LY6D as a Chemoresistance Marker Gene and Therapeutic Target for Laryngeal Squamous Cell Carcinoma

Abstract

Laryngeal squamous cell carcinoma (LSCC) is a common head and neck cancer that is unresponsive to chemotherapy; therefore, understanding the causes of chemotherapy resistance is important. The cancer stem cell (CSC) theory postulates that CSCs are the source of tumor chemoresistance. We enrich laryngeal CSCs to overcome chemoresistance of LSCC. A laryngeal cancer xenograft model was established, and a low dose of cisplatin was administered until chemoresistance arose. A next-generation xenograft model was established using surviving tumor cells, and the test was repeated four times to screen for CSCs. Cell function experiments were performed on each tumor cell generation (m1, m2, m3, and m4). The m3 line, with the highest stemness, was selected for transcriptome sequencing. LY6D was selected for clinical sample validation and functional verification. LY6D expression was detected in 107 laryngeal cancer samples, with high expression in 91 of these samples. LY6D expression was correlated with pathological T and clinical stages, and with cervical lymph node metastasis. The siLY6D group exhibited reduced adhesion and chemoresistance to cisplatin, 5-fluorouracil, and paclitaxel. LY6D is upregulated in laryngeal cancer and may serve as a biomarker for chemoresistance in CSCs. Moreover, LY6D could serve as an alternative antigenic peptide in the targeted treatment of laryngeal cancer.

Introduction

Laryngeal cancer is a common head and neck malignancy [1]. Its incidence has been increasing annually, and it is insensitive to currently used chemotherapeutics. Therefore, most cases of laryngeal cancer are treated surgically. However, throat resection can affect pronunciation, swallowing, and respiratory function, possibly diminishing quality of life for the patient. Therefore, studying the causes of chemotherapy resistance in laryngeal cancer is important. The cancer stem cell (CSC) theory holds that a very small number of CSCs are the principal cause of cancer chemoresistance. In this study, a xenograft tumor model of laryngeal carcinoma was established under chemotherapy drug pressure for several generations, and the surviving CSCs were selected. CSCs with high malignancy and chemoresistance were sequenced to identify laryngeal cancer-specific chemoresistance genes. Treating these genes could change the chemoresistance properties of laryngeal cancer and improve therapeutic outcomes.

Materials and Methods

Screening of laryngeal CSCs in vivo

The animal experimentation procedures were approved by the Animal Care Commission of Experimental Animal Center of Shanxi Medical University. All aspects of the present study were fully approved by the Research Ethics Committee at Shanxi Medical University, China. BALB/C nude mice (specific pathogen free [SPF] grade, female, 4–6 weeks old) were purchased from Vital River (Beijing, China) and raised by Shanxi Otolaryngology Laboratory of the SPF Animal Center. The human laryngeal squamous cell carcinoma (LSCC) cell line, hep2, was obtained from the China Center for Type Culture Collection (Wuhan, China) and injected subcutaneously into the mice to establish a laryngeal carcinoma xenograft model (eight mice per group). When the volume of the tumor reached 300 mm³, a low dose of cisplatin (5 mg/kg) was administered. Changes in tumor volume were monitored. When the tumors stopped shrinking and their volume stabilized, they were excised and subjected to tumor dissociation (130-095-929; Miltenyi Biotec, Bergisch Gladbach, Germany). The cells were grown in suspension culture consisting of serum-free Dulbecco's modified Eagle's medium (DMEM) supplemented with B27 (27010150308-1; 1:50; Engreen Biosystem Co. Ltd., Beijing, China), epidermal growth factor (EGF; 20 ng/mL), and basic fibroblast growth factor (bFGF; 20 ng/mL) in an ultra-low-attachment culture flask. All cells were maintained in an incubator at 37°C and 100% relative humidity under a 5% CO₂ atmosphere. The cells were then injected subcutaneously into the mice once again. The aforementioned steps were repeated for four mouse generations to obtain CSCs. The first to fourth tumor cell generations were named m1, m2, m3, and m4, respectively.

Verification of cellular chemoresistance in vitro

The cells were cultured in vitro, and cisplatin was added to determine whether there was a relative improvement in chemoresistance. Cell suspension (5,000 cells per 100 μL medium per group) was added to each well of a 96-well plate. After cell adhesion, various cisplatin concentrations (1, 2.5, 5, 7.5, 10, 12.5, 15, 17.5, 20, 25, and 30 μg/mL) were prepared. Three replicates were made for each concentration, and the control group received no cisplatin. After 24 h, 10 μL CCK8 was added to each well and incubation was continued for 1 h. Absorbance was measured for each group in a microplate reader at λ = 450, and lethality was calculated as follows: $\begin{matrix} L e t h a l i t y & = (O D [c o n t r o l g r o u p] - O D [e x p e r i m e n t a l g r o u p]) \\ ∕ O D [c o n t r o l g r o u p] . \end{matrix}$

Minimal tumorigenicity experiment in nude mice

Various numbers (10,000, 5,000, 2,500, 1000, 500, 200, 100, 50, 20, 10) of cells suspended in 100 μL medium and 20 μL Matrigel were inoculated into the axillae of nude mice. Each group had six mice. Tumor formation was then observed for each group.

Cell proliferation assay

The CCK8 method was used to compare the proliferative capacities of m1, m2, m3, m4, and hep2. One hundred microliters of medium containing 1 × 10³ cells was added to each well in a 96-well plate, and 3 replicate wells were prepared for each group. Ten microliters of CCK8 was added to each well at 24, 48, and 72 h, and the absorbances were measured with a microplate reader at λ = 450.

Clone formation assay

Five hundred cells were counted for m1, m2, m3, m4, and hep2 and cultured in a 35-mm petri dish. After 10 d, the cells were fixed with paraformaldehyde, rinsed with phosphate-buffered saline, stained with crystal violet, and enumerated for clones.

Transwell chamber assay

The invasion abilities of m1, m2, m3, m4, and hep2 were evaluated in a Transwell chamber assay. Matrigel (BD356234; BD Biosciences, San Jose, CA) was thawed at 4°C overnight and diluted in serum-free medium to a 1:5 volumetric ratio. Each Transwell chamber was supplemented with 40 μL of this dilution and incubated at 37°C for 2 h to allow the Matrigel to coagulate. A 100 μL suspension containing 1 × 10⁵ cells was added to the upper chamber, and 600 μL of serum containing DMEM was added to the lower chamber. After incubation for 24 and 48 h, the cells were fixed with paraformaldehyde and stained with crystal violet. The chamber was removed and examined to determine whether the cells passed through the membrane and subsequently microphotographed. Then, 33% acetic acid was added, and the absorbance of each sample was measured in a microplate reader at λ = 570 nm. A cell migration assay was also conducted using the same procedure as above except for the omission of the Matrigel.

Scratch assay

A culture insert (ibidi81176; ibidi, Germany) was placed in each hole of the μ-slide 8 well (ibidi80826; ibidi). From each group, 4 × 10⁴ cells were resuspended in 70 μL serum-free medium and placed on the left and right holes of the scratch plate. The culture inserts were carefully removed the next day, and microphotographs were taken at 0, 18, and 36 h.

Cell adhesion assay

The cells were collected at a density of 1 × 10³ in 100 μL and inoculated in 96-well plates. The cells were incubated for 1, 2, and 4 h and fixed with 4% formaldehyde for 20 min before being stained with 1% crystal violet for 10 min. The stained cells were digested in 33% glacial acetic acid, and the absorbance of each group was measured with a microplate reader at λ = 570.

Sphere formation assay

One thousand tumor cells (m1, m2, m3, m4, and hep2) were cultured in a 35-mm suspension dish containing 2 mL serum-free suspension medium. After suspension culture (medium composition is the same as above), the spheres were counted under the microscope after 5 d (>50 cells can be considered as a sphere).

Cellular immunofluorescence assay

Differentiation of m3 and hep2 was compared between those cultured by suspension and those cultured by adhesion. Slides were placed at the bottom of a 24-well plate, and 10⁴ cells were inoculated into each well and incubated for 4 h. The cells were then fixed with 4% paraformaldehyde for 30 min and blocked with 5% bovine serum albumin for 1.5 h. The primary antibodies used were anti-cytokeratin 14 (ab7800; Abcam, Cambridge, UK) and anti-alpha smooth muscle action (alpha-SMA; ab7817; Abcam). The cells were incubated overnight at 4°C, dipped three times in a mixture of Tris-buffered saline and polysorbate 20, incubated with the fluorescent secondary antibody Alexa Fluor 488-labeled goat anti-mouse IgG for 1 h, stained with 4′,6-diamidino-2-phenylindole, and microphotographed with a Leica TCS SP8 confocal laser scanning microscope (Leica Camera AG, Wetzlar, Germany).

Transcriptome sequencing analysis

Transcriptome sequencing was performed by Shanghai OE Biotech. Co. Ltd. Samples included tumor cells from three different nude mice in the third generation (m3) and the first generation (m1). Laryngeal carcinoma hep2 cells were used as controls.

Clinical sample collection and quantitative reverse transcription–polymerase chain reaction of LY6D

This trial involved 107 LSCC patients undergoing surgery at the First Hospital affiliated with Shanxi Medical University. All patients provided informed, written signed consent before surgery and acknowledged that they understood their rights and obligations.

LSCC and adjacent normal margin (ANM) tissues were obtained from patients undergoing surgery. Fresh specimens were frozen with liquid nitrogen and used in quantitative reverse transcription–polymerase chain reaction (qRT-PCR). Patient clinical information, including name, age, surgery date, clinical classification, pathological T stage, cervical lymph node metastasis, pathological differentiation, presence or absence of recurrence, post-hospital status, and contact information, was recorded.

RNA from the 107 laryngeal carcinoma samples was extracted, and qRT-PCR was performed to evaluate LY6D expression. The qLY6D-F was TTCTGCAAGACCACGAACACAA and the qLY6D-R was CTCCGCACAGTCCTTCTTCAC. LY6D expression levels were compared between the LSCC and ANM tissues. After a normality test and an ANOVA for homogeneity, the data were analyzed by one-factor ANOVA. Data with irregular variance were analyzed by Dunnett's T3 test.

Cell adhesion and chemoresistance assays after LY6D silencing

LY6D interfering RNA was synthesized. The sense sequence of LY6D-1 was ACCAGCUCCAGCAACUGCAAGCAUU, the antisense sequence of LY6D-1 was AAUGCUUGCAGUUGCUGGAGCUGGU, the sense sequence of LY6D-2 was CCUGAGCCUCCUGGCCGUCAUCUUA, and the antisense sequence of LY6D-2 was UAAGAUGACGGCCAGGAGGCUCAGG. Lipofectamine 3000 Transfection Reagent (L3000075; Invitrogen, CA) and si-LY6D were added to m3 and hep2 to induce cell transfection. Cell adhesion tests for hep2 and m3 were performed as previously described. For this experiment, the common chemotherapeutics cisplatin, 5-FU, and paclitaxel were used. Relative changes in chemoresistance to the three drugs were compared by the CCK-8 method.

Fluorescence activated cell sorting experiment the correlationship of LY6D and CD133

M3, hep2 were collected and added the corresponding antibody. Antibodies include CD133/2-PE antibody (Miltenyi Biotec), CD44 antibodies (Miltenyi Biotec), and Ly-6D antibodies (BD Biosciences), labeled for 30 min. The ratio of CD133 and LY6D was explored by flow cytometry.

Statistical analysis

Data of multiple groups were tested for normal distribution and homogeneity of variance before being analyzed by one-factor ANOVA. Statistical analysis was performed in SPSS v. 13.0 (IBM Corp., Armonk, NY).

Results

The tumor volume initially increased in each generation of nude mice (Fig. 1A). Under chemotherapeutic drug pressure, the tumors gradually shrank and then their volumes stabilized. The time of tumor formation in the different generations gradually shortened from 13 to 5 d. At the same time points, however, the tumor volumes increased. Therefore, with each successive generation, the tumorigenic ability and stemness of the cells continuously increased.

FIG. 1.

(A) Tumor volume change chart. (B) Results of in vitro chemoresistance verification test. Hep2, m1, m2, m3, and m4 were treated with cisplatin at the indicated concentration for 24 h. Then, cell viability was determined using a CCK-8 kit. Cisplatin lethality was then calculated.

The chemoresistance of the screened cells was enhanced

Surviving tumor cells were excised from the nude mice and tested for in vitro chemoresistance (Fig. 1B). Cell viability decreased and mortality increased with increasing cisplatin concentration. After the addition of cisplatin for 24 h, the IC50 of the hep2 and m3 cells were 8.5 and 23 μg/mL, respectively. The resistance index increased nearly threefold. One-way ANOVA was used to evaluate the differences among five groups. The value of IC50 in m3 and hep2 was statistically different. Therefore, post-screening cellular chemoresistance was greatly enhanced.

Screened m3 cells had strong tumorigenicity

Minimal tumor formation tests in nude mice (Table 1) indicated that 5,000 laryngeal carcinoma hep2 cells could induce tumorigenesis in 50% of the nude mice. In the m3 (third) generation, however, only 20 cells sufficed to induce tumor formation in the nude mice. Therefore, CSCs were present in m3.

Table 1.

Minimal Tumor Formation Experiment for Different Generations of Tumor Cells

Number	10,000	5,000	2,500	1,000	500	200	100	50	20	10
hep2	5/6	3/6	1/6	0/6
m1	5/6	4/6	2/6	0/6
m2	6/6	5/6	5/6	3/6	0/6
m3					6/6	6/6	6/6	6/6	4/6
m4					6/6	6/6	5/6	4/6	0/6	0/6

With 5000 hep2 cells (bold), 3 out of 6 nude mice can form tumors. In contrast, using only 20 m3 cells (bold), 4 out of 6 nude mice can form tumors. M3's tumorigenic ability is greatly enhanced.

Screened cells showed CSC characteristics (as observed by cell proliferation, clone formation, Transwell chamber, scratch, cell adhesion, sphere formation, and cellular immunofluorescence assays)

The order of proliferative abilities of LSCC was as follows: m3 > m4 > m2 > m1 > hep2 (Fig. 2A).

FIG. 2.

Stemness tests of screened cells. (A) Proliferation of hep2, m1, m2, m3, and m4 cells. (B) Clone formation assay results. (C) Cell migration ability of hep2, m1, m2, m3, and m4 cells determined by Transwell chamber assay (microscope picture × 200). (D) Invasive ability of hep2, m1, m2, m3, and m4 cells (microscope picture × 200). (E) Invasive ability of hep2, m1, m2, m3, and m4 cells determined by scratch assay (microscope picture × 400). (F) Cell adhesion assay results (microscope picture × 100). (G) Sphere formation assay results (microscope picture × 400). (H) Detection of m3 differentiation ability by immunofluorescence assay (microscope picture × 400). (H1) M3 cells showed low expression of CK14 after dissociation and suspension culture. (H2) After 15 days of incorporation of serum to induce differentiation, CK14 showed a high expression state in m3. (H3) M3 cells showed a state of low expression of α-SMA after dissociation. (H4) After 15 days of incorporation of serum to induce differentiation, m3 cells showed a high expression of α-SMA. (H5) Hep2 showed high expression of CK14 by suspension culture. (H6) After adherent culture for 15 days, CK14 showed a high expression in hep2. (H7) Hep2 showed a state of high expression of α-SMA by suspension culture. (H8) High expression of α-SMA in hep2 by adherent culture for 15 days. α-SMA, alpha smooth muscle action.

The ability of cells to self-renew was determined by the clone and sphere formation assays. The clone formation rates for hep2, m1, m2, m3, and m4 were 14.70%, 18.00%, 30.87%, 53.27%, and 54.07%, respectively. The clone formation rates of m3 and m4 were the highest (Fig. 2B). Under serum-free suspension culture conditions, m2, m3, and m4 formed spheres and their diameters increased with culture time. By the fifth day, hep2, m1, m2, m3, and m4 groups formed suspended spheres at the rates of 20%, 25%, 33%, 61%, and 62%, respectively (Fig. 2G). The m3 and m4 cells exhibited strong sphere formation abilities and produced larger spheres than those of the other groups.

The results of the Transwell chamber assay indicated that the strongest invasion and migration abilities were found in m3 (Fig. 2C, D).

The scratch assay (Fig. 2E) confirmed that m3 had the strongest migration ability. m3 also had the strongest adhesion ability (Fig. 2F).

Multidirectional differentiation potential is an important characteristic of CSCs. Therefore, we used an immunofluorescence assay to evaluate CK14 and α-SMA expression as myoepithelial markers. Fluorescence microscopy (Fig. 2H) revealed that most of the m3 cells had low or zero expression levels of CK14 and α-SMA immediately after dissociation. After 15 d of adhesion culture, the cells were induced to differentiate by serum addition, and CK14 and α-SMA showed high expression levels. It was verified that m3 was in an undifferentiated state just after dissociation and could differentiate into epithelial cells, fibroblasts, and other cell types under certain conditions.

We conducted fifth- and sixth-generation chemoresistance screening in nude mice to obtain m5 and m6 cells, and the aforementioned verification tests were conducted. The stemness of the m1, m2, and m3 cells increased with screening generation and then reached a plateau. The stemness of m4, m5, and m6 resembled that of m3.

Genes expressed differentially in laryngeal CSCs were identified

We performed gene chip detection on m3 using m1 and hep2 cells as controls (Fig. 3). This assay can disclose laryngeal cancer-specific chemoresistance genes. Relative to m1, m3 had 102 upregulated and 60 downregulated genes. Compared with hep2, m3 had 126 upregulated and 311 downregulated genes.

FIG. 3.

Transcriptome sequencing analysis for m3, m1, and hep2 cells. (A) Sample correlation coefficient matrix. (B) Cluster analysis results. m1 versus hep2. (C) Cluster analysis results. m3 versus hep2. (D) Cluster analysis results. m3 versus m1. (E) Volcano maps. m1 versus hep2. (F) Volcano maps. m3 versus hep2. (G) Volcano maps. m3 versus m1.

LY6D showed high expression in laryngeal clinical samples

We selected 107 clinical laryngeal cancer samples (Table 2). qRT-PCR showed that LY6D was high expressed in 91 cases. Statistical analysis indicated correlations between LY6D expression and the T stage, clinical stage, and cervical lymph node metastasis. Therefore, LY6D may still be a novel marker for laryngeal cancer malignancy.

Table 2.

Results of Quantitative Reverse Transcription–Polymerase Chain Reaction of LY6D Expression in 107 Laryngeal Cancer Samples

Parameters		Case (n)	LY6D-PCR value (mean ± SE)	P
T stage	T1	30	2.15 + 2.97	<0.001
	T2	33	7.16 + 7.57
	T3	30	14.91 + 14.45
	T4	14	21.16 + 15.89
Clinical stage	I	30	2.20 + 2.96	<0.001
	II	23	6.27 + 6.86
	III	27	10.62 + 11.98
	IV	27	20.29 + 12.29
Degree of pathological differentiation	High	38	2.72 ± 9.34	0.076
	Medium	51	8.03 ± 15.32
	Low	18	5.57 ± 18.92
Cervical lymph node metastasis	N⁰	80	6.41 + 9.00	<0.001
Cervical lymph node metastasis	N⁺	27	19.69 + 15.26	<0.001
Primary or recurrent cases	Primary	99	17.84 + 22.78	0.053
Primary or recurrent cases	Recurrence	8	9.11 + 10.98	0.053

LY6D silencing decreased laryngeal cell adhesion and chemoresistance ability

After LY6D silencing, the adhesion abilities of m3-siLY6D and hep2-siLY6D significantly decreased (Fig. 4A). Cell chemoresistance tests after LY6D silencing showed that at the same concentrations of chemotherapeutic drugs, the cell viabilities of the m3-siLY6D and hep2-siLY6D groups were significantly lower than those of the m3 and hep2 groups, respectively (Fig. 4B). Therefore, cells highly expressing LY6D have strong adhesion and chemoresistance abilities.

FIG. 4.

(A1, A2) Results of cell adhesion assay after LY6D silencing. (B1–B3) Results of cell chemoresistance tests after LY6D silencing. (C1–C3) Results of FACS. FACS, fluorescence activated cell sorting.

The proportion of LY6D and CD133 in M3 increased test by FACS

In laryngeal cancer hep2 cells, the ratio of CD44 was 67.5% (Fig. 4C1). The specificity of CD44 was not strong. In contrast, the ratio of CD133 was about 1.36% (Fig. 4C1). CD133 can better represent cell stemness in laryngeal cancer. Using hep2 as a control, an fluorescence activated cell sorting (FACS) experiment of CD133 and LY6D in m3 was performed. The experiment was confirmed that the proportion of LY6D and CD133 was all increased, from 0.58% to 66.48% and from 2.27% to 31.40%, respectively (Fig. 4C2, C3). The difference is statistically significant.

Discussion

In vivo methods for screening CSCs had significant advantages over other methods

We categorized CSC screening methods into the following three types: (1) Screening using stem cell surface markers such as CD133 and CD44 [2,3], and techniques such as flow cytometry-based sorting and immunomagnetic bead-based sorting. This type of screening is convenient but not specific. (2) Screening according to the slow periodicity of stem cells via techniques such as side population (SP) sorting and DNA-labeled retention cell technologies. This approach, however, isolates impure stem cells. (3) Screening based on stem cell chemoresistance. The in vitro method is simple, but its cell activity is low. The in vivo method is time-consuming and complex, but the cells derived from it have obvious stemness. Studies have shown that there is a structure around the CSCs called a “niche,” which keeps them in a resting and undifferentiated state [4]. The niche is the core driving force sustaining stemness. Relative to in vitro methods, stem cell screening by in vivo chemoresistance conforms to the growth environment required by CSCs, is highly efficiency and authentic, and generates relatively pure stem cells. Through several cell function tests, we confirmed that the cells obtained from in vivo chemoresistance have strong chemoresistance, tumorigenicity, self-renewal, and differentiation abilities.

The American Association for Cancer Research Cancer Stem Cell Working Group recommends that tumor cell xenograft tumorigenesis is the gold standard for CSC identification [5]. CSCs can form tumors on experimental animals in very small numbers. Prince et al. [6] used CD44 as an indicator of head and neck tumor stemness. Five thousand CD44+ cells can induce tumorigenesis in nude mice. Al-Hajj et al. [7] screened breast CSCs using specific cell surface markers. The injection of 100 Lin-ESA+CD44+CD24-/low cells induced tumorigenesis in 1 of 6 nude mice. Clay et al. [8] extracted ALDH+ cells from head and neck tumor specimens and performed a minimal tumor number experiment. Fifty to 100 cells could transform 7 of 15 NOD/SCID mice to form tumor. Yu et al. [9] obtained CD44+CD133+ laryngeal carcinoma cells by the flow-sorting technique and showed that the minimum number required for tumor formation was 1,000 screened cells. In this study, only 20 m3 cells formed tumors in nude mice. Such a low number of cells required to form xenograft tumors has seldom been reported, which indicates that some of the m3 were CSCs and the screening model we used was successful.

LY6D is highly expressed in various tumors

The LY6 gene family is associated with poor prognosis in various cancers. LY6D is located on human chromosome 8q24.3. The Human Genomics Study successfully identified multiple genes on chromosome 8q24 involved in several cancers. It has been reported that a high LY6D expression level is associated with multiple tumor subtypes, malignancy, decreased survival, tumor recurrence, and poor prognosis [10].

LY6D can be used as a marker of squamous cell carcinoma to diagnose bladder cancer [11] and is used as a radiolabel to detect small metastases of head and neck cancer [12]. The expression level of LY6D is also significant for occult lymph node metastasis in head and neck tumors [13]. Research reports suggest that the LY6 family is involved in immune regulation, and LY6D is pluripotent in the lymphatic system [14,15].

LY6D affects cancer cell adhesion and tumor dissemination

Cell function verification indicated that the relative adhesion ability of the siLY6D group was decreased. Huttlin et al. [16,17] reported that LY6D interacts with CTNNAIL, which affects cell adhesion. Studies have shown that LY6D is located in desmosomes and participates in matrix interactions, which lead to tumor adhesion and dissemination [18].

LY6D affects cancer cell chemoresistance

To the best of our knowledge, there are no direct reports on the association between LY6D and tumor chemoresistance. In this study, chemoresistance decreased after LY6D knockdown. LY6D can affect the sensitivity of tumor cells to chemotherapeutic drugs and may have important clinical implications.

BioGRID indicated that LY6D forms a protein interaction with ABCB11, which is a member of the ABC transporter family. These carriers serve as drug discharge pumps to reduce chemotherapeutic drug concentrations in tumor cells and induce chemoresistance. LY6D may increase tumor cell chemoresistance via the interaction between LY6D and ABCB11. Wang et al. [19] identified a human liver protein interaction network by the yeast two-hybrid technique and confirmed an interaction between LY6D and ABCB11. However, the authors did not describe the specific interaction between LY6D and ABCB11. Elucidation of this relationship may disclose the mechanism of LSCC chemotherapy resistance and help achieve targeted tumor therapy.

Antibody–drug conjugates targeting LY6 family members can be used for cancer therapy

Tumor targeted therapy refers to the direct targeting of tumor cells using antibody–drug conjugates to circumvent the systemic toxicity.

Asundi et al. [20] demonstrated high LY6E expression levels in 750 different cancers and designed a drug targeting the LY6E-antibody conjugate. Unlike traditional cytotoxic DNA-binding anticancer drugs, the LY6E-antibody conjugate destroys microtubule networks in proliferating cells while remaining stable in the plasma and being released only in the acidic lysosomes of the target cells. LY6K was identified as a tumor-associated antigen in lung cancer and esophageal squamous cell carcinoma. The efficacy of the LY6K-177 peptide vaccine was verified in patients with advanced esophageal cancer. Ishikawa et al. [21] used LY6K-177 peptide vaccine to treat advanced gastric cancer. In a Phase I clinical trial, no toxicity was observed, and the tumors stopped spreading in three patients and shrank in another. Yoshitake et al. [22] extracted the antigenic peptides of LY6K, CDCA1, and IMP3, prepared an immunotherapy vaccine, and tested it in Phase II clinical trials on 37 patients with advanced head and neck cancer. The trial results indicated that this vaccine could improve the prognosis of advanced head and neck tumors and prolong survival.

Characteristics of LY6D and research prospects

Overall, our finding shows that LY6D is highly expressed in LSCC and is associated with tumor malignancy. LY6D is associated with adhesion, participates in matrix interaction, causes tumor metastasis, interacts with ABCB11, and is closely related to tumor cell chemosensitivity.

The LY6 gene family has been used as an antigenic peptide in clinical trials for tumor-targeted therapy and has demonstrated efficacy. Therefore, the development of LY6D-related targeted antitumor drugs merits further investigation. This novel approach may overcome chemoresistance, evoke immune responses, and provide a targeted tumor treatment.

Footnotes

Acknowledgment

We would like to thank Professor Mian Wu of the University of Science and Technology of China for his guidance on this topic.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the National Natural Science Foundation of China (Grants nos. 81602394, 81402256, and 81572670), the Shanxi Provincial Key Research and Development Program (Grants nos. 201903D321090 and 201803D31094), the Shanxi Province Scientific and Technological Achievements Transformation Guidance Foundation (Grants nos. 201604D131002 and 201604D132040), the Key Technological Innovation Platform Foundation for Head and Neck Cancer Research of Shanxi Province (Grant no. 201605D151003), and the Scientific and Technological Innovation Programs of Higher Education Institutions in Shanxi (STIP; Grants nos. 2016-92 and 2016-93).

References

Steuer

, EI-Deiry

, Parks

, Higgins

and Saba

. (2017). An update on larynx cancer. CA Cancer J Clin, 67:31–50.

Corrò

and Moch

. (2018). Biomarker discovery for renal cancer stem cells. J Pathol Clin Res, 4:3–18.

Wang

, Wu

, Gao

, Li

, Bo

, Zhu

, Fu

, Liu

, Wen

and Wang

. (2017). Identification and characterization of CD133+Í44+ cancer stem cells from human laryngeal squamous cell carcinoma cell lines. J Cancer, 8:497–506.

Chacón-Martínez

, Koester

and Wickström

. (2018). Signaling in the stem cell niche: regulating cell fate, function and plasticity. Development, 145:dev165399.

Clarke

, Dick

, Dirks

, Eaves

, Jamieson

, Jones

, Visvader

, Weissman

and Wahl

. (2006). Cancer stem cells—perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer Research, 66:9339–9344.

Prince

, Sivanandan

, Kaczorowski

, Wolf

, Kaplan

, Dalerba

, Weissman

, Clarke

and Ailles

. (2007). Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci USA, 104:973–978.

Al-Hajj

, Wicha

, Benito-Hernandez

, Morrison

and Clarke

. (2003). Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA, 100:3983–3988.

Clay

, Tabor

, Owen

, Carey

, Bradford

, Wolf

, Wicha

and Prince

. (2010). Single-marker identification of head and neck squamous cell carcinoma cancer stem cells with aldehyde dehydrogenase. Head Neck, 32:1195–1201.

, Jin

, Chen

, Wen

and Gao

. (2009). Biological characteristics of highly tumorigenic CD44+CD133+ subpopulation of laryngeal carcinoma cells. Zhonghua Zhong Liu Za Zhi, 31:99–103.

10.

Luo

, McGarvey

, Madhavan

, Kumar

, Gusev

and Upadhyay

. (2016). Distinct lymphocyte antigens 6 (Ly6) family members LY6D, Ly6E, Ly6K and Ly6H drive tumorigenesis and clinical outcome. Oncotarget, 7:11165–11193.

11.

Torenbeek

, Blomjous

CEM

, Quak

, Ybema

and Meijer

CJLM

. (1992). Use of monoclonal-antibody E48 in diagnosing transitional cell-carcinoma of urinary-bladder. Clin Pathol, 45:303–307.

12.

Colnot

, Nieuwenhuis

, Kuik

, Leemans

, Dijkstra

, Snow

, van Dongen

and Brakenhoff

. (2004). Clinical significance of micrometastatic cells detected by E48 (Ly-6D) reverse transcription-polymerase chain reaction in bone marrow of head and neck cancer patients. Clin Cancer Res, 10:7827–7833.

13.

Nieuwenhuis

, Leemans

, Kummer

, Denkers

, Snow

and Brakenhoff

. (2003). Assessment and clinical significance of micrometastases in lymph nodes of head and neck cancer patients detected by E48 (Ly-6D) quantitative reverse transcription-polymerase chain reaction. Lab Invest, 83:1233–1240.

14.

Zhang

, Esplin

, Iida

, Garrett

, Huang

, Medina

and Kincade

. (2013). RAG-1 and LY6D independently reflect progression in the B lymphoid lineage. PLoS One, 8:e72397.

15.

Upadhyay

. (2019). Emerging role of lymphocyte antigen-6 family of genes in cancer and immune cells. Front Immunol, 4:810–819.

16.

Huttlin

, Ting

, Bruckner

, Gebreab

, Gygi

, Szpyt

, Tam

, Zarraga

, Colby

, et al. (2015). The BioPlex network: a systematic exploration of the human interactome. Cell, 162:425–440.

17.

Huttlin

, Bruckner

, Paulo

, Cannon

, Ting

, Baltier

, Colby

, Gebreab

, Gygi

, et al. (2017). Architecture of the human interactome defines protein communities and disease networks. Nature, 545:505–509.

18.

Eshel

, Zanin

, Kapon

, Sagi-Assif

, Brakenhoff

, van Dongen

and Witz

. (2002). Human Ly-6 antigen E48 (Ly-6D) regulates important interaction parameters between endothelial cells and head-and-neck squamous carcinoma cells. Int J Cancer, 98:803–810.

19.

Wang

, Huo

, Ma

, Tang

, Li

, Huang

, Yuan

, Li

, Wang

, et al. (2011). Toward an understanding of the protein interaction network of the human liver. Mol Syst Biol, 7:536.

20.

Asundi

, Crocker

, Tremayne

, Chang

, Sakanaka

, Tanguay

, Spencer

, Chalasani

, Luis

, et al. (2015). An antibody-drug conjugate directed against lymphocyte antigen 6 complex, locus E (LY6E) provides robust tumor killing in a wide range of solid tumor malignancies. Clin Cancer Res, 21:3252–3262.

21.

Ishikawa

, Imano

, Shiraishi

, Yasuda

, Peng

Y-F

, Shinkai

, Yasuda

, Imamoto

and Shiozaki

. (2014). Phase I clinical trial of vaccination with LY6K-derived peptide in patients with advanced gastric cancer. Gastric Cancer, 17:173–180.

22.

Yoshitake

, Fukuma

, Yuno

, Hirayama

, Nakayama

, Tanaka

, Nagata

, Takamune

, Kawahara

, et al. (2015). Phase II clinical trial of multiple peptide vaccination for advanced head and neck cancer patients revealed induction of immune responses and improved OS. Clin Cancer Res, 21:312–321.