Tissue Engineering of Lung: The Effect of Extracellular Matrix on the Differentiation of Embryonic Stem Cells to Pneumocytes

Abstract

We have previously differentiated lung epithelium from human and murine embryonic stem cells (mESCs) and are now exploring the potential applications of these cells, including in the engineering of lung tissue constructs. In this study, we hypothesized that the differentiation and maintenance of lung epithelium derived from mESCs can be enhanced by extracellular matrix (ECM) proteins. Our established differentiation protocol was applied to mESCs grown on a range of ECMs: collagen I, laminin 332, fibronectin, Matrigel, and, as an experimental control, gelatin. The ECMs were coated onto tissue culture plastic (TCP) and poly-DL-lactic acid (PDLLA), a biodegradable polymer we have previously shown to support the growth of mature pneumocytes. Matrigel or Laminin-332 coating of either TCP or PDLLA film resulted in enhanced surfactant protein C gene expression in differentiating mESCs, a direct indication of the upregulation of lung epithelial differentiation. For each combination, changes in the contact angle and ζ potential of protein-coated TCP and PDLLA film confirmed protein adsorption. We conclude that the choice of the coating protein can greatly affect the differentiation of ESCs, and laminin-332-coated PDLLA provided an ECM-degradable scaffold combination that is suitable for engineering of lung tissue constructs.

Introduction

A large variety of lung diseases exists, and most are debilitating and widespread and present a significant, worldwide biomedical problem. Thus, undoubtedly, a readily available means to repair, replace, or regenerate human lung tissue would have an enormous impact on healthcare. From a tissue engineering point of view, restoration of lung function might be achieved by implanting pneumocytes on an appropriate scaffold into the gas-exchange area of the impaired organ. This area of the lung is comprised of air sacs, or alveoli, lined by two types of epithelial cells; gas exchange occurs across type I pneumocytes, while type II pneumocytes secrete surfactant proteins and act as local progenitors for type I cells. At present, it is very difficult to obtain or expand pure populations of primary type II pneumocytes, and they do not maintain their phenotype for prolonged periods in vitro.¹ Thus, stem cells have been explored as a source for potential regenerative medicine strategies for the lung. Type II pneumocytes have been differentiated from both murine and human embryonic stem cells (ESCs) in a 2D environment using soluble factors^2–5 or cell-extract-based reprogramming⁶ and in 3D using coculture.⁷

Cell-matrix interactions, mediated by both arginine–glycine–aspartate-dependent and non-arginine–glycine–aspartate-dependent integrins, are well known to affect lung development, including type II cell function and surfactant protein synthesis and secretion.⁸ For example, laminin is essential for alveolar formation and its mRNA increases during lung development.⁹ The extracellular matrix (ECM) associates with lung development and also plays roles in maintaining both the type II pneumocyte phenotype in vitro and lung repair in vivo. The morphology of type II pneumocytes and the secretion by them of surfactant proteins, such as surfactant protein C (SPC) and D (SPD), are retained best on collagen membranes,¹⁰ laminin,¹¹ or Matrigel (ML)-coated plastic¹² with or without growth factors or external forces.

Recently, collagen-glycosaminoglycan¹³ and ML hydrogel¹⁴ have been used as coatings for scaffolds seeded with primary pneumocytes. A basic principle of tissue engineering is to deliver appropriate cells loaded on scaffolds resembling the in situ tissue both mechanically and physiologically.¹⁵ These scaffolds should fulfill several stringent requirements.¹⁶ Poly(D,L-lactide) (PDLLA), a hydrophobic polymer synthesized from lactic acid, has been used widely as a scaffold material for different tissue engineering applications and is particularly suited to lung tissue engineering because of its elasticity and its biodegradability. The surface properties of a material are known to have significant effects on cell attachment, growth, and differentiation. As PDLLA is hydrophobic, which is not ideal for cell culture, it is essential to render its surface compatible with cells. In addition, in working toward a simplified, easily reproducible system for the production of lung tissue constructs, we are trying to both differentiate and grow ESC-derived pneumocytes on the scaffold. We hypothesized that coating material surfaces with ECM proteins will augment this process. Our study was performed in two steps. First, we examined the effects of different ECM coatings on type II pneumocyte differentiation from murine ESCs (mESCs) cultured on tissue culture plastic (TCP). On the basis of the results obtained, proteins that had positive effects on TCP were further investigated as coatings for PDLLA films, to select an appropriate scaffold coating for future 3D constructs of distal lung. As a protein coating can change the surface properties of a material dramatically, including cell attachment, migration, proliferation, and even phenotype, the surface properties of the ECM-coated TCP or PDLLA samples were also studied using contact angle measurements and ζ potential measurement. The former revealed the wettability of the protein-coated surfaces and the latter can be used to evaluate the overall chemistry of the protein-coated surface. In this way, we tried to assess the correlation between surface properties and ESC differentiation.¹⁷

Materials and Methods

Maintenance of mESCs

The mESC line E14-Tg2a used throughout this study had been stably transduced with a 4.8 kb murine SPC promoter/enhanced green fluorescent protein (eGFP) construct using Lipofectamine™ 2000 (Invitrogen, Paisley, United Kingdom), as described previously.⁶ Nontransduced E14-Tg2a cells were cultured in parallel as a negative control for flow cytometry. mESCs were routinely cultured in an undifferentiated state on gelatin (GN)-coated tissue culture plates in high-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) batch-tested fetal bovine serum (Invitrogen), 2 mM L-glutamine (Invitrogen), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich, Dorset, United Kingdom), and 1000 U/mL leukemia inhibitory factor (LIF; Chemicon, Temecula, CA).

Differentiation of mESCs

Two T75 flasks of mESC colonies, covering <30–50% of the surface area of each vessel, were used to form embryoid bodies (EBs) in six nontissue culture-treated Petri dishes (Sigma-Aldrich) by withdrawal of LIF and limited trypsin digestion. EB formation is referred to as day 0. For directed differentiation of mESCs, suspension and adherent EBs were treated with a modified 3-step protocol, as previously published⁴ and summarized in Figure 1. The differentiating EBs were seeded onto coated TCP or PDLLA films at day 10 (Fig. 1). EBs were not dissociated into single cells before being seeded.

FIG. 1.

Summary of differentiation protocol. Days 1 and 2: embryoid bodies (EBs) were treated with basic murine embryonic stem cell medium (Dulbecco's modified Eagle's medium, bovine serum, L-glutamine, and B-mercaptoethanol) without LIF. Day 3: medium was changed to serum-free culture medium (Dulbecco's modified Eagle's medium, knockout serum replacement, L-glutamine, and B-mercaptoethanol) containing 10 ng/mL activin A, with fresh medium being given on day 5. Day 7: EBs were cultured in serum-free culture medium. Day 10: EBs were seeded on tissue culture plates and poly-DL-lactic acid (PDLLA) film precoated with GN or an extracellular matrix (ECM) proteins for adherent culture. One Petri dish of EBs generated one six-well plate and one 24-well plate. During days 11–20, the same serum-free medium was used to culture adherent EBs with medium change for every 4 days. From day 21 to 28, small airway basal medium (SABM; Cambrex Corporation, East Rutherford, NJ) was used for 8 days with medium change for every 4 days. Color images available online at www.liebertonline.com/ten.

PDLLA film preparation

Five percent (w/v) PDLLA (Purac, Gorinchem, The Netherlands) solution was made by dissolving PDLLA powder (inherent viscosity of 1.53 dL/g) completely in dimethyl carbonate (Sigma-Aldrich). One milliliter of the dissolved polymer solution was applied to circular borosilicate glass coverslips (15 or 32 mm diameter to fit into 24- or 6-well tissue culture plates, respectively) previously washed in acetone followed by absolute ethanol. The PDLLA solution was allowed to dry for 72 h in a solvent-rich chamber under a minimal air-flow to obtain a smooth polymer film. The polymer-coated coverslips were attached to the base of the tissue culture wells with a small amount of 5% (w/v) PDLLA–dimethyl carbonate solution. All plates containing PDLLA film were further sterilized under UV light for 60 min at 0.120 J and 80 W (BLX-254; Vilber Lourmat, Marne-la-Vallée Cedex, France). UV-sterilized plates were further washed with 0.1M phosphate-buffered saline (PBS; Invitrogen) several times.

Coating TCP and PDLLA with ECM proteins

Four different ECM proteins, type I collagen (CO; Sigma-Aldrich), laminin 332 (LN¹⁸; obtained from conditioned medium as described below), fibronectin (FN; Roche Diagnostics GmbH, Penzberg, Germany), and growth factor-reduced Matrigel (BD Biosciences, Bedford, MA), were used to coat material surfaces. In addition, as an experimental control to provide baseline data for comparison, GN (Sigma-Aldrich) was also used as a coating. All of the proteins were coated onto the TCP surface, and GN, LN, and ML were coated onto the surface of PDLLA. For clarity, the material-coating combinations are listed in Table 1. The concentrations of the protein coatings were chosen on the basis of either previous publications that used ECM coating to maintain the type II cell phenotype^{1,9,11,12,19,20} or the concentrations suggested by the supplier. About 0.1% (w/v) of GN was added to the materials at 200 μL/cm² and incubated at 37°C for 1 h; 50 μg/mL of FN was added to the materials at 100 μL/cm² and incubated at room temperature for 45 min. Type I collagen solution (2 mg/mL in acetic acid) was applied to materials at a concentration of 2.5 μL/cm² using rubber cell scrapers and air-dried at room temperature for 1 h in a fume-cupboard. For ML, a stock solution (1 mg/mL) was diluted 1:30 in DMEM, and 200 μL/cm² of the diluted solution was applied to materials using a rubber cell scraper at room temperature for 1h. LN was obtained from DMEM conditioned by an LN-producing rat bladder cell line (804G).¹⁹ To eliminate the competitive adsorption effect of serum proteins, 804G cells were fed with DMEM only when they reached 70% confluence, and then the conditioned medium was collected 24 h after addition, followed by 0.22 μm filter sterilization; 200 μL/cm² of 804G cell-conditioned medium was added to the materials at 37°C for 1 h. For all conditions, the protein solution was aspirated before use and all coated surfaces washed with PBS.

Table 1.

Abbreviations for Material–Coating Combinations

Abbreviation	Material coating
TCP	Tissue culture plastic
TCP-GN	Tissue culture plastic–gelatin
TCP-CO	Tissue culture plastic–collagen
TCP-LN	Tissue culture plastic–laminin 332
TCP-FN	Tissue culture plastic–fibronectin
TCP-ML	Tissue culture plastic–Matrigel
PDLLA	Poly-DL-lactic acid
PDLLA-GN	Poly-DL-lactic acid–gelatin
PDLLA-LN	Poly-DL-lactic acid–laminin 332
PDLLA-ML	Poly-DL-lactic acid–Matrigel

Immunocytochemistry

To confirm the formation of endoderm, the precursor layer to pulmonary epithelium, in the differentiating EBs by the first day of attachment to the test surfaces, immunostaining was carried out. Expression of the endodermal marker Foxa2, the early pulmonary epithelial marker thyroid transcription factor 1 (TTF1), and the basement membrane component laminin was examined in this study. Day 11 EBs were harvested, washed with PBS, and fixed with 4% (w/v) paraformaldehyde overnight. Fixed EBs were cryoprotected in 30% (w/v) sucrose solution overnight, snap-frozen in isopentane cooled by liquid nitrogen, and cryosectioned at 15 μm thickness. Cryosectioning was performed several times on EBs from each batch to rule out any artifacts during cryosection. Sectioned EBs were incubated with goat anti-mouse Foxa2 (diluted 1:50; SC-9187, Santa Cruz Biotechnology, Santa Cruz, CA), rabbit antilaminin (1:100; L9393; Sigma-Aldrich, Poole, United Kingdom), or mouse anti-mouse TTF1 (diluted 1:100, NCL-L-TTF1; Novocastra, Newcastle-upon-Tyne, United Kingdom) antibodies overnight at 4°C. After thorough washing in PBS, sections were incubated with appropriate secondary, fluorescence-labeled antibodies, rabbit anti-goat conjugated with rhodamine (diluted 1:100; AP106R; Chemicon), goat anti-rabbit conjugated with rhodamine (diluted 1:100; AP132R; Chemicon), or rabbit anti-mouse conjugated with TRITC (diluted 1:100; R0270; Dako, Copenhagen, Denmark), as appropriate, for 1 h at room temperature before washing and mounting in Vectashield containing DAPI (Vector Laboratories, Burlingame, CA).

Microscopy

Cell morphology and both SPC-eGFP and immunostaining fluorescence were observed using an Olympus IX70 inverted fluorescence microscope, and images were captured using F-view II Trigger FW camera and analyzed using analySIS^D 5.0 software (Olympus Soft Imaging Solutions, Helperby, United Kingdom).

RT-PCR

On day 28 of mESC differentiation, total RNA was extracted using Trizol reagent and treated with RQ1 RNase-free DNase I (Promega, Madison, WI) following the manufacturer's protocols. Total RNA from adult murine lung (Ambion, Cambridgeshire, United Kingdom) was used as a positive control for all gene targets; 0.5 μg of total RNA from each sample of the triplicates was reverse transcribed into cDNA with random hexamer using Thermoscript RT-PCR System (Invitrogen). Expression levels of RNAs for SPC, a unique type II pneumocyte marker, SPD, another surfactant protein secreted by type II cells, and aquaporin 5, a water channel found abundantly in type I pneumocytes, were evaluated. PCR was performed using recombinant Taq polymerase (Fermentas Life Sciences, Ontario, Canada) in PCR buffer (2.5 mM of MgCl₂, 0.2 mM of deoxyribonucleoside triphosphates (dNTPs) mix, and 0.2 μM of each primer). PCR cycles were performed using a thermal cycler (Eppendorf Mastercycler, Hamburg, Germany) with cycle conditions as follows: 94°C for 2 min, amplication phase (denaturation at 94°C for 15 s, annealing for 30 s, and elongation for 30 s at 72°C) for 30–36 cycles, and final incubation at 72°C for 7 min.

The primer sequences used were as follows:

SPC forward, CAGCTCCAGGAACCTACTGC; reverse, CACAGCAAGGCCTAGGAAAG

SPD forward, GAGGTTGCCTTCTCCCACTA; reverse, CCACAAGCCTTATCATTCCA

Aquaporin 5 forward, ACTGCCACAGCTCAGACCTCA; reverse, AACGCCCAACCCGAATACC

Housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward, TGTGTCCGTCGTGGATCTGA; reverse, CCTGCTTCACCACCTTCTTGA

Housekeeping gene β-actin forward, GTGGGCCGCTCTAGGCACCAA; reverse, CTCTTTGATGTCACGCACGATTTC

Optimal cycle numbers were predetermined. The cycle numbers for SPC, SPD, aquaporin 5, GAPDH, and β-actin mRNAs were 36, 35, 36, 30 and 33 cycles, respectively. Negative controls comprised omission of the cDNA template.

WST-1 cell proliferation assay

In parallel to plating cells into 6-well plates, 400 μL of the homogenized EB suspension was seeded onto a 24-well plate precoated with ECM. The WST-1 assay²¹ (Clontech Laboratories, Mountain View, CA), a tetrazolium-based assay used widely to evaluate cell activity, was performed on four duplicates per condition on days 11, 12, 16, 20, 24, and 28 after medium change to small airway basal medium (SABM). mESC EBs require longer periods, up to 24 h, to attach to the tissue culture plate than most cell lines. Therefore, in this report, we used the WST-1 assay on day 11 (first day after EB attachment) and day 12 (second day after EB attachment) as the index of initial EB adhesion and successful EB adhesion, respectively. At the terminal differentiation stage (days 20–28), the relative cell population size was measured every 4 days in view of the chronic cytotoxic effect of SABM on nonpulmonary cells. Triplicate samples were used throughout; 400 μL of fresh culture medium (serum-free medium or SABM) containing 10% (v/v) WST-1 reagent was added to each well and to four blank wells as background controls. The plates were incubated in a humidified atmosphere (37°C, 5% [v/v] CO₂) for 3 h and shaken gently every 30 min. After 3 h, 100 μL of the medium containing 10% WST-1 reagent was sampled twice from each well using an MRX II Microplate Reader and Dynex Revelation 4.22 software (Dynex Technologies, Chantilly, VA). Test wavelength measurements were taken at 450 nm and the reference wavelength was 650 nm.

Measurement of SPC-eGFP-expressing cells by flow cytometry

Flow cytometry was performed on cells of the experimental groups and negative controls (i.e., E14-Tg2a mESCs without SPC-eGFP transduction cultured on GN in parallel with experimental groups) at day 28 of culture. About 400 μL of trypsin/EDTA (T/E) was added to each well in a six-well plate for 15 min to dissociate the adherent cell clumps. In order not to damage the cells during the subsequent pipetting, chicken serum was added at a predetermined dilution ratio of 1:50 to slow down the cytotoxic effects of trypsin. Cells were pipetted vigorously more than 60 times after T/E dissociation. Dissociated cells were spun down at 800 rpm for 3 min and resuspended with 1 mL of PBS with 2 μg/mL of propidium iodide (PI). Flow cytometry was performed with a FACSCalibur^® flow cytometer and CellQuest™ software (Becton Dickinson, CA). Data were analyzed with FCS express 3.0 software (De Novo Software, Ontario, Canada). Gating was done to exclude dead cells and cell debris in the low forward scattering region. Nonviable cells were also ruled out by excluding cells expressing high fluorescence in the FL3 (PI) channel. A threshold was then applied in the FL1 channel to make 0.05% of the negative control scores positive.⁴ Relative populations of SPC-eGFP-positive cells were compared using one way analysis of variance (ANOVA) with LSD post hoc tests at a significance level of p < 0.05 using SPSS software (SPSS, Chicago, IL).

Contact angle measurement

The relative levels of hydrophilicity displayed by protein-coated TCP and PDLLA were assessed by contact angle measurements at 21°C using the Drop Shape Analysis System (DSA 10 Mk2; Krüss GmbH, Hamburg, Germany) and both the sessile drop and captive bubble methods. For the sessile drop method, advancing and receding contact angles were measured from digital images of a drop of de-ionized water in direct contact with the surface. For the captive bubble method, the protein-coated polymers were immersed in distilled water overnight before the measurements. Instead of using a drop of de-ionized water, an air bubble was used beneath the flat polymer film immersed in de-ionized water. Angles between air–liquid and solid–liquid interfaces were recorded. A minimum of six measurements were taken on both TCP and PDLLA films coated with each protein.

Zeta potential measurement

The ζ potentials of protein-coated TCP and PDLLA were measured using an Electrokinetic Analyser (Anton Paar KG, Graz, Austria) based on the streaming potential method.¹⁷ To eliminate any errors possibly resulting from polymer swelling or protein dissolution, ζ potential change over time, ζ = f(t), was recorded at constant ionic strength (1 mM KCl). When the ζ potential stabilized over time, it was subsequently recorded as a function of pH (ζ = f [pH]) in a 1 mM KCl electrolyte solution. The streaming potential was generated by applying a steadily increasing pressure difference (Δp) from 30 to 250 mbar across a channel made up by the sample. pH was controlled by adding either 0.1 M HCl or 0.1 M KOH using a remote titration unit (Anton Paar KG) at a constant temperature of 20°C.

Results

Transmitted light and fluorescence microscopy

To assess the spatial distribution of the endoderm and possible formation of pulmonary lineages in day 11 EBs, Foxa 2 and TTF1 were immunostained. Numerous Foxa-2-immunoreactive cells were found, with the vast majority lying at the periphery of the EBs (Fig. 2A). A smaller population of TTF1-immunoreactive cells was also present in the same area (Fig. 2B). Immunostaining of laminin revealed basement membrane formation just beneath the outermost cell layer of the EBs (Fig. 2C), although it did not appear to be contiguous. On day 21 of differentiation culture, SPC-eGFP-expressing cells were observed in all experimental groups (Fig. 2D–K). However, their frequency varied greatly between different colonies grown under the same experimental conditions, and therefore it was not possible to evaluate the percentage of SPC-eGFP-positive cells under fluorescence microscopy. Most SPC-eGFP-positive cells lay at the margin of each adherent EB clump and tended to form clusters. In many colonies, the SPC-eGFP-positive cells lined the characteristic cyst at the core of the EB (Fig. 2H, J). By day 28, some of the cells had started to exhibit autofluorescence that obscured the fluorescence of the SPC-eGFP-positive cells (data not shown).

FIG. 2.

(A–C) Immunostaining of day 11 EB controls to show differentiation into endoderm (these EBs had not been seeded onto protein-coated tissue culture plastic [TCP] or PDLLA). (A) A cryosectioned EB with Foxa2-immunoreactive (red) cells lying around the border of the cell cluster. (B) A similar EB immunostained for thyroid transcription factor 1 (red). Positive cells are also seen at the periphery of the EB but in lower numbers than those expressing Foxa2. (C) Immunoreactivity for laminin (red) appears to form a layer under the outermost ring of cells. Nuclei (blue) stained with DAPI in all cases. The insets in (A–C) are the negative controls of the corresponding images. (D–K) Surfactant protein C–enhanced green fluorescent protein (SPC-eGFP) expression on day 21 of differentiation culture. Transcription of the SPC gene and, therefore, differentiation of type II pneumocytes were demonstrated by SPC-eGFP fluorescence (green) in differentiating EBs grown on (D) TCP-gelatin (GN), (E) TCP-collagen (CO), (F) TCP-laminin 332 (LN), (G) TCP-fibronectin (FN), (H) TCP-Matrigel (ML), (I) PDLLA-GN, (J) PDLLA-LN, and (K) PDLLA-ML. A transmitted light photograph of the same field is shown in each case. Color images available online at www.liebertonline.com/ten.

RT-PCR

Figure 3A shows the mRNA expression profiles of differentiated cells cultured on protein-coated TCP on day 28. Higher SPC mRNA expression was found in cells grown on TCP coated with LN (TCP-LN) and with ML (TCP-ML) than with GN (TCP-GN). Cells grown on TCP-CO or TCP-FN expressed less SPC mRNA than those grown on TCP-GN. All other mRNA expression levels, except those for GAPDH mRNA, which was used as housekeeping gene, showed similar trends as those seen for SPC mRNA expression. Cells grown on TCP-CO had the lowest levels of each mRNA assayed except for that of GAPDH. GAPDH mRNA expression was very consistent in every experimental group compared with β-actin mRNA. On protein-coated PDLLA, the mRNA expression profile was different. Cells grown on PDLLA-LN showed the highest expression level of each gene tested except housekeeping GAPDH (Fig. 3B). Cells cultured on PDLLA-ML also had mRNA expression levels higher than those obtained for the GN control. β-Actin and SPD mRNA expression showed a similar tendency to that of SPC mRNA.

FIG. 3.

Results of RT-PCR analysis of differentiating EBs at day 28 of culture on different surfaces. mRNA expression profiles of differentiated cells grown on coated (A) TCP and (B) PDLLA. The results from three independent samples of each material–coating combination are shown. Expression of markers for type I (aquaporin 5) and type II (SPC and SPD) pneumocytes was seen in EBs grown on TCP coated with GN, CO, or LN, but the strongest expression occurred in EBs grown on LN-coated PDLLA.

WST-1 assay

The effects of different ECM proteins on cell attachment and population sizes were assessed with the WST-1 assay. Initial EB adhesion to TCP-LN, TCP-FN, and TCP-ML was better than that to TCP-GN and TCP-CO (Fig. 4A). Clearly, some EBs did not attach to TCP-GN and TCP-CO on day 12, resulting in a drop in optical density (OD; directly proportional to cell number) at 450 nm wavelength. As for protein-coated PDLLA, a drop in OD was observed on PDLLA-GN and PDLLA-LN (Fig. 4B). Whether EBs can attach to protein-coated materials was shown by cell spreading from the EBs (Fig. 4C–J). The cell spreading on day 12 were well correlated with the ODs obtained from the WST-1 assay. Cell populations were previously found to increase in this system from day 10 to 20. In this report,⁴ increased OD was observed from day 12 to 20 for all groups. On day 21, the serum-free medium was replaced with SABM. As mentioned, SABM was used to select for type II pneumocytes. Subsequently, for most samples, no increase in OD was found from day 20 to 24 and a decrease occurred from day 20 to 28 due to the chronic toxicity of SABM to nonpulmonary cells. This conclusion was supported by the observation of increased numbers of dead cells under light microscopy (data not shown).

FIG. 4.

Results of WST-1 assay of cell numbers. (A, B) The numbers of cells (directly proportional to optical density) on ECM-coated TCP or PDLLA were found to be broadly similar from day 11 to 20. A different pattern was noted after day 24 when cell numbers on ECM-coated TCP continued to increase and then fell at day 28, while those on ECM-coated PDLLA did the reverse and fell on day 24 to recover by day 28. (C–J) Light microscopy of cells growing on ECM-coated TCP and PDLLA on day 12. Cells are shown growing on (C) TCP-GN, (D) TCP-CO, (E) TCP-LN, (F) TCP-FN, (G) TCP-ML, (H) PDLLA-GN, (I) PDLLA-LN, and (J) PDLLA-ML. On PDLLA, cells were seen to extend from EBs to the greatest extent when grown on ML-coated PDLLA film (J). Scale bar corresponds to 500 μm.

Measurement of SPC-eGFP-expressing cells by flow cytometry

Gating of target cells in the differentiating culture at day 28 was complicated, especially when they comprised only a low percentage of the whole population (Fig. 5A). As there were many dead cells, as well as debris from both cells and the protein coating, after dissociating the adherent EBs by T/E, we used size gating and propidium iodide uptake for exclusion (Fig. 5A–C). The size of the SPC-eGFP-positive population assessed by flow cytometry (Fig. 5D, E) broadly paralleled the SPC mRNA expression profile (Fig. 3A, B). The percentage of SPC-eGFP-positive cells ranged from 1.2% (TCP-CO) to 5.6% (TCP-ML). TCP-LN and TCP-ML enhanced the frequency of SPC-eGFP-positive cells 1.9- and 2.3-fold, respectively, as compared with those differentiated on TCP-GN. However, there was no significant difference between the results obtained for TCP-LN and TCP-ML. Similarly, PDLLA-LN and PDLLA-ML enhanced the frequency of SPC-eGFP-positive cells 2.7 and 4.3-fold, respectively, as compared with those differentiated on PDLLA-GN, but there was no significant difference between the results for PDLLA-LN and PDLLA-ML.

FIG. 5.

Flow cytometry of SPC-eGFP-expressing cells at day 28 of culture on different surfaces. (A) Gating was done to exclude small cell debris in the low forward scattering region. (B) Propidium iodide was used to rule out nonviable cells that have around 100 times higher fluorescence level in the FL3 channel. Nonviable cells were often found in the terminal differentiation culture, especially in the middle of adherent EBs. (C) A threshold was set in the green fluorescence channel FL1. (D) The proportion of SPC-eGFP-positive cells cultured on protein-coated TCP as compared with cells grown on the control (TCP-GN). The percentages of the total cell population formed by SPC-eGFP-positive cells are shown in each column. (E) The proportion of SPC-eGFP-positive cells cultured on protein-coated PDLLA as compared with cells grown on the control (PDLLA-GN). The percentages of the total cell population formed by SPC-eGFP-positive cells are shown in each column. Asterisks specify statistically significant difference from value of the control (TCP-GN and PDLLA-GN) (p < 0.05). Color images available online at www.liebertonline.com/ten.

Contact angle measurement

All the protein-coated surfaces except TCP-FN had lower advancing and receding contact angles than the uncoated ones, as measured by either sessile drop or captive bubble methods (Table 2). Some contact angle measurements differed with the two methods. For example, θ_A of TCP-ML measured by the sessile drop method was comparable to that of TCP-CO. However, θ_A of TCP-ML measured by captive bubble methods was much lower than that of TCP-CO. This difference between contact angles obtained by sessile drop and captive bubble was due to the intrinsic discrepancy of the measuring principals: sessile drop measured the dry polymer surface, whereas captive bubble measured the wet surface. Therefore, the positive effects of the coating to enhance the wettability can be observed clearly in the results obtained using captive bubbles, especially in the receding contact angles. Despite the enhanced wettability by protein coatings, SPC expression of the differentiated cells were not in parallel to the wettability, suggesting that SPC expression is contact angle independent.

Table 2.

Contact Angle Measurements of Tissue Culture Plastic and Poly-DL-Lactic Acid Coated With/Without Extracellular Matrix Proteins

	Contact angle measured by sessile drop method (dried surface)		Contact angle measured by captive bubble method (wet surface)
Condition	Advancing	Receding	Advancing	Receding
TCP	64.3 ± 1.1	13.6 ± 1	88.7 ± 1.2	62.9 ± 3
TCP-GN	43.3 ± 4.6	14.0 ± 1.3	46.0 ± 4	40.9 ± 2.1
TCP-CO	50.7 ± 1.5	12.7 ± 0.3	72.4 ± 1.1	46.9 ± 2.0
TCP-LN	57.1 ± 0.8	14.8 ± 0.6	70.2 ± 2.1	40.3 ± 0.6
TCP-FN	68.2 ± 2.2	13.8 ± 1.1	71.7 ± 1.2	41.9 ± 0.7
TCP-ML	51.7 ± 1.4	16.5 ± 0.7	53.2 ± 3.2	40.4 ± 1.6
PDLLA	73.6 ± 2.3	57.0 ± 1.9	81.8 ± 1.9	63.3 ± 2.5
PDLLA-GN	62.2 ± 1.2	21.0 ± 1.7	69.7 ± 2	44.6 ± 1.3
PDLLA-LN	54.3 ± 4.4	13.3 ± 1.8	77.8 ± 2.4	51 ± 1.5
PDLLA-ML	56.3 ± 2.7	16.3 ± 0.9	47.4 ± 2.6	49 ± 2.1

Zeta potential measurement

Figure 6 demonstrates the ζ potential courses of the protein-coated TCP (Fig. 6A) and PDLLA (Fig. 6B) films as a function of pH (ζ = f(pH)). Both TCP and PDLLA films contain mainly Brønsted acidic function groups at the surfaces, which resulted in an isoelectric point (IEP), where ζ = 0, at a low pH and a plateau (ζ_plateau) in the alkaline region. This was understandable because most TCPs were plasma-treated with oxygen and, thus, had many acidic functional groups. All the different protein-coatings on TCP, except TCP-FN, were found to have a less acidic surface than uncoated TCP, according to the shift in IEP to a higher pH. Introduction of protein, therefore, increased the numbers of basic groups, such as amines. For protein-coated PDLLA, all samples had a higher IEP, also suggesting a less acidic surface. TCP and PDLLA coated with the same proteins, except for LN, showed similar values for IEP and ζ_plateau. PDLLA-LN had a higher IEP and lower ζ_plateau than TCP-LN. The former showed that PDLLA-LN contains fewer acidic functional groups, and the latter that there were more dissociating acidic function groups at high pH. The difference in the IEP and ζ_plateau of LN coating on different materials suggested dissimilar unfolding conformations of laminin, which subsequently altered the mESC responses.

FIG. 6.

ζ Potential measurements. Graphs show the ζ potentials of (A) TCP and (B) PDLLA films with and without ECM protein coatings. All protein coatings on both TCP and PDLLA, except TCP-FN, were found to reduce surface acidity as shown by the isoelectric point for each (pH at zero potential [0mV]). Color images available online at www.liebertonline.com/ten.

Discussion

In this study, we aimed to test whether coating materials with ECM proteins enhances the differentiation from stem cells and subsequent maintenance of pulmonary epithelium. We used our published three-step protocol⁴ to induce the differentiation of alveolar epithelium, specifically type II pneumocytes, from mESCs on TCP and a polymer we have identified as being suitable for lung tissue engineering, PDLLA coated with a range of ECM proteins. We found that ECM had a positive effect on the differentiation and maintenance of the pneumocytes when coated onto TCP or PDLLA, compared with the experimental control coating (GN), and that laminin and ML gave the best results.

When the mESCs formed EBs, activin A was added to the culture medium to enhance the formation of endoderm.^22,23 We showed previously⁴ that expression of the endodermal markers Foxa 2 and Sox17 within differentiating EBs peaks at day 10. Therefore, we seeded EBs on to protein-coated substrata at this stage. The peak of Foxa 2 expression at day 10 is consistent with our current observation that Foxa2-immunoreactive cells formed a large proportion of the day 11 EB. The smaller percentage formed by TTF1-immunoreactive cells also agrees with our previous finding that expression of TTF1 is detectable from day 11 of mESC differentiation to pulmonary epithelium.⁴

ECM proteins were introduced to the culture at the adherent culture stage (days 11–20). We added serum-free medium to induce the random differentiation of mESCs after endoderm formation. Thus, if a certain ECM protein plays an important role in pneumocyte formation, we expected to see increased expression of the marker for type II pneumocytes, SPC, by mESCs differentiating on it. The mESCs used in the study were transduced with a 4.8 kb murine SPC promoter/eGFP construct so that transcription of the SPC gene and, thus, differentiation to the type II pneumocyte phenotype were marked by expression of green fluorescence. SPC-eGFP-expressing cells were observed at the end of the adherent culture stage. Early stage EBs have been reported to show endodermal cells on their surface and primitive ectodermal cells inside.^20,24 Our finding of SPC-eGFP cells mainly at the borders of the adherent EBs agrees with this observation. We also observed a discontinuous basement membrane beneath the monolayer of the EB surface. The monolayer is likely to be visceral endoderm,²⁰ which does not give rise to the pulmonary epithelium. Enhanced expression of SPC and, by implication, the differentiation of type II pneumocytes by LN and ML suggest that either the ECM protein had an indirect effect on the monolayer of cells that enhanced the differentiation of the definitive endoderm, or some of the definitive endoderm cells had direct contact with the ECM coating due to the discontinuity of the basement membrane. As both LN and ML may unfold in different conformations that could affect mESC differentiation into pneumocytes when adsorbed to PDLLA, LN and ML were further investigated as a coating of PDLLA. The result demonstrated that PDLLA-LN induces higher SPC mRNA expression than either PDLLA-ML or the control (GN). In this study, LN and ML were derived from cell culture systems, suggesting the possibility of the observed increase of SPC expressing cells being caused by trace levels of growth factors remaining in the LN and ML coatings. However, in a separate study, trace concentrations of growth factors in LN and growth-factor-reduced ML were found not to have any effect on the SPC expression of differentiated mESCs and the survival rates of SPC-eGFP-positive cells grown in SABM (unpublished observations).

Most SPC-eGFP-expressing cells formed clusters, reflecting the necessity of cell–cell interactions during ESC differentiation. On day 28 of culture, following the switch to SABM (days 21–28), many cells autofluoresced. SABM is known to increase cell death in differentiating mESC cultures,² and these cells, in addition to those dying naturally during terminal differentiation, are likely to autofluoresce. Laminin or ML coatings gave higher levels of SPC expression than GN. This corresponds with the recent finding that ML induces high endoderm gene expression.²⁵ As the regulation of SPC expression occurs independently of that of other surfactant proteins,²⁶ the fact that we found increased SPD expression too suggests increased type II pneumocyte differentiation, through to the mature phenotype, occurred on TCP coated with laminin or ML and PDLLA coated with laminin than on other surface-coating combinations. A characteristic feature of type II pneumocytes is its transdifferentiation into type I pneumocytes in vitro, so increased expression of the type I cell marker aquaporin 5 also leads to the same conclusion.

ECM proteins can induce EB differentiation by seeding randomly differentiated 5-day-old EBs onto collagen gels that incorporated FN and laminin; FN was reported to induce dose-dependent endothelial differentiation and laminin was shown to guide the differentiation of the cardiac lineage.²⁷ These observations and ours of laminin inducing differentiation of pneumocytes from EBs with enhanced endoderm formation suggest that the effect of exogenous ECM proteins on stem cells might be stage specific. Indeed, the effect of the ECM proteins on embryonic development is well known to be stage specific. For example, expression of laminin subunit α1 is limited to the first trimester in human embryos, whereas laminin subunit α5 expression is detectable from early stages of fetal lung development and thereafter.²⁸ The laminin used in the present study, LN, is composed of subunits α3, β3, and γ2. LN has been localized to the basement membranes of airway epithelium and alveolar parenchyma throughout the development of the human lung.^29,30 However, a recent report indicates that laminin-γ2-deficient mice still showed normal branching morphogenesis and epithelial differentiation until the saccular stage.³¹ Its effect on alveolarization are still unknown because the laminin-γ2-deficient mice died before the alveolarization stage. The increased number of SPC-eGFP-expressing cells we observed differentiating on laminin-coated TCP implied a positive effect of the protein either on the differentiation of the lung epithelial lineage from endoderm or on type II pneumocyte differentiation. In vivo, type I collagen–deficient mice can still develop normal lung,³² suggesting that either type I collagen is not crucial to the process or its function in lung may be shared by other collagens. This might explain why TCP coated with collagen was found in this study not to enhance SPC expression and, thus, type II pneumocyte differentiation. In embryonic lung development, FN is more involved in branching morphogenesis and airway formation.³³ Its role in type II cell differentiation is less obvious. In vitro, FN does not maintain the phenotype of type II cells.³⁴ The relative lack of involvement of FN in pulmonary alveolar differentiation may explain lower SPC expression found in cells grown on TCP coated with the protein. ML is an Engelbreth-Holm-Swarm (EHS) sarcoma-derived basement membrane extract. Its main component, laminin 111 (formerly named laminin 1),³⁵ has a critical role in lung development. Antibodies to laminin 111 reduce the growth of embryonic lung explants and their branching morphogenesis in vitro.³⁶ Disruption of laminin 111 polymerization causes failure of airway basement membrane formation.³⁷ Increased SPC expression we observed in mESCs differentiating on TCP coated with ML agrees with this finding. In this research, we only applied a single exogenous ECM protein to the differentiation culture after endoderm formation; more tests are needed to determine the stage-specific and/or possible synergistic effects of the ECM.

It has been reported that β-tubulin, a cytoskeleton protein, is not an appropriate internal control for stem cell differentiation.³⁸ Our results confirm this observation, as β-actin expression was highest in cells grown on ML or laminin coating on TCP and PDLLA, respectively. As β-actin is part of the cytoskeleton, its expression is also strongly related to the substratum³⁹ and its regulation can be activated by ECM at the transcriptional level.^40,41 The integrin signaling pathway and ECM work in a positive feedback mechanism that induces the cells themselves to produce more ECM.⁴² We found strong correlation between expression of SPC, SPD, and β-actin mRNAs in agreement with the literature on primary type II cell culture in vitro,⁴³ which suggests that the cytoskeleton can regulate SPC mRNA expression and maintain type II cell differentiation. Regulation of SPC mRNA is very likely mediated by polysomes that associate with 3′ tail of mRNA and, thus, can transport and stabilize the mRNA to a specific location within the cell.⁴⁴ Type II cells cultured on attached collagen lose surfactant protein secretion and phenotype, but both characteristics recovered after detaching the attached gel so that it floated, suggesting the involvement of the cytoskeleton in type II cell differentiation.^10,45

ECM proteins have been used for decades as coatings to render a material surface bioactive.^46–48 Once an ECM protein solution comes into contact with a solid surface, a dynamic, nonspecific protein adsorption process occurs in which the protein changes its conformation to the lowest energy state,⁴⁹ a process affected by the chemistry of the solid surface. In view of this, we evaluated the overall surface chemistry of the samples using contact angle measurements of sessile drops and the captive bubble technique and ζ potential measurement. Using the sessile drop technique alone for contact angle to characterize a cell culture material could generate misleading information. For example, the θ_A of dry TCP-CO is among the lowest of all protein-coated surfaces, but the θ_A of wet TCP-CO was among the highest. As PDLLA samples were immersed in cell culture medium during differentiation, the captive bubble technique can be more representative. ζ potential measurements allow comparison of surfaces by measuring the IEP and ζ_plateau of the materials. IEP shifts to higher pH if the surface becomes less acidic after protein coating. The curves of ζ = f(pH) of TCP-GN and PDLLA-GN were similar, as were those for TCP-ML and PDLLA-ML. This implied similar protein coating on both materials. In contrast, TCP-LN and PDLLA-LN had distinct IEP, ζ_plateau, and the slope of the ζ = f(pH), implying dissimilar coating properties, despite the same protein being applied. It can be expected that different levels of exposure of cell-binding ligands were presented on both coatings. This difference may contribute to SPC expression of cells on PDLLA-LN to be much higher than that on PDLLA-ML, whereas SPC expression of cells on TCP-ML was slightly higher than that on TCP-ML To conclude, IEP and ζ_plateau were not correlated to SPC expression of the differentiated cells, but both factors were good tools to the evaluate protein coatings.

In conclusion, we have investigated the potential of ECM proteins to affect the differentiation of ESCs and have defined a culture protocol, polymer surface and coating combination, that promotes the differentiation of mESCs to pulmonary epithelial cells. It was also confirmed that, depending on the materials used, different proteins should be applied. For the in vitro expansion of pneumocytes, ML proved to be a good coating. However, for tissue engineering of lung with biodegradable PDLLA as a scaffold, laminin gave the best results, as assessed by levels of SPC gene expression. These combinations could have widespread uses in tissue engineering, developmental studies, and the creation of cell–scaffold constructs that can be used for pharmacological and toxicological screening.

Footnotes

Acknowledgments

This work was supported by the Medical Research Council (Component Grant G0300106) and The Rosetrees Trust. Yuan-Min Lin would especially like to thank the National Science Council Taiwan for the Taiwan Merit Scholarship numbered TMS-094-2B-005. We also thank Prof. A. Smith for the E14-Tg2a cell line, Prof. J. Whitsett for the kind donation of the SPC promoter–eGFP plasmid construct, and Prof. R. Lubman for the 804G cell line.

Disclosure Statement

No competing financial interests exist.

References

Rice

W.R.

, Conkright

J.J.

, Na

C.L.

, Ikegami

, Shannon

J.M.

, Weaver

T.E.

Maintenance of the mouse type II cell phenotype in vitro. Am J Physiol Lung Cell Mol Physiol, 283:L256. 2002.

Ali

N.N.

, Edgar

A.J.

, Samadikuchaksaraei

, Timson

C.M.

, Romanska

H.M.

, Polak

J.M.

, Bishop

A.E.

Derivation of type II alveolar epithelial cells from murine embryonic stem cells. Tissue Eng, 8:541. 2002.

Rippon

H.J.

, Ali

N.N.

, Polak

J.M.

, Bishop

A.E.

Initial observations on the effect of medium composition on the differentiation of murine embryonic stem cells to alveolar type II cells. Cloning Stem Cells, 6:49. 2004.

Rippon

H.J.

, Polak

J.M.

, Qin

, Bishop

A.E.

Derivation of distal lung epithelial progenitors from murine embryonic stem cells using a novel three-step differentiation protocol. Stem Cells, 24:1389. 2006.

Samadikuchaksaraei

, Cohen

, Isaac

, Rippon

H.J.

, Polak

J.M.

, Bielby

R.C.

, Bishop

A.E

. Derivation of distal airway epithelium from human embryonic stem cells. Tissue Eng, 12:867. 2006.

Qin

, Tai

, Collas

, Polak

J.M.

, Bishop

A.E.

Cell extract-derived differentiation of embryonic stem cells. Stem Cells, 23:712. 2005.

Van Vranken

B.E.

, Romanska

H.M.

, Polak

J.M.

, Rippon

H.J.

, Shannon

J.M.

, Bishop

A.E.

Coculture of embryonic stem cells with pulmonary mesenchyme: a microenvironment that promotes differentiation of pulmonary epithelium. Tissue Eng, 11:1177. 2005.

Aliotta

J.M.

, Passero

, Meharg

, Klinger

, Dooner

M.S.

, Pimentel

, Quesenberry

P.J.

Stem cells and pulmonary metamorphosis: new concepts in repair and regeneration. J Cell Physiol, 204:725. 2005.

Schuger

, Varani

, Killen

P.D.

, Skubitz

A.P.

, Gilbride

Laminin expression in the mouse lung increases with development and stimulates spontaneous organotypic rearrangement of mixed lung cells. Dev Dyn, 195:43. 1992.

10.

Geppert

E.F.

, Williams

M.C.

, Mason

R.J.

Primary culture of rat alveolar type II Cells on floating collagen membranes. Morphological and biochemical observations. Exp Cell Res, 128:363. 1980.

11.

Rannels

S.R.

, Yarnell

J.A.

, Fisher

C.S.

, Fabisiak

J.P.

, Rannels

D.E.

Role of laminin in maintenance of type II pneumocyte morphology and function. Am J Physiol, 253:C835. 1987.

12.

Kawada

, Shannon

J.M.

, Mason

R.J.

Improved maintenance of adult rat alveolar type II cell differentiation in vitro: effect of serum-free, hormonally defined medium and a reconstituted basement membrane. Am J Respir Cell Mol Biol, 3:33. 1990.

13.

Chen

, Marsilio

, Goldstein

R.H.

, Yannas

I.V.

, Spector

Formation of lung alveolar-like structures in collagen-glycosaminoglycan scaffolds in vitro. Tissue Eng, 11:1436. 2005.

14.

Mondrinos

M.J.

, Koutzaki

, Jiwanmall

, Li

, Dechadarevian

J.P.

, Lelkes

P.I.

, Finck

C.M.

Engineering three-dimensional pulmonary tissue constructs. Tissue Eng, 12:717. 2006.

15.

Levenberg

, Golub

J.S.

, Amit

, Itskovitz-Eldor

, Langer

Endothelial cells derived from human embryonic stem cells. Proc Natl Acad Sci USA, 99:4391. 2002.

16.

Hutmacher

D.W.

Scaffolds in tissue engineering bone and cartilage. Biomaterials, 21:2529. 2000.

17.

Safinia

, Blaker

J.J.

, Maquet

, Boccaccini

A.R.

, Mantalaris

, Bismarck

Characterisation of “wet” polymer surfaces for tissue engineering applications: are flat surfaces a suitable model for complex structures?

E-Polymers, 10. 2005.

18.

Aumailley

, Bruckner-Tuderman

, Carter

W.G.

, Deutzmann

, Edgar

, Ekblom

, Engel

, Engvall

, Hohenester

, Jones

J.C.

, Kleinman

H.K.

, Marinkovich

M.P.

, Martin

G.R.

, Mayer

, Meneguzzi

, Miner

J.H.

, Miyazaki

, Patarroyo

, Paulsson

, Quaranta

, Sanes

J.R.

, Sasaki

, Sekiguchi

, Sorokin

L.M.

, Talts

J.F.

, Tryggvason

, Uitto

, Virtanen

, von der Mark

, Wewer

U.M.

, Yamada

, Yurchenco

P.D.

A simplified laminin nomenclature. Matrix Biol, 24:326. 2005.

19.

Baker

S.E.

, DiPasquale

A.P.

, Stock

E.L.

, Quaranta

, Fitchmun

, Jones

J.C.

Morphogenetic effects of soluble laminin-5 on cultured epithelial cells and tissue explants. Exp Cell Res, 228:262. 1996.

20.

, Edgar

, Fassler

, Wadsworth

, Yurchenco

P.D.

The role of laminin in embryonic cell polarization and tissue organization. Dev Cell, 4:613. 2003.

21.

Ishiyama

, Tominaga

, Shiga

, Sasamoto

, Ohkura

, Ueno

A combined assay of cell viability and in vitro cytotoxicity with a highly water-soluble tetrazolium salt, neutral red and crystal violet. Biol Pharm Bull, 19:1518. 1996.

22.

Yasunaga

, Tada

, Torikai-Nishikawa

, Nakano

, Okada

, Jakt

L.M.

, Nishikawa

, Chiba

, Era

, Nishikawa

Induction and monitoring of definitive and visceral endoderm differentiation of mouse ES cells. Nat Biotechnol, 23:1542. 2005.

23.

Kubo

, Shinozaki

, Shannon

J.M.

, Kouskoff

, Kennedy

, Woo

, Fehling

H.J.

, Keller

Development of definitive endoderm from embryonic stem cells in culture. Development, 131:1651. 2004.

24.

Mfopou

J.K.

, Willems

, Leyns

, Bouwens

Expression of regulatory genes for pancreas development during murine embryonic stem cell differentiation. The International journal of developmental biology, 49:915. 2005.

25.

Chen

S.S.

, Fitzgerald

, Zimmerberg

, Kleinman

H.K.

, Margolis

Cell-cell and cell-extracellular matrix interactions regulate embryonic stem cell differentiation. Stem Cells, 25:553. 2007.

26.

Beers

M.F.

, Fisher

A.B.

Surfactant protein C: a review of its unique properties and metabolism. Am J Physiol, 263:L151. 1992.

27.

Battista

, Guarnieri

, Borselli

, Zeppetelli

, Borzacchiello

, Mayol

, Gerbasio

, Keene

D.R.

, Ambrosio

, Netti

P.A.

The effect of matrix composition of 3D constructs on embryonic stem cell differentiation. Biomaterials, 26:6194. 2005.

28.

Pierce

R.A.

, Griffin

G.L.

, Miner

J.H.

, Senior

R.M.

Expression patterns of laminin alpha1 and alpha5 in human lung during development. Am J Respir Cell Mol Biol, 23:742. 2000.

29.

Coraux

, Meneguzzi

, Rousselle

, Puchelle

, Gaillard

Distribution of laminin 5, integrin receptors, and branching morphogenesis during human fetal lung development. Dev Dyn, 225:176. 2002.

30.

Virtanen

, Laitinen

, Tani

, Paakko

, Laitinen

L.A.

, Burgeson

R.E.

, Lehto

V.P.

Differential expression of laminins and their integrin receptors in developing and adult human lung. Am J Respir Cell Mol Biol, 15:184. 1996.

31.

Nguyen

N.M.

, Pulkkinen

, Schlueter

J.A.

, Meneguzzi

, Uitto

, Senior

R.M.

Lung development in laminin gamma2 deficiency: abnormal tracheal hemidesmosomes with normal branching morphogenesis and epithelial differentiation. Respir Res, 7:28. 2006.

32.

Kratochwil

, Dziadek

, Lohler

, Harbers

, Jaenisch

Normal epithelial branching morphogenesis in the absence of collagen I. Dev Biol, 117:596. 1986.

33.

Roman

Fibronectin and fibronectin receptors in lung development. Exp Lung Res, 23:147. 1997.

34.

Adamson

I.Y.

, King

G.M.

, Young

Influence of extracellular matrix and collagen components on alveolar type 2 cell morphology and function. In Vitro Cell Dev Biol, 25:494. 1989.

35.

Kleinman

H.K.

, McGarvey

M.L.

, Liotta

L.A.

, Robey

P.G.

, Tryggvason

, Martin

G.R.

Isolation and characterization of type IV procollagen, laminin, and heparan sulfate proteoglycan from the EHS sarcoma. Biochemistry, 21:6188. 1982.

36.

Schuger

, O'Shea

, Rheinheimer

, Varani

Laminin in lung development: effects of anti-laminin antibody in murine lung morphogenesis. Dev Biol, 137:26. 1990.

37.

Schuger

, Yurchenco

, Relan

N.K.

, Yang

Laminin fragment E4 inhibition studies: basement membrane assembly and embryonic lung epithelial cell polarization requires laminin polymerization. Int J Devel Biol, 42:217. 1998.

38.

Murphy

C.L.

, Polak

J.M.

Differentiating embryonic stem cells: GAPDH, but neither HPRT nor beta-tubulin is suitable as an internal standard for measuring RNA levels. Tissue Eng, 8:551. 2002.

39.

Nagahara

, Matsuda

Cell-substrate and cell-cell interactions differently regulate cytoskeletal and extracellular matrix protein gene expression. J Biomed Mater Res, 32:677. 1996.

40.

Burridge

, Chrzanowska-Wodnicka

Focal adhesions, contractility, and signaling. Ann Rev Cell Dev Biol, 12:463. 1996.

41.

Farmer

S.R.

, Wan

K.M.

, Ben-Ze'ev

, Penman

Regulation of actin mRNA levels and translation responds to changes in cell configuration. Mol Cell Biol, 3:182. 1983.

42.

Owen

G.R.

, Meredith

D.O.

, ap Gwynn

, Richards

R.G.

Focal adhesion quantification—a new assay of material biocompatibility?

Eur Cells Mater, 9:85. 2005.

43.

Shannon

J.M.

, Pan

, Edeen

K.E.

, Nielsen

L.D.

Influence of the cytoskeleton on surfactant protein gene expression in cultured rat alveolar type II cells. Am J Physiol, 274:L87. 1998.

44.

Hesketh

J.E.

Sorting of messenger RNAs in the cytoplasm: mRNA localization and the cytoskeleton. Exp Cell Res, 225:219. 1996.

45.

Shannon

J.M.

, Jennings

S.D.

, Nielsen

L.D.

Modulation of alveolar type II cell differentiated function in vitro. Am J Physiol, 262:L427. 1992.

46.

Dean

J.W.

, Culbertson

K.C.

, D'Angelo

A.M.

Fibronectin and laminin enhance gingival cell attachment to dental implant surfaces in vitro. Int J Oral Maxillofac Implants, 10:721. 1995.

47.

Kesler

K.A.

, Herring

M.B.

, Arnold

M.P.

, Glover

J.L.

, Park

H.M.

, Helmus

M.N.

, Bendick

P.J.

Enhanced strength of endothelial attachment on polyester elastomer and polytetrafluoroethylene graft surfaces with fibronectin substrate. J Vasc Surg, 3:58. 1986.

48.

Seitz

T.L.

, Noonan

K.D.

, Hench

L.L.

, Noonan

N.E.

Effect of fibronectin on the adhesion of an established cell line to a surface reactive biomaterial. J Biomed Mater Res, 16:195. 1982.

49.

Haynes

C.A.

, Sliwinsky

, Norde

Structural and electrostatic properties of globular-proteins at a polystyrene water interface. J Colloid Interface Sci, 164:394. 1994.