Establishment of Periodontal Ligament Stem Cell-like Cells Derived from Feeder-Free Cultured Induced Pluripotent Stem Cells

Abstract

The periodontal ligament (PDL) is a fibrous connective tissue that connects the cementum of the root to the alveolar bone. PDL stem cells (PDLSCs) contained in the PDL can differentiate into cementoblasts, osteoblasts, and PDL fibroblasts, with essential roles in periodontal tissue regeneration. Therefore, PDLSCs are expected to be useful in periodontal tissue regeneration therapy. In a previous study, we differentiated induced pluripotent stem cells (iPSCs) into PDLSC-like cells (iPDLSCs), which expressed PDL-related markers and mesenchymal stem cell (MSC) markers; they also exhibited high proliferation and multipotency. However, the iPSCs used in this differentiation method were cultured on mouse embryonic fibroblasts; thus, they constituted on-feeder iPSCs (OF-iPSCs). Considering the risk of contamination with feeder cell-derived components, iPDLSCs differentiated from OF-iPSCs (ie, OF-iPDLSCs) are unsuitable for clinical applications. In this study, we aimed to obtain PDLSC-like cells from feeder-free iPSCs (FF-iPSCs) using OF-iPDLSC differentiation method. First, we differentiated FF-iPSCs into neural crest cell-like cells (FF-iNCCs) and confirmed that FF-iNCCs expressed NCC markers (eg, Nestin and p75NTR). Then, we cultured FF-iNCCs on human primary PDL cell-derived extracellular matrix for 2 weeks; the resulting cells were named FF-iPDLSCs. FF-iPDLSCs exhibited higher expression of PDL-related and MSC markers compared with OF-iPDLSCs. FF-iPDLSCs also demonstrated proliferation and multipotency in vitro. Finally, we analyzed the ability of FF-iPDLSCs to form periodontal tissue in vivo upon subcutaneous transplantation with β-tricalcium phosphate scaffolds into dorsal tissues of immunodeficient mice. Eight weeks after transplantation, FF-iPDLSCs had formed osteocalcin-positive bone/cementum-like tissues and collagen 1-positive PDL-like fibers. These results suggested that we successfully obtained PDLSC-like cells from FF-iPSCs. Our findings will contribute to the development of novel periodontal regeneration therapies.

Introduction

Periodontal tissue, consisting of gingival, cementum, alveolar bone, and periodontal ligament (PDL), plays an important role in maintaining tooth health.¹ In particular, PDL stem cells (PDLSCs; ie, stem cells in the PDL) contribute to periodontal tissue regeneration.² Seo et al. demonstrated that PDLSCs can differentiate into osteoblasts and adipocytes in vitro.³ Moreover, PDLSCs express both PDL and mesenchymal stem cell (MSC) markers.^2,3 Previous studies have revealed that when PDLSCs are subcutaneously implanted in mice, they form cementum-like and PDL-like tissues.^3,4 Furthermore, autologous transplantation of PDLSCs reportedly can regenerate injured periodontal tissue.^5,6 However, because acquisition of PDLSCs requires tooth extraction, it is difficult to obtain the large numbers of PDLSCs required for clinical applications. Thus, there is a need for a method that enables a large number of PDLSCs to be acquired without tooth extraction.

Yamanaka et al. created induced pluripotent stem cells (iPSCs) by transfecting skin fibroblasts with four genes: OCT3/4, SOX2, KLF4, and c-Myc. These cells expressed embryonic stem cell markers, such as NANOG and E-Ras.⁷ iPSCs possess the ability to differentiate into various cell types, including neurons, myocardial cells, and endothelial cells; they are expected to play key roles in regenerative medicine.^8
–10 Initially, mouse embryonic fibroblasts (MEFs) were required as feeder cells for cultures of iPSCs.⁷ However, on-feeder iPSCs (OF-iPSCs) are unsuitable for clinical applications due to the risk of contamination with feeder cell-derived components. In addition, the OF-iPSC culturing method is complex because it involves MEF preparation and specialized passaging techniques. Therefore, a feeder-free iPSC (FF-iPSC) culture method has been developed.¹¹ This FF method is suitable for clinical applications because it eliminates the risk of contamination with feeder cell-derived components and simplifies the subculture of iPSCs.

In our laboratory, we have successfully differentiated OF-iPSCs into PDLSC-like cells (OF-iPDLSCs).¹² We demonstrated that OF-iPDLSCs exhibit high proliferation and multipotency; they also express MSC and PDL-related markers. However, because the differentiation process to obtain OF-iPDLSCs involves the use of MEFs and human primary PDL cell (HPDLC)-derived extracellular matrix (ECM), clinical applications for these cells and matrix are challenging. In this study, we investigated whether PDLSC-like cells could be obtained from FF-iPSCs using the OF-iPDLSC differentiation method.

Materials and Methods

Cell culture

iPSCs were obtained from RIKEN (Ibaraki, Japan; HPS 0063). This iPSc line was established from skin fibroblasts from a 36-year-old healthy woman. OF-iPSCs were cultured on MEFs (ReproCELL, Kanagawa, Japan) and maintained in primate embryonic stem cell medium (serum-free; ReproCELL) containing 5 ng/mL human recombinant basic fibroblast growth factor (b-FGF; ReproCELL). FF-iPSCs were cultured on dishes coated with iMatrix-511 (Nippi, Tokyo, Japan) using StemFit AK03N Medium (serum-free; Ajinomoto, Tokyo, Japan). HPDLCs were isolated from the third molar of a healthy 25-year-old female patient at Kyushu University. The HPDLCs were cultured in alpha-minimum essential medium (α-MEM; Gibco-BRL, Grand Island, NY, USA) supplemented with 50U/µL penicillin and 50 µg/mL streptomycin (Wako, Osaka, Japan), as well as 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) (10% FBS/α-MEM). For this study, HPDLCs from passages 6 through 8 were used. All procedures adhered to the principles outlined in the Declaration of Helsinki and were conducted in accordance with the guidelines of the Research Ethics Committee of Kyushu University Certified Institutional Review Board for Clinical Trials (Approval No. 2–115, issued on August 10, 2020).

Differentiation of OF/FF-iPSCs into neural crest-like cells

OF/FF-iPSCs were differentiated into OF/FF-neural crest-like cells (OF/FF-iNCCs) using an established method.^13,14 Briefly, OF-iPSCs were dissociated into single cells with Accutase (Nacalai Tesque, Kyoto, Japan) and cultured on Matrigel-coated dishes (1 × 10⁵ cells/3.5 cm dish) using MEF-conditioned medium supplemented with 10 mM Y-27632 (Rho-associated coiled-coil containing kinase/Rho-binding kinase inhibitor; Enzo Life Sciences, Farmingdale, NY, USA) and 10 ng/mL b-FGF. After the cultures reached 50%–70% confluence, cells were cultured in KnockOut Serum Replacement medium (serum-free) and neurobasal medium (serum-free) supplemented with Noggin (PeproTech, Inc., Rocky Hill, NJ, USA) and SB431542 (TGF-β inhibitor; Tocris, Minneapolis, MN, USA).¹³ After 12–13 days, cells expressing p75NTR, a neural crest marker, were isolated by MACS (Miltenyi Biotec, Bergisch Gladbach, Germany). The isolated cells were named OF-iNCCs.

FF-iPSCs (1.3 × 10⁴ cells/well) were seeded in a six-well plate (Corning Incorporated, Corning, NY, USA) coated with iMatrix-511 and cultured in StemFit AK03N Medium containing 10 mM Y-27632. The following day and 3 days later, the medium was changed to StemFit AK03N Medium without Y-27632. After 4 days, cells were cultured in AK03N Medium supplemented with 10 μM SB431542 (Fujifilm Wako) and 1 µM CHIR99021 (GSK-3 inhibitor; Axon Medchem, Reston, VA, USA) for 10 days. The medium was changed every 3 days (days 0–6) and then every 2 days (days 7–10).¹⁴ The resulting cells were named FF-iNCCs.

Differentiation of OF/FF-iNCCs into OF/FF-iPDLSCs

HPDLCs were seeded in 24-well plates in 10% FBS/α-MEM (1.0 × 10⁴ cells/well). After 4 days, detachment was achieved using 2% ethylenediaminetetraacetic acid (EDTA; Nacalai Tesque) in phosphate-buffered saline (PBS) to obtain dishes coated with ECM. OF-iNCCs (1.0 × 10⁵ cells/well) and FF-iNCCs (1.0 × 10⁴ cells/well) were seeded on these HPDLC-derived ECM-coated dishes; the cells were cultured for 2 weeks and named OF-iPDLSCs and FF-iPDLSCs, respectively.

Quantitative reverse transcription polymerase chain reaction

Total cellar RNA was isolated with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using a KAPA SYBR Fast qPCR kit (Nippon Genetics, Tokyo, Japan) in a Thermal Cycler Dice Real Time System (Takara Bio Inc., Shiga, Japan). Primer sequences, product sizes, and annealing temperatures for each gene are listed in Table 1. β-actin was used as an internal control. The expression levels of the target genes were determined by calculation of ΔΔCt values.

Table 1.

Primer Sequences, Product Sizes, and Annealing Temperatures for Quantitative Reverse Transcription Polymerase Chain Reaction

Target genes (abbreviation)	Forward (top) and reverse (bottom) primer sequences	Size of amplified products (bp)	Annealing temperature (C)
β-actin	ATTGCCGACAGGATGCAGA	89	60
β-actin	GAGTACTTGCGCTCAGGAGGA	89	60
ADIPSIN	GTGCGCGGAGAGCAATCG	131	60
ADIPSIN	AGATCCCGGGCTTCTTGCG	131	60
BMP2	TCCACTAATCATGCCATTGTTCA	73	60
BMP2	GGGACACAGCATGCCTTAGGA	73	60
BSP	CTGGCACAGGGTATACAGGGTTAG	181	60
BSP	ACTGGTGCCGTTTATGCCTTG	181	60
COL1	CCCGGGTTTCAGAGACAACTTC	148	60
COL1	TCCACATGCTTTATTCCAGCAATC	148	60
FBN2	AATGTGGGTCTCAACCTTCG	186	60
FBN2	CTGTAGCCACCCAGGATGTT	186	60
LPL	GACTCGTTCTCAGATGCCCT	145	60
LPL	ACTTCAGGCAGAGTGAATGGG	145	60
MKX	CATCGTCATCAGAAACTGAAGGCA	89	60
MKX	TCTGTTAGCTGCGCTTTCACCC	89	60
NANOG	TCCAACATCCTGAACCTCAGCTA	193	60
NANOG	AGGTTCCCAGTCGGGTTCAC	193	60
Nestin	TGGCCACGTACAGGACCCTCC	142	60
Nestin	AGATCCAAGACGCCGGCCCT	142	60
Oct3/4	GCAATTTGCCAAGCTCCTGAA	114	60
Oct3/4	GCAGATGGTCGTTTGGCTGA	114	60
ΟPG	TGGCACCAAAGTAAACGCAGAG	195	60
ΟPG	CTCGAAGGTGAGGTTAGCATGTC	195	60
PLAP1	ATGGGAGTCTTGCTAACATACCAC	154	60
PLAP1	CAGAAGTCATTTACTCCCACTCTTG	154	60
PPARγ	TATTCTCAGTGGAGACCGCC	115	60
PPARγ	TGAGGACTCAGGGTGGTTCA	115	60
p75NTR	CCGAGGCACCACCGACAACC	107	60
p75NTR	TGCTTGCAGCTGTTCCACCTCT	107	60
SOST	AGCTGGAGAACAACAAGACCA	93	60
SOST	AGCTGTACTCGGACACGTCTT	93	60

BMP2, bone morphogenetic protein 2; BSP, bone sialoprotein; COL1, collagen I; FBN2, fibrillin-2; LPL, lipoprotein lipase; MKX, Mohawk; OPG, osteoprotegerin; PLAP1, periodontal ligament-associated protein 1; PPARγ, peroxisome proliferator-activated receptor γ; SOST, sclerostin.

Immunofluorescence staining

OF/FF-iPSCs, iNCCs, and iPDLSCs were fixed with 4% paraformaldehyde (Nacalai Tesque) and 0.5% dimethyl sulfoxide (Nacalai Tesque) in PBS. Subsequently, cells were permeabilized with 0.3% Triton X-100 (Nacalai Tesque) in PBS, then blocked with 2% bovine serum albumin (BSA; Nacalai Tesque) in PBS. Cells were incubated overnight at 4°C with antihuman NANOG antibody (Abcam, Inc., Cambridge, MA, USA) and antihuman Nestin antibody (Novus Biologicals, Centennial, CO, USA). OF/FF-iPDLSCs were also incubated with antihuman osteoprotegerin (OPG) antibody (Abcam) and antihuman COL1 antibody (Abcam). Normal rabbit IgG (Cell Signaling Technology, Danvers, MA, USA) or normal chicken IgY control (R&D Systems, Minneapolis, MN, USA) was used as a control for each antibody. Next, cells were incubated with an Alexa Fluor 488-conjugated chicken antirabbit antibody, Alexa Fluor 647-conjugated goat antirabbit antibody, or Alexa Fluor 488-conjugated goat antichicken antibody (Invitrogen). The nuclei were stained with 4′,6-diamidino-2-phenylindole (Nacalai Tesque). Stained cells were imaged and analyzed using a Keyence BZ-X700 microscope (Keyence Corporation, Osaka, Japan).

Flow cytometry analysis

OF/FF-iPDLSCs were detached using Accutase, adjusted to a density of 5 × 10⁵ cells/tube, and then incubated with R-phycoerythrin-conjugated mouse antihuman antibodies targeting CD34, CD45, CD90, CD105, CD146 (all from BioLegend, San Diego, CA, USA), IgG1, or IgG2a (both from iCyte, Tokyo, Japan) for 45 min at 4°C. The percentages of positive cells were assessed by flow cytometry (EC800 Cell Analyzer; Sony, Tokyo, Japan) and Eclipse software (Sony).

Proliferation assay

OF/FF-iPDLSCs were seeded in a 48-well plate (5 × 10³ cells/well). Subsequently, on days 0, 1, 2, 3, proliferation was assessed using a water-soluble tetrazolium (WST)-1 cell proliferation assay kit (Takara Bio, Inc.) according to the manufacturer’s protocol. The supernatant was collected from each well and subjected to measurement of optical density at 450 nm using an iMark microplate reader (Bio-Rad Laboratories, Hercules, CA, USA).

Osteoblast differentiation

OF/FF-iPDLSCs (2 × 10⁴ cells/well) were seeded in a 24-well plate and cultured in 10% FBS/α-MEM. After cells had reached confluence, the culture medium was changed to osteoblast differentiation medium, consisting of 10% FBS/α-MEM supplemented with 50 µg/mL ascorbic acid (Nacalai Tesque) and 2 µM β-glycerophosphate (Sigma-Aldrich). After 4 weeks of culture, Alizarin Red S staining was performed. Images of stained cells were captured with a Keyence BZ-9000 microscope (Keyence Corporation); areas of positive staining were measured using BZ-X Analyzer Software (Keyence Corporation).

Adipocyte differentiation

OF/FF-iPDLSCs (2 × 10⁴ cells/well) were seeded in a 24-well plate and cultured in 10% FBS/α-MEM. After cells had reached confluence, the culture medium was changed to adipocyte differentiation medium, consisting of 10% FBS/α-MEM supplemented with 1% L-glutamine (Nacalai Tesque), 0.1 mM L-ascorbic acid (Fujifilm Wako), 1 mM sodium pyruvate solution (Nacalai Tesque), 10 µM hydroxyethyl-piperazinyl ethanesulfonic acid (Nacalai Tesque), 60 µM indomethacin (Sigma-Aldrich), and 10⁻⁷ M dexamethasone (Merck Millipore, Darmstadt, Germany). After 3 weeks of culture, Oil Red O staining was performed. Fatty lipids were imaged with a Keyence BZ-9000 microscope and the number of Oil Red O-positive cells was determined using BZ-X Analyzer Software. Nine fields were randomly selected for quantification of positive cells.

Subcutaneous implantation of FF-iPDLSCs in immunodeficient mice

FF-iPDLSCs (3 × 10⁶ cells) were mixed with 30 mg β-tricalcium phosphate (β-TCP) powder (OSferion; Olympus, Tokyo, Japan) and incubated at 37°C overnight. Next, the mixture was centrifuged and the supernatant was aspirated. The pellets were mixed with fibrinogen (Sigma-Aldrich) and thrombin (Sigma-Aldrich). Then, we made mid-longitudinal skin incisions on the dorsal surface of 6-week-old male immunodeficient mice (NOD SCID; Nihon Crea, Tokyo, Japan) and separated the skin bluntly from the muscle to form a pocket. Finally, the construct was placed into each pocket. As a control, cell-free β-TCP was transplanted.

After 8 weeks, the mice were sacrificed; harvested tissues were fixed with 4% paraformaldehyde and decalcified with 10% EDTA. Subsequently, the tissues were embedded in paraffin and sectioned at a thickness of 5 µm.

Histological analysis of FF-iPDLSCs

Sections were subjected to Masson’s trichrome staining or immunohistochemical staining. Briefly, sections were blocked with 2% BSA in PBS, then incubated at 4°C overnight with antihuman COL1 (1:250 dilution, Abcam), COL3 (1:1000 dilution, Cell Signaling Technology), OPG (1:4000 dilution, Abcam), OCN (1:2000 dilution, Invitrogen), Osterix (OSX; 1:500 dilution, Abcam), NuMA antibody (1:500 dilution, Abcam), and normal rabbit IgG (Cell Signaling Technology). Next, sections were incubated with biotinylated antirabbit IgG (Nichirei Biosciences, Tokyo, Japan), followed by an avidin–peroxidase conjugate (Nichirei Biosciences). Immunopositive reactions were identified using a simple diaminobenzidine staining solution (Nichirei Biosciences) and nuclei were counterstained with Mayer’s hematoxylin solution (Fujifilm Wako).

Statistical analysis

Statistical analysis was performed using unpaired two-tailed t-tests (for comparisons of two groups), one-way ANOVA followed by the Bonferroni method, or Kruskal–Wallis test followed by the Steel–Dwass method, (for comparisons of ≥3 groups). P values < 0.05 were considered statistically significant by EZR (Saitama Medical Center, Jichi Medical University, Saitama, Japan).

Results

Expression of iPSC and NCC markers in OF/FF-iPSCs, OF/FF-iNCCs, and OF/FF-iPDLSCs

We investigated whether FF-iNCCs and FF-iPDLSCs could acquire their specific morphologies under the culture conditions used in this study. FF-iNCCs exhibited a stellate-shaped morphology, whereas FF-iPDLSCs had a spindle-shaped morphology (Fig. 1A). FF-iNCCs and FF-iPDLSCs had morphologies similar to OF-iNCCs and OF-iPDLSCs, respectively. Next, to confirm the differentiation stage of iPSCs, we analyzed gene and protein expression patterns of iPSC markers (NANOG and OCT3/4) and NCC markers (Nestin and p75NTR). The expression levels of iPSC markers were significantly lower in OF/FF-iNCCs and OF/FF-iPDLSCs than in OF/FF-iPSCs (Fig. 1B). The expression levels of NCC markers were significantly higher in OF/FF-iNCCs than in other cell groups. Additionally, we analyzed protein expression levels of NANOG and Nestin in each cell type by immunofluorescence (Fig. 1C and D). NANOG expression was higher in OF/FF-iPSCs, while Nestin expression was higher in OF/FF-iNCCs compared to other cell types. These results suggested that the differentiation protocol used in this study could promote the differentiation of FF-iPSCs into FF-iNCCs, similar to the protocol for OF-iPSCs.

FIG. 1.

Expression of iPSC and NCC markers in OF/FF-iPSCs, OF/FF-iNCCs, and OF/FF-iPDLSCs. (A) Representative phase-contrast microscopic images of OF/FF-iPSCs, OF/FF-iNCCs, and OF/FF-iPDLSCs. (B) Quantitative RT-PCR analysis of iPS-related markers (NANOG and OCT3/4) and NC-related markers (Nestin and p75NTR). β-actin was used as an internal control. Data expressed as the median (interquartile range) (n = 4); **P < 0.01. (C, D) Immunocytochemical staining images of NANOG (C) and Nestin (D) in OF/FF-iPSCs, OF/FF-iNCCs, and OF/FF-iPDLSCs. Nuclei were counterstained with DAPI (blue). Bars = 100 µm. iPSC, induced pluripotent stem cell; NCC, neural crest-like cell; OF, on-feeder; FF, feeder-free; PDLSC, periodontal ligament stem cell; RT-PCR, reverse transcription polymerase chain reaction.

MSC marker expression and proliferation ability in OF/FF-iPDLSCs

We analyzed the expression patterns of MSC markers in OF/FF-iPDLSCs by flow cytometry. Both cell types showed high expression levels of the MSC markers CD90, CD105, and CD146. Intriguingly, we found that the proportions of CD105 and CD146 were higher in FF-iPDLSCs than in OF-iPDLSCs (Fig. 2A). Almost no CD34-positive and CD45-positive cells were observed in either cell type (Fig. 2B). Additionally, we measured proliferation ability in OF/FF-iPDLSCs using a WST-1 assay. There was no significant difference in proliferation ability between cell types (Fig. 2C).

FIG. 2.

Expression of MSC markers and proliferation ability in OF/FF-iPDLSCs. (A, B) Flow cytometric analysis of MSC-associated surface marker, CD90, CD105, and CD146 (A) and hematopoietic cell-associated surface marker, CD34 and CD45 (B) in OF/FF-iPDLSCs. (C) Proliferation of OF/FF-iPDLSCs was analyzed by WST-1 assay. Data expressed as the mean ± standard deviation (n = 4). MSC, mesenchymal stem cell; WST, water-soluble tetrazolium.

Multipotency of OF/FF-iPDLSCs

First, OF/FF-iPDLSCs were cultured in osteoblast differentiation medium and stained with Alizarin Red S to visualize mineralization (Fig. 3A). Both OF-iPDLSCs and FF-iPDLSCs showed significant staining compared to the control, but there was no difference between these two cell types (Fig. 3B). RT-PCR analysis revealed the expression of osteogenesis-related markers (BSP, BMP2, and sclerostin [SOST]) in each cell type and there was no significant difference between the cell types (Fig. 3C). Next, OF/FF-iPDLSCs were cultured in adipocyte differentiation medium. We stained these cells with Oil Red O and observed fatty lipids (Fig. 3D). Compared with OF-iPDLSCs, FF-iPDLSCs formed more fatty lipids (Fig. 3E). The expression levels of adipocyte-related markers (lipoprotein lipase [LPL], peroxisome proliferator-activated receptor-γ [PPARγ], and ADIPSIN) were higher in FF-iPDLSCs than in OF-iPDLSCs (Fig. 3F). These results suggested that FF-iPDLSCs had properties similar to OF-iPDLSCs in vitro.

FIG. 3.

Multipotency of OF/FF-iPDLSCs. (A) The formation of mineralized nodules in OF/FF-iPDLSCs was examined by Alizarin red S staining after culture in CM or ODM for 4 weeks (bars: 5 mm). (B) Positive area of Alizarin Red S staining was quantified. (C) Quantitative RT-PCR analysis of BSP, BMP2, and SOST in OF/FF-iPDLSCs after 4 weeks of culture in CM or ODM. (D) The fatty lipids in OF/FF-iPDLSCs were examined by Oil red O staining after culture in CM or ADM for 3 weeks (allow heads: fatty lipids, bars: 500 µm). (E) Numbers of Oil Red O-stained fatty lipids in OF/FF-iPDLSCs cultured in CM or ADM for 3 weeks. (F) Quantitative RT-PCR analysis of LPL, PPARγ, and ADIPSIN in OF/FF-iPDLSCs after 3 weeks of culture in CM or ADM. β-actin was used as an internal control. Data expressed as the mean ± standard deviation (n = 4); **P < 0.01. CM, control medium; ODM, osteoblast differentiation medium; ADM, adipocyte differentiation medium.

Expression of PDL-related markers in OF/FF-iPDLSCs

To determine whether FF-iPDLSCs have characteristics similar to OF-iPDLSCs, we analyzed the expression levels of PDL-related markers (OPG, PLAP1, COL1, Mohawk [MKX], and fibrillin-2 [FBN2]) in OF/FF-iPDLSCs via RT-PCR (Fig. 4A). The expression levels of PDL-related markers were significantly higher in FF-iPDLSCs than in OF-iPDLSCs. The protein expression levels of OPG and COL1 also were higher in FF-iPDLSCs (Fig. 4B).

FIG. 4.

Expression of PDL-related markers in OF/FF-iPDLSCs. (A) Quantitative RT-PCR analysis of expression levels of PDL-related genes (OPG, PLAP1, COL1, MKX, and FBN2). β-actin was used as an internal control. Data expressed as the mean ± standard deviation (n = 4); **P < 0.01. (B) Immunocytochemical staining images of OPG and COL1 in OF/FF-iPDLSCs. Nuclei were counterstained with DAPI (blue). Bars = 100 µm. OPG, osteoprotegerin.

Periodontal tissue formation of FF-iPDLSCs in vivo

Finally, we evaluated the periodontal tissue formation ability of FF-iPDLSCs in vivo. Eight weeks later after transplantation of FF-iPDLSCs, we observed fiber-like tissues connecting the β-TCP scaffolds (Fig. 5A). Fiber-like tissues (observed by Masson’s trichrome staining) exhibited COL1, COL3, and OPG expression (Fig. 5B–D). Immunostaining was performed using an antihuman OCN and OSX antibody, which identifies human bone/cementum; OCN and OSX-positive cells were observed around the scaffolds (Fig. 5E and F). In addition, immunostaining was performed using an anti-NuMA antibody that specifically stains human nuclei; this assay confirmed that FF-iPDLSCs were localized to the transplant site (Fig. 5G). We also confirmed co-localization of COL1 and NuMA (Supplementary Fig. S1) and found that COL1 was expressed not only in mouse cells but also in iPDLSCs. These results suggested that FF-iPDLSCs generated periodontal tissue-like structures in vivo. In control group, these tissues were not evident (Fig. 5I) and no expression of NuMA was observed (Fig. 5J).

FIG. 5.

Differentiation potential of FF-iPDLSCs in vivo. (A–H) Serial sections were in FF-iPDLSCs prepared transplanted for 8 weeks of FF-iPDLSCs. Sections were stained with Masson Trichrome (A). Other sections were immunostained with antihuman COL1 (B), antihuman COL3 (C), antihuman OPG (D), antihuman OCN (E), antihuman OSX (F), antihuman NuMA (G), and control rabbit IgG (H). (I–J) Serial sections in control group were prepared. Sections were stained with Masson’s trichrome (I). The other sections were immunostained with antihuman NuMA (J). Bars = 50 µm, *: β-TCP. n = 3. OSX, Osterix.

Discussion

In this study, we aimed to obtain FF-iPSC-derived PDLSCs that can be used in clinical applications. We found that FF-iPDLSCs exhibited characteristics similar to OF-iPDLSCs in vitro and formed PDL-like structures in vivo.

NCCs are stellate-shaped cells that express neural crest markers, such as p75NTR and Nestin.^15

–18 NCCs have also reported to differentiate into various cell types, such as craniofacial bone, Schwann, and smooth muscle cells.¹⁹ In our previous study, we could not differentiate OF-iPDLSCs directly from OF-iPSCs.¹² Those results suggested that it was important to differentiate iPSCs into iNCCs, which could then be used for differentiation into iPDLSCs. In this study, FF-iPSC-derived FF-iNCCs had a stellate morphology and expressed neural crest markers similar to OF-iNCCs. These findings suggested that the iNCCs required for iPDLSC differentiation could also be obtained from FF-iPSCs.

The MSC markers CD105 and CD146 are involved in regulating MSC pluripotency and proliferation.^20
–22 A previous study of mouse dermal fibroblasts revealed that, compared with CD105-negative cells, CD105-positive cells had a greater capacity for differentiation into osteoblasts and adipocytes.²³ In addition, CD146 was regarded as a key marker of PDLSCs during their initial characterization,³ and it has been reported that CD146-positive cells display multipotency and proliferation in various cell types, such as bone marrow MSCs and umbilical cord MSCs.^24
–26　FF-iPDLSCs, which abundantly expressed CD105 and CD146, demonstrated multipotency and proliferation; these results were consistent with previous reports. Moreover, the ability to differentiate into adipocytes was stronger among FF-iPDLSCs than among OF-iPDLSCs. These results might be related to the higher expression levels of CD105 and CD146 in FF-iPDLSCs than in OF-iPDLSCs.

PDL-related markers such as OPG, PLAP1, COL1, MKX, and FBN2 are known to be major components of PDL tissues.^27

–30 FF-iPDLSCs expressed higher levels of these markers compared with OF-iPDLSCs. Those results suggested that FF-iPDLSCs successfully differentiated into PDLSCs in vitro, similar to OF-iPDLSCs.

In this study, we focused on whether iNCCs differentiated from iPSCs in a FF condition could differentiate into PDLSC-like cells. However, we used HPDLC-derived ECM and serum medium in iPDLSC differentiation process. Using serum-free medium is crucial for safety and reliability in clinical applications, therefore completely xeno-free differentiation of iPDLSC is essential. We have previously hypothesized that the ECM derived from HPDLCs contains PDLSC-inducing factors. Thus, we have performed comprehensive analysis of HPDLCs and succeeded in identifying FBN2, one of the PDLSC-inducing factors.³¹ In the future, we plan to identify PDLSC-inducing factors other than FBN2 and establish a method to induce FF-iPDLSCs without using HPDLCs and serum medium.

Previous reports have shown that OCN and COL1 are expressed during subcutaneous transplantation of PDLSCs.^32
–34 Cementoblasts and osteoblasts have been reported to express OCN and OSX and these results supported our results.^35,36 In our previous studies, we have demonstrated that COL3 and OPG, as well as COL1, are PDL markers.^37,38 Thus, it was suggested that FF-iPDLSCs formed bone/cementum- and PDL-like tissues in vivo and FF-iPDLSCs might be useful for periodontal tissue regeneration. However, to evaluate the periodontal tissue regeneration ability of FF-iPDLSCs, it is necessary to transplant these cells into injured periodontal tissue. Previous studies reported that scaffold materials such as collagen hydrogel, poly lactic-co-glycolic acid, and apatite-coated silk fibroin were used when transplanting cells into periodontal tissue.^39
–41 In addition, growth factors such as b-FGF, platelet-rich fibrin, and the bone morphogenetic factor 6 were suggested to promote periodontal tissue regeneration.^42

–45 In the future, it will be necessary to identify scaffolds and growth factors suitable for FF-iPDLSCs, then transplant these components into models of periodontal tissue injury.

Conclusions

In conclusion, we found that FF-iPDLSCs had properties similar to OF-iPDLSCs in vitro and formed periodontal tissue-like structures in vivo, suggesting that PDLSCs can differentiated induced from FF-iPSCs. These results may lead to the development of novel periodontal tissue regeneration therapies.

Footnotes

Acknowledgments

We thank Drs. Obata, Yoshida, Kaneko, Kinoshita, Kadowaki, Nagano, Safwan, Tashita, Toraya, Kidsen, and Bara for their great support in the preparation of this work and we appreciate the technical assistance from The Joint Use Laboratories, Faculty of Dental Science, Kyushu University. We also thank Michelle Kahmeyer-Gabbe, PhD, from the Edanz Group () for editing a draft of this article.

Author Disclosure Statement

The authors declare that there is no conflict of interest regarding the publication of this article.

Funding

This work was financially supported by Grants-in-Aid for Scientific Research (Project Nos. JP21K09876, JP22H03270, JP23K09171) from the Japan Society for the Promotion of Science.

Supplementary Material

Supplementary Data S1

Supplementary Figure S1

References

Carnes

, Maeder

, Graves

. Cells with osteoblastic phenotypes can be explanted from human gingiva and periodontal ligament. J Periodontol, 1997; 68:701–707; doi: 10.1902/jop.1997.68.7.701

Nagatomo

, Komaki

, Sekiya

, et al. Stem cell properties of human periodontal ligament cells. J Periodontal Res, 2006; 41:303–310; doi: 10.1111/j.1600-0765.2006.00870.x

Seo

, Miura

, Gronthos

, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet, 2004; 364:149–155; doi: 10.1016/S0140-6736(04)16627-0

Ivanovski

, Gronthos

, Shi

, et al. Stem cells in the periodontal ligament. Oral Dis, 2006; 12:358–363; doi: 10.1111/j.1601-0825.2006.01253.x

Liu

, Zheng

, Ding

, et al. Periodontal ligament stem cell-mediated treatment for periodontitis in miniature swine. Stem Cells, 2008; 26:1065–1073; doi: 10.1634/stemcells.2007-0734

Feng

, Akiyama

, Liu

, et al. Utility of PDL progenitors for in vivo tissue regeneration: A report of 3 cases. Oral Dis, 2010; 16:20–28; doi: 10.1111/j.1601-0825.2009.01593.x

Takahashi

, Yamanaka

. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006; 126:663–676; doi: 10.1016/j.cell.2006.07.024

Kasamoto

, Funakoshi

, Hatani

, et al. Am80, a retinoic acid receptor agonist, activates the cardiomyocyte cell cycle and enhances engraftment in the heart. Stem Cell Rep, 2023; 18:1672–1685; doi: 10.1016/j.stemcr.2023.06.006

Ikuno

, Masumoto

, Yamamizu

, et al. Correction: Efficient and robust differentiation of endothelial cells from human induced pluripotent stem cells via lineage control with VEGF and cyclic AMP. PLoS One, 2017; 12:e0176238; doi: 10.1371/journal.pone.0176238

10.

Goparaju

, Kohda

, Ibata

, et al. Rapid differentiation of human pluripotent stem cells into functional neurons by mRNAs encoding transcription factors. Sci Rep, 2017; 7:42367; doi: 10.1038/srep42367

11.

Nakagawa

, Taniguchi

, Senda

, et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep, 2014; 4:3594; doi: 10.1038/srep03594

12.

Hamano

, Tomokiyo

, Hasegawa

, et al. Extracellular matrix from periodontal ligament cells could induce the differentiation of induced pluripotent stem cells to periodontal ligament stem cell-like cells. Stem Cells Dev, 2018; 27:100–111; doi: 10.1089/scd.2017.0077

13.

Lee

, Chambers

, Tomishima

, et al. Derivation of neural crest cells from human pluripotent stem cells. Nat Protoc, 2010; 5:688–701; doi: 10.1038/nprot.2010.35

14.

Kamiya

, Takenaka-Ninagawa

, Motoike

, et al. Induction of functional xeno-free MSCs from human iPSCs via a neural crest cell lineage. NPJ Regen Med, 2022; 7:47; doi: 10.1038/s41536-022-00241-8

15.

Widera

, Zander

, Heidbreder

, et al. Adult palatum as a novel source of neural crest-related stem cells. Stem Cells, 2009; 27:1899–1910; doi: 10.1002/stem.104

16.

Bogenmann

, Thomas

, Li

, et al. Generation of mice with a conditional allele for the p75(NTR) neurotrophin receptor gene. Genesis, 2011; 49:862–869; doi: 10.1002/dvg.20747

17.

Tomokiyo

, Hynes

, Ng

, et al. Generation of neural crest-like cells from human periodontal ligament cell-derived induced pluripotent stem cells. J Cell Physiol, 2017; 232:402–416; doi: 10.1002/jcp.25437

18.

Shi

, Zhang

, Qiang

, et al. Mesenspheres of neural crest-derived cells enriched from bone marrow stromal cell subpopulation. Neurosci Lett, 2013; 532:70–75; doi: 10.1016/j.neulet.2012.10.042

19.

Mehrotra

, Tseropoulos

, Bronner

, et al. Adult tissue-derived neural crest-like stem cells: Sources, regulatory networks, and translational potential. Stem Cells Transl Med, 2020; 9:328–341; doi: 10.1002/sctm.19-0173

20.

Monterubbianesi

, Bencun

, Pagella

, et al. A comparative in vitro study of the osteogenic and adipogenic potential of human dental pulp stem cells, gingival fibroblasts and foreskin fibroblasts. Sci Rep, 2019; 9:1761; doi: 10.1038/s41598-018-37981-x

21.

Russell

, Phinney

, Lacey

, et al. In vitro high-capacity assay to quantify the clonal heterogeneity in trilineage potential of mesenchymal stem cells reveals a complex hierarchy of lineage commitment. Stem Cells, 2010; 28:788–798; doi: 10.1002/stem.312

22.

Aslan

, Zilberman

, Kandel

, et al. Osteogenic differentiation of noncultured immunoisolated bone marrow-derived CD105+ cells. Stem Cells, 2006; 24:1728–1737; doi: 10.1634/stemcells.2005-0546

23.

Lee

, Shim

, Kim

, et al. Identification of a distinct subpopulation of fibroblasts from murine dermis: CD73(-) CD105(+) as potential marker of dermal fibroblasts subset with multipotency. Cell Biol Int, 2016; 40:1008–1016; doi: 10.1002/cbin.10623

24.

Tran

, Kim

, Oh

, et al. CD49f and CD146: A possible crosstalk modulates adipogenic differentiation potential of mesenchymal stem cells. Cells, 2023; 13; doi: 10.3390/cells13010055

25.

Baksh

, Yao

, Tuan

. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells, 2007; 25:1384–1392; doi: 10.1634/stemcells.2006-0709

26.

Fayazi

, Salehnia

, Ziaei

. The effect of stem cell factor on proliferation of human endometrial CD146(+) cells. Int J Reprod Biomed, 2016; 14:437–442.

27.

, Liu

, et al. Periodontal ligament-associated protein-1 gets involved in experimental periodontitis. J Periodontal Res, 2019; 54:180–189; doi: 10.1111/jre.12618

28.

Wada

, Maeda

, Tanabe

, et al. Periodontal ligament cells secrete the factor that inhibits osteoclastic differentiation and function: The factor is osteoprotegerin/osteoclastogenesis inhibitory factor. J Periodontal Res, 2001; 36:56–63; doi: 10.1034/j.1600-0765.2001.00604.x

29.

Kondo

, Sawada

, Shibayama

, et al. Elastic system fibers in rat incisor periodontal ligament–immunohistochemical study using sections of fresh-frozen un-demineralized tissues. Acta Histochem, 2011; 113:125–130; doi: 10.1016/j.acthis.2009.09.002

30.

Ito

, Toriuchi

, Yoshitaka

, et al. The Mohawk homeobox gene is a critical regulator of tendon differentiation. Proc Natl Acad Sci U S A, 2010; 107:10538–10542; doi: 10.1073/pnas.1000525107

31.

Hamano

, Yamashita

, Hasegawa

, et al. Effect of fibrillin-2 on differentiation into periodontal ligament stem cell-like cells derived from human-induced pluripotent stem cells. Stem Cells Dev, 2024; 33:228–238; doi: 10.1089/scd.2024.0013

32.

Wen

, Yang

, Wu

, et al. COL4A2 in the tissue-specific extracellular matrix plays important role on osteogenic differentiation of periodontal ligament stem cells. Theranostics, 2019; 9:4265–4286; doi: 10.7150/thno.35914

33.

Zhang

, Gong

, Cai

, et al. A composite membrane with microtopographical morphology to regulate cellular behavior for improved tissue regeneration. Acta Biomater, 2023; 168:125–143; doi: 10.1016/j.actbio.2023.06.046

34.

Cha

, Jeon

, Lee

, et al. Effects of in vitro osteogenic induction on in vivo tissue regeneration by dental pulp and periodontal ligament stem cells. J Endod, 2015; 41:1462–1468; doi: 10.1016/j.joen.2015.04.010

35.

Nakashima

, Zhou

, Kunkel

, et al. The novel zinc finger-containing transcription factor Osterix is required for osteoblast differentiation and bone formation. Cell, 2002; 108:17–29; doi: 10.1016/s0092-8674(01)00622-5

36.

Sugii

, Yoshida

, Albougha

, et al. 4-META/MMA-TBB resin containing nano hydroxyapatite induces the healing of periodontal tissue repair in perforations at the pulp chamber floor. Cell Biochem Funct, 2024; 42:e4058; doi: 10.1002/cbf.4058

37.

Fujii

, Maeda

, Wada

, et al. Investigating a clonal human periodontal ligament progenitor/stem cell line in vitro and in vivo. J Cell Physiol, 2008; 215:743–749; doi: 10.1002/jcp.21359

38.

Hamano

, Tomokiyo

, Hasegawa

, et al. Functions of beta2-adrenergic receptor in human periodontal ligament cells. J Cell Biochem, 2020; 121:4798–4808; doi: 10.1002/jcb.29706

39.

Zong

, Van Holm

, Bronckaers

, et al. Biomimetic periodontal ligament transplantation activated by gold nanoparticles protects alveolar bone. Adv Healthc Mater, 2023; 12:e2300328; doi: 10.1002/adhm.202300328

40.

Akita

, Kano

, Saito-Tamura

, et al. Use of rat mature adipocyte-derived dedifferentiated fat cells as a cell source for periodontal tissue regeneration. Front Physiol, 2016; 7:50; doi: 10.3389/fphys.2016.00050

41.

Duan

, Tu

, Zhang

, et al. Application of induced pluripotent stem (iPS) cells in periodontal tissue regeneration. J Cell Physiol, 2011; 226:150–157; doi: 10.1002/jcp.22316

42.

Ding

, Kang

, Li

, et al. An in situ tissue engineering scaffold with growth factors combining angiogenesis and osteoimmunomodulatory functions for advanced periodontal bone regeneration. J Nanobiotechnology, 2021; 19:247; doi: 10.1186/s12951-021-00992-4

43.

Ding

, Li

, Zhang

, et al. Super-assembled core/shell fibrous frameworks with dual growth factors for in situ cementum-ligament-bone complex regeneration. Biomater Sci, 2020; 8:2459–2471; doi: 10.1039/d0bm00102c

44.

Duan

, Lin

, et al. Study of platelet-rich fibrin combined with rat periodontal ligament stem cells in periodontal tissue regeneration. J Cell Mol Med, 2018; 22:1047–1055; doi: 10.1111/jcmm.13461

45.

Chien

, Chang

, Wang

, et al. Promoting induced pluripotent stem cell-driven biomineralization and periodontal regeneration in rats with maxillary-molar defects using injectable BMP-6 hydrogel. Sci Rep, 2018; 8:114; doi: 10.1038/s41598-017-18415-6