Virulence of Bacteria Colonizing Vascular Bundles in Ischemic Lower Limbs

Abstract

Background:

We documented previously the presence of bacterial flora in vascular bundles, lymphatics, and lymph nodes of ischemic lower limbs amputated because of multifocal atheromatic changes that made them unsuitable for reconstructive surgery and discussed their potential role in tissue destruction. The question arose why bacterial strains inhabiting lower limb skin and considered to be saprophytes become pathogenic once they colonize deep tissues. Bacterial pathogenicity is evoked by activation of multiple virulence factors encoded by groups of genes.

Methods:

We identified virulence genes in bacteria cultured from deep tissue of ischemic legs of 50 patients using a polymerase chain reaction technique.

Results:

The staphylococcal virulence genes fnbA (fibronectin-binding protein A), cna (collagen adhesin precursor), and ica (intercellular adhesion) were present in bacteria isolated from both arteries and, to a lesser extent, skin. The IS256 gene, whose product is responsible for biofilm formation, was more frequent in bacteria retrieved from the arteries than skin bacteria. Among the virulence genes of Staphylococcus epidermidis encoding autolysin atlE, icaAB (intercellular adhesion), and biofilm insert IS256, only the latter was detected in arterial specimens. Bacteria cultured from the lymphatics did not reveal expression of eta and IS256 in arteries. The Enterococcus faecalis asa 373 (aggregation substance) and cylA (cytolysin activator) frequency was greater in arteries than in skin bacteria, as were the E. faecium cyl A genes. All Pseudomonas aeruginosa virulence genes were present in bacteria cultured from both the skin and arteries. Staphylococci colonizing arterial bundles and transported to tissues via ischemic limb lymphatics expressed virulence genes at greater frequency than did those dwelling on the skin surface. Moreover, enterococci and Pseudomonas isolated from arterial bundles expressed many virulence genes.

Conclusions:

These findings may add to the understanding of the mechanism of development of destructive changes in lower limb ischemic tissues by the patient's, but not hospital-acquired, bacteria, as well as the generally unsatisfactory results of antibiotic administration in these cases. More aggressive antibiotic therapy targeted at the virulent species should be applied.

The changes observed in the tissues of legs with atherosclerotic obstruction of arteries are the result of insufficient blood perfusion and also of infective processes leading to foot-tissue inflammation. Most studies on arterial microbiology have been devoted to the role of bacterial factors in the pathogenesis of atherosclerosis, as the atherogenic process resembles many aspects of chronic inflammation [1], a response that may be promoted by microorganisms [2 –4]. However, much less attention has been paid to the nosocomial infections, which may impose a secondary insult to arteries and limb soft tissues. Colonization of limb vascular bundles by microorganisms penetrating the foot skin may take place, either directly along the perivascular spaces or through the lymphatics draining the foot skin and running along large arteries and veins [5]

We documented in our previous studies the presence of bacterial flora in the vascular bundles, lymphatics, and lymph nodes of ischemic lower limbs amputated because of multifocal atheromatic changes that were unsuitable for reconstructive surgery [5]. Specimens of atherosclerotic calf and femoral arteries contained bacteria in more than 50% of cases and their DNA in more than 65%. Moreover, the lymphatics contained bacterial cells in 76% of specimens. The isolates from limb arteries and lymphatics were most often coagulase-negative staphylococci and Staphylococcus aureus. However, other highly pathogenic strains also were detected. Furthermore, immunohistopathological evaluation of the arterial walls and periarterial tissue showed dense focal infiltrates of granulocytes and macrophages. The conclusion was that bacteria can be responsible for dense neutrophil and macrophage infiltrates in atherosclerotic walls and periarterial tissue leading to inflammation, including necrosis, of ischemic tissues. The bacteria recovered belonged to the saprophytic flora. Nevertheless, they originated from tissues with overt inflammation. Thus, the question arose how pathogenic these species can become once they penetrate the epidermis and locate in deep tissues. Bacterial pathogenicity is evoked by the presence of multiple virulence factors encoded by groups of genes present in the chromosome and pathogenicity islands that interact in various combinations [7 –9].

In this paper, we present data on the presence of virulence genes in the staphylococci, enterococci, and Pseudomonas spp. isolated from the vascular bundles of ischemic lower limbs and discuss their possible role in the periarterial inflammatory and necrotic changes. To analyze the effect of change by bacteria of their environment from skin to deep tissues on the expression of specific virulence genes, such genes were identified in species harvested from the skin surface and arterial bundles. The frequency of bacteria in the two sources was compared.

Patients and Methods

Approvals

The consent of the Warsaw University Medical Ethics Committee was obtained for this study. Informed conscious consent was received from all patients before limb amputation.

Patients

Fragments of popliteal and femoral arteries were obtained from 50 patients with atherosclerosis of the legs who underwent either popliteal or femoral artery thrombendarterectomy or some degree of limb amputation because of multifocal obstruction of calf arteries resulting in intractable pain and the initial stage of foot dry necrosis limited to the big toe becoming white-blue. Arteriography was performed in each patient. Leg lymphatics were harvested from 21 amputated limbs as potential conductivity channels for bacterial colonization of vascular bundles from the foot skin. The age range in all groups was 55 to 76 y (mean 62 y). Of the patients, 66% were men.

Patients were admitted to the hospital as they showed up in the admission room. Excluded were patients with overt diabetes mellitus, usually presenting with foot ulcers. All patients received amoxicillin-clavulanic acid (Augmentin) and metronidazole for at least 7 d before the material was harvested. No patient received long-term antibiotic therapy prior to admission. Epidemiologic studies in the surgical department did not detect methicillin-resistant S. aureus (MRSA) as a possible source of additional infection for admitted patients.

Collection of human tissue

Arteries

All procedures were carried out in the operating room under strictly aseptic conditions. Fragments of vascular bundles of the popliteal and femoral arteries were harvested. Specimens were divided into two parts: One was used for bacteriological culture, another for bacterial DNA detection. Material for bacteriological studies was placed in transport medium, that for microbial DNA was frozen at −70°C in dry ice and stored until further use.

Foot skin and calf Lymphatics

A 1 × 1-cm sample of non-disinfected skin was excised. Patent Blue 0.5 mL was injected into the toe web and sole subcutaneous space, and the site of injection was massaged for 3 min. The colored superficial and deep lymphatics running along large vessels were then dissected.

Bacteriological culture

The following media were used: Hemoline liquid medium (Biomérieux, Marcy l'Etoile, France), Columbia blood agar base enriched with 5% sterile defibrinated sheep blood, MacConkey's agar, Chapman's agar, Sabouraud's agar (malt agar), and brain heart infusion (BHI) (all from DIFCO, Detroit, MI).

The cultures were performed as published previously [1] Specimens were incubated at 37°C and examined at 24 and 48 h for aerobic bacterial growth. In cases where there was no aerobic growth, additional cultures were established for anaerobic isolation. The organisms recovered were identified by standard procedures using the Analytical Profile Identification (API) System (Biomérieux). Aerobic cocci of the Micrococaccae family were identified using the API-Staph system. Gram-negative bacilli were identified using the API 20E technique. Gram-positive spore-forming bacilli were identified by evaluating the fermentation of sugars or polyalcohols. The sensitivity of the isolated bacterial strains to antibiotics was examined using the ATB-Plus system (Biomérieux).

Virulence genes

The Staphylococcus genes mecA (conferring resistance to β-lactams), IS256 (responsible for biofilm formation), etaA (exfoliative toxin A), fnba (fibronectin-binding protein A), etd (exfoliative toxin D), cna (collagen adhesin precursor), icaAB (cell proliferation and production of polysaccharide intercellular adhesion molecule), and atlE (rapid initial attachment of the bacteria to polymer surfaces via a surface-associated protein) were sought. For enterococci, we tested for esp (surface adhesion), ace (collagen-binding antigen), cylA (cytolysin activator), gelE (gelatinase), and asa and asa373 (aggregation substance). For Pseudomonas, we tested for lecA (lectins playing a role in adhesion), algR (alginate facilitating bacterial dissemination), phzA1 (phenazine synthesis), toxR and toxA (exotoxin A and exoenzyme S), lasB (protease), and plcH (hemolytic phospholipase C).

DNA isolation

Isolation of genomic DNA was performed with a kit (EurX, Gdansk, Poland). Proteinase K was added to release the DNA. The sample was bound to GeneMATRIX, and elution was carried out using Tris-EDTA. For gene amplification, we used the primers listed in Table 1. The reaction conditions were denaturation at 95°C for 10 min; 30 cycles of denaturation at 95°C for 30 sec, primers T^m for 1 min, elongation at 72°C for 30 sec; and final elongation at 72°C for 10 min.

Table 1.

Primers Used for Identification of Virulence Genes of Staphylococci, Enterococci, and Pseudomonas

Virulence genes	Primer sequence	T_m (°C)	Bacterial species
MecA310	F 5′-GTAGAAATGACTGAACGTCCGATAA	54	Staphylococcus
	R 5′-CCAATTCCACATTGTTTCGGTCTAA
IS256	F 5′-ATGTAGGTCCATAAGAACGGC	52	Staphylococcus
	R 5′-TGAAAAGCGAAGAGATTCAAAGC
EDIN	F 5′-GAAGTATCTAATACTTCTTTAGCAGC	53,2	Staphylococcus
	R 5′-TCATTTGACAATTCTACACTTCCAAC
etaA	F 5′-ACTGTAGGAGCTAGTGCATTTGT	54	Staphylococcus
	R 5′-TGGATACTTTTGTCTATCTTTTTCATCAAC
fnba	F 5′-CACAACCAGCAAATATAG	45	Staphylococcus
	R 5′-CTGTGTGGTAATCAATGTC
etd	F 5′-CGCAAATACATATGAAGAATCTGA	44	Staphylococcus
	R 5′-TGTCACCTTGTTGCAAATCTATAG
cna	F 5′-AGTGGTTACTAATACTG	39,8	Staphylococcus
	R 5′-CAGGATAGATTGGTTTA
icaAB	F 5′-TTATCAATGCCGCAGTTGTC	50	Staphylococcus
	R 5′-GTTTAACGCGAGTGCGCTAT
atlE	F 5′-CAACTGCTCAACCGAGAACA	51,8	Staphylococcus
	R 5′-GTTTAACGCGAGTGCGCTAT
esp	F 5′-TTGCTAATGCTAGTCCACGACC	56	Enterococcus
	R 5′-GCGTCAACACTTGCATTGCCGAA
ace	F 5′-GGAATGACCGAGAACGATGGC	57	Enterococcus
	R 5′-GCTTGATGTTGGCCTGCTTCCG
cylA	F 5′-GACTCGGGGATTGATAGGC	53,5	Enterococcus
	R 5′-GCTGCTAAAGCTGCGCTTAC
gelE	F 5′-ACCCCGTATCATTGGTTT	45,8	Enterococcus
	R 5′-ACGCATTGCTTTTCCATC
asa	F 5′-CCAGCCAACTATGGCGGAATC	55	Enterococcus
	R 5′-CCTGTCGCAAGATCGACTGTA
asa373	F 5′-GGACGCACGTACACAAAGCTAC	55	Enterococcus
	R 5′-CTGGGTGTGATTCCGCTGTTA
lecA	F 5′-CGATGTCATTACCATCGTCG	51	Pseudomonas
	R 5′-TGATTGCACCCTGGACATTA
algR	F 5′ AGGGCAACTGGACGGCTATC	54	Pseudomonas
	R 5′ TGTGGTCGGCAATGAAGAAGA
phzA1	F 5′-ACCACTTCTGGGTCGAGTG	53,8	Pseudomonas
	R 5′-GTGGGAATACCGTCACGTTT
toxR	F 5′-ATGGCATCTATGCGAGGAAC	51,8	Pseudomonas
	R 5′-CAGGGGAATGAAGTTCTTG
toxA	F 5′-TCAGGGCGCACGAGAGCAACGAGA	64	Pseudomonas
	R 5′-GACAGCCGCGCCGCCAGGTAGAGG
plcH	F 5′-CGACGAGGGCGACGGCTTCTATGA	63	Pseudomonas
	R 5′-CCGGGCAGGCTCTTGGGCTCGTA
lasB	F 5′-ACTGTCGCGGCCGCATTTCGTCAT	62	Pseudomonas
	R 5′-CATCGCCGTGCCGTCCCAGTAGG

F = forward; R = reverse.

Statistical evaluation

For statistical evaluation of differences of gene frequency in skin and vascular bundle bacteria, the Student t-test was used, with p < 0.05 designated significant.

Results

Bacterial isolates from arterial walls

Of the 50 specimens of lower limb arterial tissue, bacterial isolates were detected in the calf in 58.6% and the thigh in 33.8% [5]. Calf lymphatics revealed the presence of bacterial cells in 76%. Gram-positive isolates were detected in arteries in more than 70% of specimens and in lymphatics in 80%.

The prevalence of various bacterial strains in arteries was 28% for S. aureus, 25% for S. epidermidis, 28% for Enterococcus, and 14% for Pseudomonas. The prevalence in the lymphatics was 28%, 38%, 9%, and 5%, respectively. Staphylococci were sensitive to all antibiotics but penicillin and gentamicin. The methacycline-resistant strains represented less than 30% of the whole population. Enterococci were fully sensitive only to vancomycin and teicoplanin and slightly to penicillin and amoxicillin. Proteus was sensitive to the majority of the antibiotics, whereas Pseudomonas revealed full sensitivity only to ciprofloxacin and partial sensitivity to cephaloporins, imipenem, and amikacin.

Prevalence of virulence genes in bacteria from skin and arterial and lymphatic vessels

Staphylococcus aureus and S. epidermidis

The results for these isolates are shown in Table 2. The virulence genes fnbA, cna, and ica were present in bacteria isolated from both arteries and the skin. The frequency in arterial specimens was greater than in the skin (p < 0.05). The IS256 gene, which is responsible for biofilm formation, also was more frequent in organisms from the arteries. Of the virulence genes of S. epidermidis encoding atlE, icaAB I, and IS256, only the latter was detected in arterial specimens. Bacteria cultured from lymphatics did not reveal the presence of either eta or IS256 (p > 0.05).

Table 2.

Percent of Isolates with Various Staphylococcal Virulence Genes

fnbA	cna	eta	Mec310	icaAB	icaAD	attE	IS256
Skin
71	71	57	29	100	100	100	0^a
Popliteal artery
75	100	50	25	100	50	50	100
Femoral artery
100	100	50	50	100	0	0	100
Lymphatics
40	80	0^a	50	100	100	100	0^a

Statistically significant difference in arterial vs. skin bacteria or arterial vs. lymphatic bacteria.

Enterococcus faecalis and E. faecium

Virulence genes esp, gelE, and asa were present in both E. faecalis and E. faecium (Table 3). The frequencies of asa373 and cyl in E. faecalis were greater in arteries than in skin bacteria, as were E. faecium cyl A genes.

Table 3.

Percent of Isolates with Various Enterococcal and Pseudomonas Virulence Genes

Skin
Esp	ace	cyIA	geIE	asa		asa 373
50	14	50^a	50	35		14^a
Arteries
Esp	ace	cyIA	geIE	asa		asa 373
60	20	76	50	42		74
Pseudomonas (Skin, Arteries)
lecA	algR	phzA1	toxR	toxA	plcH	lasB
100	100	100	100	100	100	100

Statistically significant difference in arterial vs. skin bacteria or arterial vs. lymphatic bacteria.

Pseudomonas aeruginosa

All the investigated virulence genes were present in these bacteria cultured from the skin and arteries (Table 3).

Discussion

This study provided the following results. First, the staphylococci virulence genes fnbA, cna, and ica were present in bacteria isolated both from arteries and the skin. Second, the frequency was greater in arterial specimens than in the skin. Third, the IS256 gene was more frequent in organisms from the arteries. Fourth, among the virulence genes of S. epidermidis, only IS256 was detected in arterial specimens. Fifth, bacteria cultured from lymphatics did not reveal either eta or IS256 (p > 00.5). Sixth, the E. faecalis asa 373 and cylA gene frequency was greater in arterial than in skin bacteria, as was the E. faecium cyl A gene. All the P. aeruginosa isolates from the skin and arteries had all of the virulence genes.

Virulence factors are molecules expressed and secreted by pathogens (bacteria, viruses, fungi, and protozoa) that enable them to evade or inhibit the host's immune response, enter into and exit from cells (if the pathogen is an intracellular one), and obtain nutrients from the host. Pathogens possess a wide array of virulence factors. Some are chromosomally encoded and intrinsic to the bacteria (e.g., capsules and endotoxin), whereas others are obtained from mobile genetic elements such as plasmids and bacteriophages (e.g., some exotoxins). Virulence factors encoded on mobile genetic elements spread through horizontal gene transfer and can convert harmless bacteria into dangerous pathogens.

Staphylococcus aureus produces many virulence factors, such as hemolysins, leukocidins, proteases, enterotoxins, exfoliative toxins, and immune-modulatory factors [6]. The expression of these factors is tightly regulated during growth. For research on the expression of virulence factors, media such as trypticase soy broth (TSB), brain heart infusion (BHI) broth, and Luria-Bertani (LB) broth have been used commonly for S. aureus cultivation. However, when S. aureus infects a host, the circumstances around bacterial cells are quite different from those in a medium, with the expression pattern of virulence factors in the host apparently quite different from that in culture. From the findings of in vivo experiments, it is considered that many factors, including cellular immune molecules and nutrient conditions, affect the expression of virulence factors, suggesting that the mechanisms of regulation of these factors in vivo are complicated. To avoid any changes attributable to a changed environment, we harvested bacteria from live tissues and extracted their DNA within 24 h. We then compared virulence gene frequencies in skin bacteria with those identified in arterial tissue and lymphatics. The virulence genes IS256, fnbA, cna, and ica were present in bacteria isolated both from arteries and skin. Their frequency in arterial specimens was greater than that in the skin.

The S. epidermidis coding insert IS256 was detected in arterial specimens, but not in lymphatics and skin. This indicates that formation of biofilm was an intra-tissue process in arterial bundles, whereas there was no proper environment on the skin surface and in lymphatics with flowing lymph. Staphylococcus epidermidis, usually an innocuous commensal micro-organism on human skin, can cause severe infection after penetration of epidermal barriers. For the most part, this organism lacks components that are easily recognized as virulence factors, such as toxins or aggressive degradative exoenzymes [7].

Interestingly, bacterial isolates from the lymphatics did not have the etaA e toxin gene. Also, there was less icaAB and atlE in femoral than in popliteal arteries. This may be accounted for by limited migration of bacteria from the foot to upper parts of the ischemic limb.

Enterococcus spp. with the highest virulence are medical isolates with the ability to adhere to a range of extracellular matrix proteins, including thrombospondin, lactoferrin, and vitronectin [8]. The Ace product is a collagen-binding protein belonging to the microbial surface components recognizing adhesive matrix molecules. Extracellular surface protein (Esp) is a cell-wall-associated protein believed to promote adhesion, colonization, and evasion of the immune system and to play some role in antibiotic resistance. Esp also contributes to enterococcal biofilm formation, which could lead to resistance to environmental stresses and adhesion to eukaryotic cells. Cytolysin (also called hemolysin) is a bacterial toxin and the cylLs group of genes encode the non-regulatory genes of the cytolysin operons. A group of hydrolytic enzymes, including hyaluronidases, gelatinase, and serine protease, are involved in the virulence of Enterococcus spp. In our studies, the frequency of the investigated genes was similar on the skin and in the arterial tissue, although there were differences in the frequency of individual genes.

Pseudomonas aeruginosa harbors several virulence genes used to colonize, destroy, and spread through tissue. Our results show that all the virulence genes were present in all strains we tested and form part of the core genome of P. aeruginosa. These findings are in agreement with those of studies that suggest the different virulence genes are harbored by all P. aeruginosa strains independently of the sites of isolation and clinical or environmental samples [9]. Several cell-associated and secreted virulence factors related to the bacterium have been described, which are encoded on plasmids or chromosomal genes, such aslasB (encoding elastase), toxA (exotoxin A), pilA (fimbrial precursor type IV pilin), plcH (hemolytic phospholipase C precursor), phzA1 (phenazine biosynthesis protein), toxR (transcriptional regulator), and lecA (lectin).

The products of these genes cause resistance to most antibiotics. In our studies, Pseudomonas was a relatively frequent species, reaching 14% in arterial tissue and 4% in lymphatics. This strain belongs to the group of aerobic bacteria usually colonizing the skin surface, whereas tissue fluid and lymph, with low pO₂, is not a convenient environment. All the virulence genes were expressed in skin, arteries, and lymphatics at the same frequency.

We found that staphylococci colonizing arterial bundles and transported via lymphatics in ischemic limbs express virulence genes at a greater frequency than those dwelling on the skin surface. Moreover, enterococci and Pseudomonas isolated from arterial bundles express high numbers of virulence genes. This may explain the development of destructive changes in lower limb ischemic tissues that are difficult to control with antibiotics. Evaluation of the bacterial virulence of strains colonizing a patient's foot, once the technique becomes available all over, will be of importance for decreasing the frequency of diabetic ulcers, late inflammation around an artificial arterial prostheses, and prevention of necrosis in patients with multifocal obstruction of arteries who are not fit for reconstructive surgery.

Footnotes

Acknowledgments

This work was supported by grants from the National Science Center (Poland) No. N N404 1644 34.

Author Disclosure Statement

No competing financial interests exist.

References

Ross

. Atherosclerosis: An inflammatory disease. N Engl J Med, 1999; 340:115–126.

Mayr

, Kiechl

, Willeit

, et al. Infections, immunity, and atherosclerosis. Circulation, 2000; 102:833–883.

Kol

, Libby

. Molecular mediators of arterial inflammation: A role for microbial products?. Am Heart J, 1999; 138:450–452.

Nieto

. Infections and atherosclerosis: New clues from an old hypothesis?. Am J Epidemiol, 1998; 148:937–958.

Andziak

, Olszewski

, Moscicka-Wesolowska

, et al. Skin own bacteria may aggravate inflammatory and occlusive changes in atherosclerotic arteries of lower limbs. Int Angiol, 2012; 31:474–482.

Jarraud

, Mouge

, Thioulouse

, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun, 2002; 70:631–641.

Pourmand

, Clarke

, Schuman

, et al. Identification of antigenic components of Staphylococcus epidermidis expressed during human infection. Infect Immunity, 2008; 74:4644–4654.

Hällgren

., Claesson

., Saeedi

, et al. Molecular detection of aggregation substance, enterococcal surface protein, cytolysin genes and in vitro adhesion to urinary catheters of Enterococcus faecalis and E. faecium of clinical origin. Int J Med Microbiol, 2009; 299:323–332.

Arruda

, Marinho

, Boulos

, et al. Nosocomial infections caused by multiresistant Pseudomonas aeruginosa. Infect Control Hosp Epidemiol, 1999; 20:620–623.