Pikachurin Is Partially Involved in the Synaptic Connection Between Donor and Host Cells in Late-Stage rd1 Mice Following Conspecific Photoreceptor Transplantation

Abstract

Photoreceptor transplantation can rescue the retinal function of late-stage rd1 mice. Many studies have used synaptic markers to suggest that there are synaptic connections after transplantation, but how donor and host cells are connected remains unknown. Many molecules are needed for triad ribbon synapse formation in wild-type mice. Among them, pikachurin is an important extracellular matrix protein that bridges the pre- and postsynaptic components. To investigate the mechanism of the synaptic connection between donor photoreceptor and host retina, we studied the expression of pikachurin in late-stage rd1 mice before and after transplantation. The results showed that the full-length form of pikachurin could still be detected in the degenerated retina. After photoreceptors were transplanted to the subretinal space of rd1 or wild-type mice, pikachurin was detected in the cytoplasm of most donor photoreceptor cells. Pikachurin puncta may represent the cleaved form of the protein and may indicate synapse generation, but it was barely observed in the donor mass of wild-type mice (3.83 ± 3.17 puncta per 100 donor cells). In contrast, pikachurin puncta could be found in the graft of the rd1 mouse retina, but the number was low (21.35 ± 9.48 puncta per 100 donor cells). In addition, 54.12 ± 8.45% of bassoon puncta were paired with pikachurin puncta and 45.5 ± 6.33% were not, indicating that there were fewer pikachurin puncta than bassoon. These results suggest that pikachurin is involved in only a portion of the synaptic connection between the donor photoreceptor and host retina.

Introduction

Photoreceptor transplantation is a promising way to rescue retinal degeneration [1]. The key of this therapeutic method is that donor cells integrate into the host retina. However, a recent discovery about material exchange indicated that most donor cells cannot connect the retinal neural circuit in wild-type mice [2 –5]. rd1 mice, which harbor a mutation in PDE beta gene, are a naturally occurring model for retinal dystrophies [6]. Compared with the intact retinal structure, the late-stage rd1 mice almost lost the entire outer nuclear layer (ONL), which makes the physical contact between the donor cell and host inner nuclear cell easier [7]. In rd1 mice, several sources of grafts have successfully connected to the downstream neuron and restored some visual function [7 –9].

In photoreceptor transplantation studies, the typical method used to indicate new synapse generation between donor and host cells is to perform immunodetection around donor cells for synaptic proteins, such as synaptophysin [7,9], ribeye [9,10], and bassoon [11]. Evidence regarding signal transduction has also been found by electrophysiological examination [8,12,13]. However, it is still unclear how the graft and host tissue connect. In the brain, several studies have shown that transplanted neurons can form appropriate afferent and efferent projections [14 –16]. In contrast, the grafted photoreceptor seems unable to develop axon-like structures that form neural synaptic connections [11,17,18].

To form neural connections, a network of transmembrane receptors, secreted ligands, and synaptic cell adhesion molecules are needed to coordinate pre- and postsynaptic assembly [19 –25]. Determining which synaptic connection proteins are expressed may uncover the characteristics of these neural connections between donor and host cells.

Pikachurin is exclusively secreted by photoreceptor, and it is an extracellular matrix protein that is important for the proper triad ribbon synaptic structure formation [19,23,26]. In the vertebrate retina, two forms of pikachurin have been detected: the full-length form (110 kDa) and the post-translational cleaved N-terminal fragment (60 kDa) [27]. The latter is involved in synaptic connection, bridging presynaptic and postsynaptic components [28]. Furthermore, pikachurin showed a high degree of structural divergence between different species according to a computational modeling analysis, which may lead to malfunction of synaptic connections when human stem cell-derived photoreceptors are transplanted to mice retina [29]. Thus, it is critical to assess the involvement of pikachurin in new synaptic connections after photoreceptor transplantation.

In this study, we investigated the expression of pikachurin before and after conspecific photoreceptor transplantation in late-stage rd1 mice. Pikachurin puncta was found in the donor cell mass, but only a part of the synaptic connection between graft and host could be formed by pikachurin.

Methods

Animals

The mice used in this study were as follows: C57Bl/6J mice obtained from the Experimental Animal Center of Kunming Medical University; C3HPde6brd1(rd1) mice purchased from Vitalstar Biotechnology Co., Ltd. (Beijing, China); Rho-icre mice [B6;SJL-Pde6b+ Tg(Rho-icre)1Ck/Boc] (Cyagen, China) were crossed to tdTomatofloxed mice (Cyagen, China) to generate rho-tdTomato mice. Six- to eight-week-old rd1 mice were used as late-stage rd1 host mice. All animal studies were approved by the Animal Ethics Committee at the West China Hospital and were performed with adherence to the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The animals were raised at room temperature with a 12-h light/12-h dark cycle and standard mice food and clean drinking water.

Immunofluorescence

Eyeballs were fixed with 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) (pH 7.4) at 4°C for 60 min, and then they were dehydrated in 30% sucrose overnight, and embedded in optimal cutting temperature compound (OCT). Cryostat sections were cut at 10 μm and collected on glass slides and stored at −20°C.

For immunostaining, the retinal sections were incubated in blocking solution (5% normal donkey serum, 1% bovine serum albumin, and 0.03% Triton X-100 in 1 × PBS) for 1 h and then were incubated with primary antibodies at 4°C overnight. The following primary antibodies used in this study: Pikachurin (#14578-1-AP; Proteintech, #011-22631; Wako), Ap2a (; SC-8975; Santa Cruz Biotechnology), PKC-a (P5704; Millipore Sigma), rhodopsin (SC-57433; Santa Cruz Biotechnology), Brn3 (SC-6062; Santa Cruz), glutamine synthetase (MAB302; Millipore), and Bassoon (CST; #6897). Subsequently, slides were incubated with a secondary antibody (Invitrogen) for 1 h at room temperature in the dark. Finally, slides were counterstained with 4′6-diamidino-2-phenylindole (Sigma Aldrich Corp.) and were mounted with Mowiol mounting medium. Stained sections were analyzed using a Zeiss Axio Imager Z2 fluorescence microscope or Nikon A1RMP confocal microscope.

Western blot

Total protein was extracted from retinas and from sorted retina cells using radio-immunoprecipitation assay (RIPA) lysis buffer containing protease inhibitor cocktail (Roche), or using phosphatase inhibition (IP) buffer (300 mM NaCl, 50mM Tris-HCl pH 7.4, 1% Triton X-100) with protease inhibitor cocktail and phosphatase inhibitors (Beyotime Institute of Biotechnology, China) [27]. The protein concentration was determined with a bicinchoninic acid assay kit (Beyotime). Protein (30 μg) was loaded into and separated by a 12% sodium dodecyl sulfate–polyacrylamide gel.

Next, proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA). After blocking with 5% nonfat milk, the membranes were incubated with a primary antibody. After washing, the membrane was incubated with secondary antibody for 1 h. The images were captured on the Odyssey CLx Infrared Imaging System (LI-COR Biosciences, Lincoln, NE). Western blotting bands were quantified using Odyssey CLx v2.1 software and normalized to beta-actin as loading control.

Real-time PCR

Total RNA was extracted from retina using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After quantification with a Nanodrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE), cDNA was synthesized from 1 μg of total RNA with PrimeScript RT reagent kit (Takara Biotechnology, Dalian, China).

To quantify the cDNA, real-time PCR was performed on qTOWER 2.2 system (Analytik Jena, Germany). The PCR amplification was conducted in a volume of 20 μL using EvaGreen Supermix (Bio-Rad Laboratories, Inc., Hercules, CA). The primers used in our study to analyze the expression of pikachurin were AAGGTGTGACTGATCCTGCA and CCCTAGGTCCCACACAACAT. To determine mRNA expression, all samples were tested in duplicate and the average Ct values were used for quantification. The mRNA expression was normalized to the endogenous reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

N-methyl-N-nitrosourea treatment

1% N-methyl-N-nitrosourea (NMU; Sigma-Aldrich, Buchs, Switzerland) in saline containing 0.05% acetic acid was injected intraperitoneally. The final concentration was 60 mg/kg body weight. Control animals received a similar volume of balanced salt solution. No clinical signs of discomfort or weight loss were observed. Seven days after NMU administration, the mice were killed, and the expression of pikachurin was examined.

Donor cell preparation and fluorescent-activated cell sorting

The mice were killed according to the approved protocol, and the eyes were removed. The retinas were dissected in cold PBS. Digestion was performed by using the Papain Dissociation System (Worthington Biochemical Corp., Lakewood, NJ). In brief, the retinas were placed in a papain solution for 15 min at 37°C. After this incubation, the retinas were triturated with a 1,000 μL plastic pipette tip to dissociate them into single cells. The papain reaction was stopped with the addition of ovomucoid albumin inhibitor, and cells were collected by centrifuging at 200g for 5 min.

Cell sorting was performed with a FACSAria SORP (Becton, Dickinson and Company) fitted with a 561 nm yellow-green laser to excite tdTomato. Tomato-positive cells were collected in the 586/15 nm channel. Fluorescence-negative cells were collected as required. All the donor cells [photoreceptor precursor cells (PPCs)] were acquired from P4 to P6 mice.

Transplantation

The recipient mice were anesthetized with a mixture of ketamine and xylazine. A tunnel was made in the scleral with a 30-gauge needle, and donor cell suspension was injected through this tunnel by a blunt 32-gauge needle. One microliter cell suspension (1 × 10⁵ cell/μL) was injected into the subretinal space slowly. The pipette was made to remain in place for 2 min and withdrawn slowly. Antibiotic ointment was applied to the eye after surgery. Two weeks after transplantation, the mice were killed to perform the following examination.

Statistical analysis

All experiments were carried out with n ≥ 3. Puncta were manually counted in three-dimensional projections using the original data files. Two different channels were examined independently and together to score both paired and single puncta. Statistical analysis was performed using the GraphPad Prism software (GraphPad Prism Software, Inc., San Diego, CA). The results were analyzed by Student's t-tests. The threshold for significance was set at P < 0.05.

Results

Detection of pikachurin in rd1 mice

In wild-type mice, pikachurin was predominantly expressed in the outer plexiform layer (OPL), as previously reported (Fig. 1A). In rd1 mice, most of pikachurin was detected in the ganglion cell layer (GCL), and the apical side of ONL and inner nuclear layer (INL) at postnatal day 14 (Fig. 1B). After photoreceptor degeneration, the pikachurin was found in the INL and GCL at p42 (Fig. 1C). This observation in rd1 mice was unexpected, as pikachurin was previously found to be exclusively expressed by photoreceptors [26]. Next, we immunostained pikachurin in another retinal degeneration model, which is induced by treatment with NMU [30]. Pikachurin was also found in the INL and GCL at 7 days after NMU administration (Fig. 1D).

FIG. 1.

Expression of pikachurin. (A) Pikachurin puncta located at OPL in wild-type retina; (B) pikachurin at the apical side of ONL, and other retinal layers at p14 in rd1 mice; (C) pikachurin in INL and GCL at p42 in rd1 mice; (D) pikachurin expression in N-methyl-N-nitrosourea-induced retinal degeneration model. INL, inner nuclear layer; GCL, ganglion cell layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Color images are available online.

To further confirm this observation, we performed western blotting to detect pikachurin in fluorescent-activated cell sorting (FACS) photoreceptor cell/nonphotoreceptor cell, wild-type retina tissue, and rd1 retinal tissue. In Fig. 2A, we find a 60 kDa band (cleaved form) in the photoreceptor cell fraction (PF), but not in the non-PF. This form was also found in the wild-type retina at different time points. However, in rd1 retinal tissue, we detected the full-length form of pikachurin (110 kDa) instead of the cleaved form (60 kDa). The expression of the 110 kDa fragment was significantly increased from age p14 to p42. Real-time PCR results showed that the mRNA level was significantly decreased in rd1 mice compared with that of wild-type mice.

FIG. 2.

Detection of pikachurin by western blot and real-time PCR. (A) In the isolated cell sample, an ∼60 kDa band was detected in the sorted PF, but not in non-PF; (B) the ∼60 kDa band was found in the wild-type retina at different time points; (C) an ∼110 kDa band was detected in rd1 mice at different ages; (D) statistical analysis showed that the expression of the ∼60 kDa band was unchanged through observation; (E) ∼110 kDa form of pikachurin increased with aging in rd1 mice; (F) the mRNA level of pikachurin was significantly decreased in rd1 mice compared with that of wild-type mice. *P < 0.05, and ****P < 0.0001. PF, photoreceptor fraction. Color images are available online.

Distribution of pikachurin in rd1 mice

We used confocal images to analyze the distribution of pikachurin in rd1 mice. At p14 in rd1 mice, rhodopsin-labeled photoreceptor cells and outer segments were immunoreactive for pikachurin (Fig. 3A). At p42 in rd1 mice, many retinal cells were positive for pikachurin, including a large population of bipolar cells (PKCa), amacrine cells (AP2a), and ganglion cells (Brn3a) (Fig. 3B, C, and E). Only Müller cells were almost negative for pikachurin staining (Fig. 3D).

FIG. 3.

Confocal micrographs showing the pattern of pikachurin labeling in rd1 mice. (A) At p14, pikachurin was seen in rod photoreceptors and outer segments (rhodopsin); (B, C) at p42, pikachurin was visualized on amacrine cells (AP2a) and ganglion cells (Brn3a); (D) pikachurin was not found in Müller cell (GS); (E) pikachurin was detected in bipolar cells. Color images are available online.

Immunodetection of pikachurin in late-stage rd1 mice after photoreceptor transplantation

To determine whether pikachurin was involved in new synapse formation after photoreceptor cell transplantation, P4–P6 PPCs were injected into the subretinal space of late-stage rd1 mice. After transplantation, surviving donor cells could be traced by fluorescence protein, and rhodopsin was well expressed in these photoreceptor cells (Supplementary Fig. S1). Pikachurin could be detected in both the host retinal cells and the donor cells. In the donor photoreceptor mass, we also noticed punctate staining of pikachurin, which may be the post-translational cleaved form of pikachurin involved in synaptic connection (Fig. 4). To verify this possibility, we costained bipolar cells and found pikachurin puncta between donor cell and host bipolar cell (Supplementary Fig. S2).

FIG. 4.

Detection of pikachurin in rd1 mice after photoreceptor transplantation. Donor cells formed a mass under the retinal space, and pikachurin was found in the cytoplasm of donor cell. Some punctate staining of pikachurin was also observed (arrows). Color images are available online.

Next, we performed photoreceptor transplantation in wild-type retina. Although donor photoreceptor was close to bipolar cell in late-stage rd1 mice, graft was separated from INL by endogenous photoreceptor in wild-type retina. As it shown in Fig. 5, we found the “isolated” donor mass above the slightly detached retina, and no synaptic connection could form between donor cell and host downstream neuron (connections that support material exchange may exist between donor and host photoreceptor, but they are not synaptic connections). In this situation, pikachurin puncta were barely observed. If the number of puncta in the donor mass was counted, we found that it was significantly higher in rd1 mice than it was in wild-type mice (21.35 ± 9.48 vs. 3.83 ± 3.17 per 100 tomato-positive cells, P < 0.05).

FIG. 5.

Detection of pikachurin in wild-type mice after photoreceptor transplantation. (A) The donor photoreceptor formed a cell mass in the subretinal space, and the retina was slightly detached. Pikachurin was expressed in the donor cell, and no pikachurin puncta was detected; (B) comparison of pikachurin puncta between rd1 and wild-type mice after photoreceptor transplantation. OS, outer segment; scale bar = 20 μm, and *P < 0.05. Color images are available online.

In addition, we found that the number of pikachurin puncta was much lower than the number of donor cells. The amount of pikachurin puncta may not be sufficient for all the donor cells to form synapses. Thus, we costained pikachurin with another synaptic marker, bassoon. In confocal images, we found that although most pikachurin puncta were colocalized with bassoon, the bassoon puncta were not always paired with pikachurin (Fig. 6). Quantitative analysis showed that 54.12 ± 8.45% of the bassoon puncta were paired with pikachurin, and 45.5 ± 6.33% of bassoon puncta were not paired. This result indicated that there were fewer pikachurin puncta than bassoon puncta.

FIG. 6.

Detection of pikachurin and bassoon in rd1 mice after photoreceptor transplantation. (A) Most of the bassoon puncta were colocalized with pikachurin (arrows), but some bassoon puncta were not paired with pikachurin puncta (arrowheads); (B) Quantitative analysis showed that 54.12 ± 8.45% bassoon puncta were paired, 45.5 ± 6.33% of puncta were isolated. Color images are available online.

Discussion

In this study, we investigated whether pikachurin was involved in synapse formation between donor and host cells after photoreceptor transplantation.

Pikachurin is predominantly located at OPL and is exclusively expressed by photoreceptor in wild-type mice [26]. Thus, its expression should decrease as photoreceptors are lost in rd1 mice. However, we found that pikachurin could still be detected in degenerated retina by immunostaining. To confirm what we observed in immunofluorescence examination, western blotting was performed using several different sets of samples. First, we collected the PF and non-PF sorted by FACS from rho-tomato adult mice retina. Comparing these two fractions, the 60 kDa cleaved fragment was found in the former, but not the latter. This result is consistent with previous report [26]. Next, we examined the protein extracted from wild-type and rd1 retinas. We only found the 60 kDa band in wild-type retina. In the rd1 retina, the full-length form of pikachurin was detected (110 kDa) instead. As rd1 mice aged, the amount of the 110 kDa band increased significantly.

We also investigated the pikachurin expression in another retinal degeneration model induced by NMU. Pikachurin was found in INL and GCL, which is similar to the change observed in rd1 mice. These results indicated that the full-length form of pikachurin remained in the retina of rd1 mice after most photoreceptors were lost. Confocal imaging showed that pikachurin was colocalized with a large population of retinal cells, including bipolar cells, amacrine cells, and ganglion cells. However, the reason why the pikachurin could be found in these cells is unknown. Retinal degeneration may lead to unexpected changes of synaptic proteins, for example, the expression level of synaptophysin was increased after most photoreceptors died [31]. In general, we have limited information about the expression of synaptic proteins in degenerated retina.

Next, we transplanted PPCs into the subretinal space of late-stage rd1 mice. As we have observed in degenerated retina before transplantation, pikachurin could be detected in the host retina. Donor cells formed a cell mass in the subretinal space and pikachurin was also found in the donor cells.

Furthermore, we found pikachurin puncta in the donor photoreceptor mass, which was probably its cleaved form. The cleaved N-terminal fragment of pikachurin, not the full-length form, worked as an important matrix protein in triad ribbon synapse [19]. The presence of pikachurin puncta may indicate synapse formation. To verify this speculation, we performed subretinal transplantation in age-matched wild-type mice. Although the graft was close to the INL in rd1 mice, the donor mass was “isolated” from bipolar cell by the ONL in wild-type mice. In the latter situation, pikachurin could be observed in the donor cell cytoplasm, yet puncta-like expression was barely observed. These results probably indicate that the pikachurin puncta found in the subretinal space of rd1 mice was the cleaved form of pikachurin and that it was involved in synapse formation.

However, we noticed that the number of pikachurin puncta was relatively low. It was only one-fifth of the number of donor cells. Thus, we costained pikachurin and another synaptic marker, bassoon. Although most pikachurin puncta was colocalized with bassoon, the bassoon puncta were not always paired with pikachurin. The number of pikachurin puncta was lower than that of bassoon. This result indicates that pikachurin may only involve in a portion of the synaptic connection between donor and host cells.

Several studies have reported functional recovery after photoreceptor transplantation in late-stage rd1 mice, which supports synapse formation between donor and host cells. Singh et al. reported that the end-stage rd1 mice had pupillary light reflex and blood flow in visual cortices after photoreceptor transplantation [7]. According to the authors, ∼2.37 ± 1.95 × 10⁴ cells (7.9 ± 6.5% of 3 × 10⁵ transplanted cells) survived in the subretinal space. Mandai et al. and Iraha et al. transplanted retinal sheets into the degenerated retina, and electrophysiological responses were recorded by multi-electrode array (MEA) [8,13]. Although the number of integrated photoreceptors in the retinal sheet was not accounted for, it should be greater than that using suspension of isolated photoreceptor cells.

Garita-Hernandez et al., recently reported that transplantation of optogenetically engineered photoreceptors could restore the visual function of rd1 mice [12]. However, the host retina grafted with unmodified photoreceptors (control group) failed in the MEA test in this study. The possible reason was that the number of surviving donor cells was insufficient (2830 ± 493 cells per retina, 1.42 ± 0.25% of all transplanted cells) to activate retinal ganglion cells. Thus, the electrophysiological response seems to be donor cell number-dependent in photoreceptor transplantation studies.

With a similar number of optogenetically transformed photoreceptors, however, the function of degenerated retina was restored. Light stimuli greatly promoted the release of glutamate, which may offset the limitation of insufficient cell number. Thus, the recorded electrophysiological response was probably glutamate amount dependent, rather than donor cell number dependent. Alternatively, the activation of the downstream neural circuit is more likely the result of glutamate spillover, but not the signal transmission between matched/paired donor and host cell through mature synaptic connection. In addition, the functional test seems not to be affected in xenotransplantation [8,12], despite interspecific protein structural divergence, such as pikachurin [29].

Taken together, there is a high possibility that the synaptic connections between donor and host cells are immature. This analysis is consistent with our observation that pikachurin was only partially involved in synapse formation after photoreceptor transplantation.

Footnotes

Acknowledgments

The authors thank Christopher R.J. Laver (University of British Columbia) for providing us many advices during the study. The authors are grateful to Yi Zhang and staff from Research Core Facility for the help provided to them in this study.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by grants to C.L. from the National Natural Science Foundation of China (81700850) and China Postdoctoral Science Foundation (2018M631085).

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

References

Gasparini

, Llonch

, Borsch

and Ader

. (2018). Transplantation of photoreceptors into the degenerative retina: current state and future perspectives. Prog Retin Eye Res, 69:1–37.

Pearson

, Gonzalez-Cordero

, West

, Ribeiro

, Aghaizu

, Goh

, Sampson

, Georgiadis

, Waldron

, et al. (2016). Donor and host photoreceptors engage in material transfer following transplantation of post-mitotic photoreceptor precursors. Nat Commun, 7:13029.

Santos-Ferreira

, Llonch

, Borsch

, Postel

, Haas

and Ader

. (2016). Retinal transplantation of photoreceptors results in donor-host cytoplasmic exchange. Nat Commun, 7:13028.

Singh

, Balmer

, Barnard

, Aslam

, Moralli

, Green

, Barnea-Cramer

, Duncan

and MacLaren

. (2016). Transplanted photoreceptor precursors transfer proteins to host photoreceptors by a mechanism of cytoplasmic fusion. Nat Commun, 7:13537.

Ortin-Martinez

, Tsai

ELS

, Nickerson

, Bergeret

, Lu

, Smiley

, Comanita

and Wallace

. (2017). A reinterpretation of cell transplantation: GFP transfer from donor to host photoreceptors. Stem Cells, 35:932–939.

Lahdenranta

, Pasqualini

, Schlingemann

, Hagedorn

, Stallcup

, Bucana

, Sidman

and Arap

. (2001). An anti-angiogenic state in mice and humans with retinal photoreceptor cell degeneration. Proc Natl Acad Sci U S A, 98:10368–10373.

Singh

, Charbel Issa

, Butler

, Martin

, Lipinski

, Sekaran

, Barnard

and MacLaren

. (2013). Reversal of end-stage retinal degeneration and restoration of visual function by photoreceptor transplantation. Proc Natl Acad Sci U S A, 110:1101–1106.

Mandai

, Fujii

, Hashiguchi

, Sunagawa

, Ito

S-I

, Sun

, Kaneko

, Sho

, Yamada

and Takahashi

. (2017). iPSC-derived retina transplants improve vision in rd1 end-stage retinal-degeneration mice. Stem Cell Rep, 8:1112–1113.

Kruczek

, Gonzalez-Cordero

, Goh

, Naeem

, Jonikas

, Blackford

SJI

, Kloc

, Duran

, Georgiadis

, et al. (2017). Differentiation and transplantation of embryonic stem cell-derived cone photoreceptors into a mouse model of end-stage retinal degeneration. Stem Cell Rep, 8:1659–1674.

10.

Gonzalez-Cordero

, Kruczek

, Naeem

, Fernando

, Kloc

, Ribeiro

, Goh

, Duran

, Blackford

SJI

, et al. (2017). Recapitulation of human retinal development from human pluripotent stem cells generates transplantable populations of cone photoreceptors. Stem Cell Rep, 9:820–837.

11.

Collin

, Zerti

, Queen

, Santos-Ferreira

, Bauer

, Coxhead

, Hussain

, Steel

, Mellough

, et al. (2019). CRX expression in pluripotent stem cell-derived photoreceptors marks a transplantable subpopulation of early cones. Stem Cells, 31:317.

12.

Garita-Hernandez

, Lampič

, Chaffiol

, Guibbal

, Routet

, Santos-Ferreira

, Gasparini

, Borsch

, Gagliardi

, et al. (2019). Restoration of visual function by transplantation of optogenetically engineered photoreceptors. Nat Commun, 10:4524.

13.

Iraha

, Tu

H-Y

, Yamasaki

, Kagawa

, Goto

, Takahashi

, Watanabe

, Sugita

, Yonemura

, et al. (2018). Establishment of immunodeficient retinal degeneration model mice and functional maturation of human ESC-derived retinal sheets after transplantation. Stem Cell Rep, 10:1059–1074.

14.

Shin

, Fricker-Gates

, Perez

, Leavitt

, Zurakowski

and Macklis

. (2000). Transplanted neuroblasts differentiate appropriately into projection neurons with correct neurotransmitter and receptor phenotype in neocortex undergoing targeted projection neuron degeneration. J Neurosci, 20:7404–7416.

15.

Cunningham

, Cho

J-H

, Leung

, Savvidis

, Ahn

, Moon

, Lee

PKJ

, Han

, Azimi

, et al. (2014). hPSC-derived maturing GABAergic interneurons ameliorate seizures and abnormal behavior in epileptic mice. Cell Stem Cell, 15:559–573.

16.

Falkner

, Grade

, Dimou

, Conzelmann

K-K

, Bonhoeffer

, Götz

and Hübener

. (2016). Transplanted embryonic neurons integrate into adult neocortical circuits. Nature, 539:248–253.

17.

Tsai

ELS

, Ortin-Martinez

, Gurdita

, Comanita

, Yan

, Smiley

, Delplace

, Shoichet

, Nickerson

PEB

and Wallace

. (2019). Modeling of photoreceptor donor-host interaction following transplantation reveals a role for Crx, Müller Glia, and Rho/ROCK signaling in neurite outgrowth. Stem Cells, 29:335.

18.

Gagliardi

, Ben M'Barek

, Chaffiol

, Slembrouck-Brec

, Conart

J-B

, Nanteau

, Rabesandratana

, Sahel

J-A

, Duebel

, et al. (2018). Characterization and transplantation of CD73-positive photoreceptors isolated from human iPSC-derived retinal organoids. Stem Cell Rep, 11:665–680.

19.

Orlandi

, Omori

, Wang

, Cao

, Ueno

, Roux

, Condomitti

, de Wit

, Kanagawa

, Furukawa

and Martemyanov

. (2018). Transsynaptic binding of orphan receptor GPR179 to dystroglycan-pikachurin complex is essential for the synaptic organization of photoreceptors. Cell Rep, 25:130–145.e5.

20.

Sarria

, Cao

, Wang

, Ingram

, Orlandi

, Kamasawa

, Kolesnikov

, Pahlberg

, Kefalov

, Sampath

and Martemyanov

. (2018). LRIT1 modulates adaptive changes in synaptic communication of cone photoreceptors. Cell Rep, 22:3562–3573.

21.

Löhner

, Babai

, Müller

, Gierke

, Atorf

, Joachimsthaler

, Peukert

, Martens

, Feigenspan

, et al. (2017). Analysis of RIM expression and function at mouse photoreceptor ribbon synapses. J Neurosci, 37:7848–7863.

22.

Cao

, Sarria

, Fehlhaber

, Kamasawa

, Orlandi

, James

, Hazen

, Gardner

, Farzan

, et al. (2015). Mechanism for selective synaptic wiring of rod photoreceptors into the retinal circuitry and its role in vision. Neuron, 87:1248–1260.

23.

Omori

, Araki

, Chaya

, Kajimura

, Irie

, Terada

, Muranishi

, Tsujii

, Ueno

, et al. (2012). Presynaptic dystroglycan-pikachurin complex regulates the proper synaptic connection between retinal photoreceptor and bipolar cells. J Neurosci, 32:6126–6137.

24.

Koike

, Obara

, Uriu

, Numata

, Sanuki

, Miyata

, Koyasu

, Ueno

, Funabiki

, et al. (2010). TRPM1 is a component of the retinal ON bipolar cell transduction channel in the mGluR6 cascade. Proc Natl Acad Sci U S A, 107:332–337.

25.

Specht

, Wu

S-B

, Turner

, Dearden

, Koentgen

, Wolfrum

, Maw

, Brandstatter

and Tom Dieck

. (2009). Effects of presynaptic mutations on a postsynaptic cacna1s calcium channel colocalized with mGluR6 at mouse photoreceptor ribbon synapses. Invest Ophthalmol Vis Sci, 50:505–515.

26.

Sato

, Omori

, Katoh

, Kondo

, Kanagawa

, Miyata

, Funabiki

, Koyasu

, Kajimura

, et al. (2008). Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nat Neurosci, 11:923–931.

27.

Han

and Townes-Anderson

. (2012). Cell specific post-translational processing of pikachurin, a protein involved in retinal synaptogenesis. PLoS One, 7:e50552.

28.

Kanagawa

, Omori

, Sato

, Kobayashi

, Miyagoe-Suzuki

, Takeda

, Endo

, Furukawa

and Toda

. (2010). Post-translational maturation of dystroglycan is necessary for pikachurin binding and ribbon synaptic localization. J Biol Chem, 285:31208–31216.

29.

Laver CRJ and Matsubara

. (2017). Structural divergence of essential triad ribbon synapse proteins among placental mammals—implications for preclinical trials in photoreceptor transplantation therapy. Exp Eye Res, 159:156–167.

30.

Reisenhofer

, Balmer

, Zulliger

and Enzmann

. (2015). Multiple programmed cell death pathways are involved in N-methyl-N-nitrosourea-induced photoreceptor degeneration. Graefes Arch Clin Exp Ophthalmol, 253:721–731.

31.

Dagar

, Nagar

, Goel

, Cherukuri

and Dhingra

. (2014). Loss of photoreceptors results in upregulation of synaptic proteins in bipolar cells and amacrine cells. PLoS One, 9:e90250.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.22 MB