747 (TRPV4-specific agonist [33]) for 2 weeks. During differentiation, we treated hNPCs with 5 μM pregnenolone sulfate or 1 μM RN1747 for 3 weeks to analyze their impact on (dopaminergic) neurogenesis.

Appropriate controls without drug treatments were cultured in parallel. The given drug concentrations were chosen because they had no effects on cell viability and still gave a signal in calcium imaging experiments. The drugs were renewed with every media change. The number of viable and dead cells was determined by trypan blue staining during proliferation. The protein content of expanding hNPCs was analyzed using the Pierce^™ BCA Protein Assay Kit (Thermo Fisher) according to manufacturer's instructions.

Statistics

Data were analyzed with GraphPad Prism 5 (GraphPad Software). Gene expressions were statistically compared by multiple t-tests (single subunits in undifferentiated vs. differentiated cells) or one-way analysis of variance (ANOVA) with Dunnett's multiple comparison test (all subunits within one group). Calcium transients were statistically analyzed by Wilcoxon test or unpaired t-test as indicated. All data are presented as means ± SEM, and the significance level was set as P < 0.05.

Results

Undifferentiated proliferating as well as differentiated human neural progenitor cells (hNPCs) were investigated by immunofluorescence. Nearly all the proliferating hNPCs stained positive for the neural precursor marker nestin and Sox1. A minor proportion of 8% ± 4% also expressed the early neuronal marker βIII-tubulin (Fig. 1A). hNPCs that had been differentiated for 3 weeks in vitro under standard conditions showed βIII-tubulin expression in 96% ± 3%, whereas only few cells (1.9% ± 0.2%) were positive for the dopaminergic marker TH (Fig. 1B).

FIG. 1.

Differentiation of human fetal midbrain-derived neural progenitor cells (hNPCs). (A) Undifferentiated hNPCs stained positive for the neural progenitor cell marker nestin and Sox1. Approximately 8% were also positive for the early neural marker Tuj1. (B) After 3 weeks of differentiation, 96% of the cells expressed Tuj1 and ∼2% stained positive for TH as shown by immunofluorescence. Note that the immunofluorescence image of differentiated hNPCs was taken from the periphery of the cell culture dish to better visualize single neurons for quantification. Scale bars represent 100 μm. hNPCs, human neural progenitor cells; TH, tyrosine hydroxylase. Color images available online at www.liebertpub.com/scd

For the functionality of neuronal cells, among others, the expression of voltage-gated sodium and calcium channels is a prerequisite. Therefore, we quantified the expression of sodium and calcium channel subunits in multiple hNPC lines (n = 2–4) by real-time PCR after 3 weeks of differentiation in vitro and compared it to the expression in undifferentiated proliferating hNPCs. Significantly higher 2^−ΔCt values in differentiated hNPCs, for nearly all main alpha-subunits and auxiliary subunits investigated, supported the improved maturation status of these hNPCs (Fig. 2A, B, P < 0.05, t-test). In differentiated hNPCs, a predominant expression of single subunits compared to others could not be detected (one-way ANOVA with Dunnett's posttest).

FIG. 2.

Sodium and calcium channel expression in undifferentiated proliferating hNPCs and after 3 weeks of differentiation. (A, B) Sodium and calcium channel subunits were significantly upregulated in differentiated hNPCs as shown by quantitative real-time polymerase chain reaction (*P < 0.05, **P < 0.01, ***P < 0.001, t-test). Data of —two to four hNPC lines (three independent experiments for each cell line) are presented as means ± SEM. (C) Ca²⁺ transients through voltage-gated Ca²⁺ channels were induced by KCl (50 mM). Mibefradil (MIB, 3 μM) and verapamil (VER, 100 μM), broad-spectrum blockers of voltage-gated Ca²⁺ channels, suppressed [Ca²⁺]_i increases evoked by bath application of KCl. (D) Summary of [Ca²⁺]_i amplitudes and the degree of blockade (three independent experiments, n = total cell number analyzed, means ± SEM; **P < 0.01, ***P < 0.001, Wilcoxon test or unpaired t-test). SEM, standard error of the mean.

Next, we determined the functionality of voltage-gated calcium channels by calcium imaging experiments. In differentiated hNPCs, the application of the depolarizing agent KCl (50 mM) induced an increase of intracellular Ca²⁺ of 155 ± 19 nM (Fig. 2C, D). The KCl-mediated influx was significantly antagonized by simultaneous application of the unspecific voltage-dependent calcium channel blockers mibefradil (3 μM) or verapamil (100 μM), the Ca²⁺ amplitudes with blockers were only 43 ± 7 nM and 43 ± 10 nM, respectively (P < 0.001, Wilcoxon test). The degree of blockade with verapamil by 77% ± 2% was significantly stronger compared with mibefradil (67% ± 2%) (Fig. 2D, P < 0.01, t-test).

Besides voltage-gated sodium and calcium channels, TRP channels are considered to play a crucial role during neuronal development as well, in part, showing a species-specific activation [34]. Interestingly, real-time PCR experiments revealed no significant differences in subunit expression between proliferating and differentiated hNPC lines (Fig. 3A, n = 5, t-test). Among TRPM channel subunits the expression of TRPM3 was significantly elevated compared with TRPM2 in our proliferating hNPCs (P < 0.05, one-way ANOVA).

FIG. 3.

TRP channel expression in proliferating hNPCs and after 3 weeks of differentiation. (A) The expression of TRP channel subunits did not significantly differ between differentiated and undifferentiated hNPCs (n = 5 cell lines, three independent experiments for each cell line, P > 0.05, t-test). TRPM3 was significantly upregulated compared to TRPM2 in proliferating cells (*P < 0.05, one-way ANOVA). (B) Transient cytosolic Ca²⁺ changes were induced by application of PS (5 μM) and RN1747 (1 μM). (C) A similar fraction of hNPCs responded to the application of pregnenolone sulfate or RN1747. The Ca²⁺ amplitudes upon application of pregnenolone sulfate were significantly lower compared to RN1747 that mainly activates TRPV4 (***P < 0.001, t-test). All data represent means ± SEM (n = total cell number analyzed, three independent experiments). ANOVA, analysis of variance; PS, pregnenolone sulfate; TRP, transient receptor potential. Color images available online at www.liebertpub.com/scd

Ca²⁺ transients through TRP channels were monitored in our undifferentiated proliferating hNPCs, since they expressed TRP channel subunits to a similar extent as differentiated cells. Upon application of pregnenolone sulfate, among others, an activator of TRPM3 channels and the selective TRPV4 agonist RN1747 [33], the intracellular calcium concentration increased (Fig. 3B). The percentages of cells showing Ca²⁺ responses caused by application of different agonists were ∼90% (Fig. 3C) (n = 210, t-test). The mean amplitudes represented by the ratio of fluorescence emission at 340 and 380 nm from fura-2-loaded cells were significantly lower after application of pregnenolone sulfate (0.054 ± 0.001) compared to RN1747 (0.074 ± 0.001, P < 0.001, t-test).

Each measurement was terminated by application of the depolarizing agent KCl (50 mM). The lack of KCl-mediated Ca²⁺ influx supported the notion that none of the proliferating cells functionally expressed voltage-gated sodium or calcium channels (data not shown). Furthermore, ligand-gated ion channels such as NMDA receptors, which could be modulated by pregnenolone sulfate, are not expressed in undifferentiated hNPCs as reported previously [28].

To analyze the effects of TRP channel agonist treatment during proliferation of hNPCs, ∼100,000 cells were plated and coincubated for 2 weeks with the lowest concentrations of pregnenolone sulfate (5 μM) and RN1747 (1 μM) that still evoked signals in hNPCs during Ca²⁺ imaging experiments. Coincubation, no matter which agonist was used, did not reveal significant changes in proliferation rates, number of living cells or protein content compared with untreated controls (Fig. 4A–C).

FIG. 4.

Coincubation of proliferating hNPCs with pregnenolone sulfate or RN1747. (A) The percentage of cells expressing the proliferation marker Ki67 was similar under all conditions tested. (B) Cell numbers after 2 weeks of proliferation increased threefold with comparable percentages of dead cells (n = 4 cell lines, P > 0.05, one-way ANOVA). (C) The protein content did not significantly differ as well (n = 3 cell lines, P > 0.05, one-way ANOVA). Scale bar represents 100 μm. Color images available online at www.liebertpub.com/scd

The percentage of cells expressing the proliferation marker Ki67 was around 40% under all conditions tested. The number of cells after 2 weeks of proliferation with or without TRP channel agonists increased threefold. The amount of dead cells (∼16%, n = 3) was not significantly different. Thus, the treatment of undifferentiated fetal mesencephalic hNPCs for 2 weeks during expansion with TRP channel agonists mainly activating TRPM3 (pregnenolone sulfate) and TRPV4 (RN1747) did not enhance cell proliferation or survival rates.

The coincubation of differentiating hNPCs with pregnenolone sulfate (5 μM) or RN1747 (1 μM) for 3 weeks did not have any significant effect on the number of TH- (∼1%/Tuj1) and Tuj1-immunoreactive cells (84%–88%/DAPI) in comparison to untreated controls (Fig. 5A, B). Furthermore, the percentage of cells expressing GABA did not significantly differ between the conditions tested (data not shown). The main neuronal proportion (∼80%) of differentiated NPCs was GABAergic neurons in our human fetal midbrain-derived cultures as shown also in a previous study [27].

FIG. 5.

Coincubation of differentiating hNPCs with 5 μM PS or 1 μM RN1747 for 3 weeks. (A) After differentiation, cells expressed TH and Tuj1 as shown by immunofluorescence in hNPCs treated with 5 μM PS. (B) The percentage of cells expressing TH (∼1%/Tuj1) or Tuj1 (84%–88%/DAPI) did not significantly differ between the conditions tested (P > 0.05, one-way ANOVA). All data are given as means ± SEM (n = 1 cell line, three independent experiments with two to three technical replicates). Scale bar represents 50 μm. DAPI, 4′,6-diamidino-2-phenylindole. Color images available online at www.liebertpub.com/scd

Discussion

In this study, we differentiated human fetal mesencephalic NPCs to neurons, including dopaminergic cells that are mainly affected by neurodegeneration in Parkinson's disease. While the number of βIII-tubulin positive cells in undifferentiated hNPC lines was comparable to a previous study [30], in our differentiated hNPC cultures the amount of βIII-tubulin positive cells was higher and the number of TH immunoreactive dopaminergic neurons lower than reported, suggesting a variability in the maturation potential of fetal midbrain-derived hNPC lines. Other studies using human embryonic stem cells (hESCs) or induced pluripotent stem cells in various neuronal differentiation approaches showed quite varying efficiencies as well, ranging from 20% to almost 90% βIII-tubulin positive cells [31,35 –38] and 3% to 30% dopaminergic neurons [36,39,40].

Human mesencephalic NPCs developed essential neuronal properties such as tetrodotoxin-sensitive sodium channels and action potentials as well as functional voltage-dependent calcium channels after maturation for 3 weeks [27,28]. However, systematic studies on the genomic expression of voltage-gated sodium, calcium, or TRP channels in human stem cell-derived neural precursors are rare. In contrast to our hNPCs, in differentiated hESC-derived neural progenitors, an upregulation of sodium and calcium channel subunits compared to undifferentiated progenitors could not be detected [41]. Another study, focusing on a limited number of ion channels, reported the significant upregulation of Na_v1.1, Na_v1.2, and Ca_v2.2 in neuron-like cells generated from hESCs [42].

The functional expression of voltage-gated sodium channels is a sign of neuronal maturation and necessary for action potential firing. In the CNS Na_v1.1, Na_v1.2, Na_v1.3, and Na_v1.6 are highly but not exclusively expressed [43], whereas Na_v1.7, Na_v1.8, and Na_v1.9 are more restricted to peripheral neurons [44]. In our hNPCs, nearly all channel subunits were significantly upregulated after differentiation, but no predominance of certain subunits was detected, indicating maturation without strict regional specification.

The only calcium channels that were not significantly upregulated upon neuronal differentiation were the T-type channels Cav3.1 and Cav3.2. This is in line with developmental studies revealing high expression levels of T-type calcium channels in early stages that are exceeded by the expression of N or L-type currents during maturation of the nervous system [45]. These quantitative real-time PCR data of voltage-dependent sodium and calcium channels suggest that human fetal NPCs and neural progenitors derived from other sources may have varying expression profiles of some main subunits.

The KCl-evoked intracellular Ca²⁺ increases, with amplitudes comparable to a previous study [28], were mainly mediated by functional voltage-gated Ca²⁺ channels. This is in line with a previous investigation using differentiated hNPCs, where the coapplication of verapamil induced an ∼80% degree of blockade [28]. Despite its potent and nonselective calcium channel antagonism, verapamil is not known to be embryo- or fetotoxic, therefore, this blocker could be used as treatment to achieve a marked inhibition of voltage-gated calcium channels in hNPC, which may become relevant in future cell transplantations and medical therapies in Parkinson's disease patients [46].

Different to the late expression of voltage-gated Na⁺ and Ca²⁺ channels during neuronal development, TRP channels are already functionally expressed in neural progenitor cells, a relatively early stage in neurogenesis. Upon differentiation, the expression profile of TRPs did not change significantly. In a study with ESC-derived hNPCs, numerous TRP channels (eg, TRPV4) were even expressed at lower levels after differentiation [41]. Our quantitative PCR data indicated an upregulation of TRPM3 in respect to TRPM2 in proliferating NPCs. While it was reported that activation of TRPM2 can lead to apoptosis and neuronal death and inhibition has a neuroprotective role [47], little is known about the role of TRPM3 in brain physiology. There is evidence that TRPM3 activation facilitates glutamatergic transmission in the developing brain [48].

In line with previous pharmacological characterizations, our data of Ca²⁺ increase upon application of pregnenolone sulfate or RN1747—respective TRPM3 and TRPV4 agonists—indicated that in proliferating hNPCs, most activity is the result of TRP channels representing the main route of Ca²⁺ entry into these cells [12]. TRP-mediated increase in calcium entry is even required for the proliferation of NPCs [25,49].

TRP channels promote many developmental processes, including proliferation and survival, which are of particular importance for various stem or progenitor cell sources intended for cell replacement therapies [12]. But there is growing evidence that TRPs can also induce neuronal degeneration in numerous disorders, including Parkinson's disease. TRPC3 for example is associated with abnormalities in GABAergic neuron firing in the substantia nigra by controlling GABA projection neuron activity [50]. Pharmacological modulation of TRP channels in stem cell-derived progenitor cells may reduce unwanted proliferation and tumor formation that still challenge cell replacement therapy [26].

Conclusions

These data indicate that hNPCs derived from fetal midbrain tissue expressed essential voltage-gated calcium and sodium channels during neuronal differentiation. In contrast, the TRP channel expression did not enhance significantly during hNPC maturation. The activation of predominantly expressed TRP channels (TRPM3, TRPV4) by treatment with agonists did not have a functional impact on the proliferation, survival, and differentiation of hNPCs in vitro.

Footnotes

Acknowledgments

The authors thank Mrs. Annett Brandt, Mrs. Ute Römuß, and Mr. Andreas Niesel for excellent technical assistance. This study was supported, in part, by the Petermax-Müller-Stiftung for Parkinson research and the Karlheinz-Hartmann-Stiftung (Hannover, Germany).

Author Disclosure Statement

The authors declare that there is no conflict of interest regarding the publication of this article.

References

Spitzer

. (2006). Electrical activity in early neuronal development. Nature, 444:707–712.

Luhmann

, Sinning

, Yang

, Reyes-Puerta

, Stüttgen

, Kirischuk

and Kilb

. (2016). Spontaneous neuronal activity in developing neocortical networks: from single cells to large-scale interactions. Front Neural Circuits, 10:40.

Toth

, Shum

and Prakriya

. (2016). Regulation of neurogenesis by calcium signaling. Cell Calcium, 59:124–134.

, Canzoniero

and Choi

. (2001). Ion homeostasis and apoptosis. Curr Opin Cell Biol, 13:405–411.

Purves

, Augustine

and Fitzpatrick

. (2011). Channels and transporter. In: Neuroscience, 2nd edn., Chapter 4. Purves

, Augustine

, Fitzpatrick

, Katz

, LaMantia

A-S

, McNamara

, Williams

, eds. Sinauer Associates, Sunderland, MA. 2001.

Dickson

. (2002). Molecular mechanisms of axon guidance. Science, 298:1959–1964.

Song

and Poo

. (2001). The cell biology of neuronal navigation. Nat Cell Biol, 3:E81–E88.

Ramsey

, Moran

, Chong

and Clapham

. (2006). A voltage-gated proton-selective channel lacking the pore domain. Nature, 440:1213–1216.

Ramírez-Barrantes

, Cordova

, Poblete

, Muñoz

, Marchant

, Wianny

and Olivero

. (2016). Perspectives of TRPV1 function on the neurogenesis and neural plasticity. Neural Plast, 2016:1568145.

10.

Zeng

, Tian

and Xiao

. (2016). TRPC channels: prominent candidates of underlying mechanism in neuropsychiatric diseases. Mol Neurobiol, 53:631–647.

11.

Vrenken

, Jalink

, van Leeuwen

and Middelbeek

. (2016). Beyond ion-conduction: channel-dependent and -independent roles of TRP channels during development and tissue homeostasis. Biochim Biophys Acta, 1863:1436–1446.

12.

Morgan

, Hübner

, Rolfs

and Frech

. (2013). Spontaneous calcium transients in human neural progenitor cells mediated by transient receptor potential channels. Stem Cells Dev, 22:2477–2486.

13.

Donnelly

. (2013). Voltage-gated Na⁺ channels in chemoreceptor afferent neurons – potential roles and changes with development. Respir Physiol Neurobiol, 185:67–74.

14.

Boiko

, van Wart

, Caldwell

, Levinson

, Trimmer

and Matthews

. (2003). Functional specialization of the axon initial segment by isoform-specific sodium channel targeting. J Neurosci, 23:2306–2313.

15.

Djouhri

, Fang

, Okuse

, Wood

, Berry

and Lawson

. (2003). The TTX-resistant sodium channel Nav1.8 (SNS/PN3): expression and correlation with membrane properties in rat nociceptive primary afferent neurons. J Physiol, 550:739–752.

16.

Catterall

, Leal

and Nanou

. (2013). Calcium channels and short-term synaptic plasticity. J Biol Chem, 288:10742–10749.

17.

Wheeler

, Groth

, Ma

, Barrett

, Owen

, Safa

and Tsien

. (2012). Ca(V)1 and Ca(V)2 channels engage distinct modes of Ca(2+) signaling to control CREB-dependent gene expression. Cell, 149:1112–1124.

18.

Bannister

and Beam

. (2013). Ca(V)1.1: the atypical prototypical voltage-gated Ca²⁺ channel. Biochim Biophys Acta, 1828:1587–1597.

19.

Catterall

, Perez-Reyes

, Snutch

and Striessnig

. (2005). International Union of Pharmacology. XLVIII. Nomenclature and structure-function relationships of voltage-gated calcium channels. Pharmacol Rev, 57:411–425.

20.

Clapham

. (2003). TRP channels as cellular sensors. Nature, 426:517–524.

21.

Clapham

, Runnels

and Strubing

. (2001). The TRP ion channel family. Nat Rev Neurosci, 2:387–396.

22.

Zheng

. (2013). Molecular mechanism of TRP channels. Compr Physiol, 3:221–242.

23.

Montell

. (2005). TRP channels in Drosophila photoreceptor cells. J Physiol, 567:45–51.

24.

Hardie

and Minke

. (1992). The trp gene is essential for a light-activated Ca²⁺ channel in Drosophila photoreceptors. Neuron, 8:643–651.

25.

Weick

, Austin Johnson

and Zhang

. (2009). Developmental regulation of human embryonic stem cell-derived neurons by calcium entry via transient receptor potential channels. Stem Cells, 27:2906–2916.

26.

Milosevic

, Brandt

, Roemuss

, Arnold

, Wegner

, Schwarz

, Storch

, Zimmermann

and Schwarz

. (2006). Uracil nucleotides stimulate human neural precursor cell proliferation and dopaminergic differentiation: involvement of MEK/ERK signalling. J Neurochem, 99:913–923.

27.

Wegner

, Kraft

, Busse

, Härtig

, Schaarschmidt

, Schwarz

and Hevers

. (2008). Functional and molecular analysis of GABA_A receptors in human midbrain-derived neural progenitor cells. J Neurochem, 107:1056–1069.

28.

Wegner

, Kraft

, Busse

, Schaarschmidt

, Härtig

, Schwarz

and Schwarz

. (2009). Glutamate receptor properties of human mesencephalic neural progenitor cells: NMDA enhances dopaminergic neurogenesis in vitro. J Neurochem, 111:204–216.

29.

Wegner

, Kraft

, Busse

, Härtig

, Ahrens

, Leffler

, Dengler

and Schwarz

. (2012). Differentiated human midbrain-derived neural progenitor cells express excitatory strychnine-sensitive glycine receptors containing α2β subunits. PLoS One, 7:e36946.

30.

Moon

, Schwarz

, Lee

, Kang

, Lee

, Kim

, Sung

, Höglinger

, Wegner

, et al. (2017). Preclinical analysis of fetal human mesencephalic neural progenitor cell lines: characterization and safety in vitro and in vivo. Stem Cells Transl Med, 6:576–588.

31.

Stanslowsky

, Haase

, Martin

, Naujock

, Leffler

, Dengler

and Wegner

. (2014). Functional differentiation of midbrain neurons from human cord blood-derived induced pluripotent stem cells. Stem Cell Res Ther, 5:35.

32.

Stanslowsky

, Reinhardt

, Glass

, Kalmbach

, Naujock

, Hensel

, Lübben

, Pal

, Venneri

, et al. (2016). Neuronal dysfunction in iPSC-derived medium spiny neurons from chorea-acanthocytosis patients is reversed by Src kinase inhibition and F-actin stabilization. J Neurosci, 36:12027–12043.

33.

Vincent

, Acevedo

, Nguyen

, Dourado

, DeFalco

, Gustafson

, Spiro

, Emerling

, Kelly

and Duncton

. (2009). Identification and characterization of novel TRPV4 modulators. Biochem Biophys Res Commun, 389:490–494.

34.

de la Roche

, Eberhardt

, Klinger

, Stanslowsky

, Wegner

, Koppert

, Reeh

, Lampert

, Fischer

and Leffler

. (2013). The molecular basis for species-specific activation of human TRPA1 protein by protons involves poorly conserved residues within transmembrane domains 5 and 6. J Biol Chem, 288:20280–20292.

35.

Soldner

, Hockemeyer

, Beard

, Gao

, Bell

, Cook

, Hargus

, Blak

, Cooper

, et al. (2009). Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell, 136:964–977.

36.

Shi

, Kirwan

, Smith

, Robinson

and Livesey

. (2012). Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses. Nat Neurosci, 15:477–486, S1.

37.

Reinhardt

, Glatza

, Hemmer

, Tsytsyura

, Thiel

, Höing

, Moritz

, Parga

, Wagner

, et al. (2013). Derivation and expansion using only small molecules of human neural progenitors for neurodegenerative disease modeling. PLoS One, 8:e59252.

38.

Hargus

, Cooper

, Deleidi

, Levy

, Lee

, Marlow

, Yow

, Soldner

, Hockemeyer

, et al. (2010). Differentiated Parkinson patient-derived induced pluripotent stem cells grow in the adult rodent brain and reduce motor asymmetry in Parkinsonian rats. Proc Natl Acad Sci U S A, 107:15921–15926.

39.

Cai

, Yang

, Poremsky

, Kidd

, Schneider

and Iacovitti

. (2010). Dopaminergic neurons derived from human induced pluripotent stem cells survive and integrate into 6-OHDA-lesioned rats. Stem Cells Dev, 19:1017–1023.

40.

Swistowski

, Peng

, Liu

, Mali

, Rao

, Cheng

and Zeng

. (2010). Efficient generation of functional dopaminergic neurons from human induced pluripotent stem cells under defined conditions. Stem Cells, 28:1893–1904.

41.

Young

, Machacek

, Dhara

, Macleish

, Benveniste

, Dodla

, Sturkie

and Stice

. (2011). Ion channels and ionotropic receptors in human embryonic stem cell derived neural progenitors. Neuroscience, 192:793–805.

42.

Mirsadeghi

, Shahbazi

, Hemmesi

, Nemati

, Baharvand

, Mirnajafi-Zadeh

and Kiani

. (2017). Development of membrane ion channels during neural differentiation from human embryonic stem cells. Biochem Biophys Res Commun, 491:166–172.

43.

Caldwell

, Schaller

, Lasher

, Peles

and Levinson

. (2000). Sodium channel Na(v)1.6 is localized at nodes of ranvier, dendrites, and synapses. Proc Natl Acad Sci U S A, 97:5616–5620.

44.

Eijkelkamp

, Linley

, Baker

, Minett

, Cregg

, Werdehausen

, Rugiero

and Wood

. (2012). Neurological perspectives on voltage-gated sodium channels. Brain, 135:2585–2612.

45.

Harvey Sanes

, Reh

and Harris

. (2012). Development of the Nervous System. Academic Press, Burlinton, MA.

46.

Lang

, Gong

and Fan

. (2015). Calcium channel blocker use and risk of Parkinson's disease: a meta-analysis. Pharmacoepidemiol Drug Saf, 24:559–566.

47.

Kühn

, Heiner

and Lückhoff

. (2005). TRPM2: a calcium influx pathway regulated by oxidative stress and the novel second messenger ADP-ribose. Pflugers Arch, 451:212–219.

48.

Zamudio-Bulcock

, Everett

, Harteneck

and Valenzuela

. (2011). Activation of steroid-sensitive TRPM3 channels potentiates glutamatergic transmission at cerebellar Purkinje neurons from developing rats. J Neurochem, 119:474–485.

49.

, Chen

, Zhou

, Xu

and Yu

. (2012). A TRPC1-mediated increase in store-operated Ca²⁺ entry is required for the proliferation of adult hippocampal neural progenitor cells. Cell Calcium, 51:486–496.

50.

Takada

, Numata

and Mori

. (2013). Targeting TRPs in neurodegenerative disorders. Curr Top Med Chem, 13:322–334.