BMP7-Based Functionalized Self-Assembling Peptides Protect Nucleus Pulposus-Derived Stem Cells From Apoptosis In Vitro

Abstract

Tissue engineering has shown great success in the treatment of intervertebral disk degeneration (IVDD) in the past decade. However, the adverse and harsh microenvironment associated in the intervertebral disks remains a great obstacle for the survival of transplanted cells. Although increasing numbers of new materials have been created or modified to overcome this hurdle, a new effective strategy of biological therapy is still required. In this study, bone morphogenic protein 7 (BMP7)-based functionalized self-assembling peptides were developed by conjugating a bioactive motif from BMP-7 (RKPS) onto the C-terminal of the peptide RADARADARADARADA (RADA16-I) at a ratio of 1:1 to form a new RADARKPS peptide. Human nucleus pulposus-derived stem cells (NPDCs) were cultured in the presence of RADA-RKPS or RADA16-I in an apoptosis-promoting environment that was induced by tumor necrosis factor-alpha, and cells were cultured with RADA16-I in normal medium that served as the control group. After 48 h of apoptosis induction, the viability, proliferation, apoptosis rate, and expression of apoptosis-related genes of NPDCs in the different groups were evaluated, and the differentiation of NPDCs toward nucleus pulposus-like cells was tested. The results showed that the RADA-RKPS peptide could significantly protect the survival and proliferation of NPDCs. In addition, the application of RADA-RKPS decreased the rate of cell apoptosis, as detected by TUNEL-positive staining. Furthermore, our in vitro study confirmed the apoptosis-protecting effects of RADA-RKPS peptides, which significantly reduced the BAX/BCL-2 ratio of NPDCs and upregulated the gene expression of collagen II a1, aggrecan, and Sox-9 after 48 h of apoptosis induction. Collectively, these lines of evidence suggest that RADA-RKPS peptides confer a protective effect to NPDCs in an apoptosis environment, suggesting their potential application in the development of new biological treatment strategies for IVDD.

Introduction

Low back pain is a global issue that affects nearly 80% of individuals at some point during their lives,¹ and intervertebral disk degeneration (IVDD) is considered a major culprit for this disorder.^2,3 However, the current therapies for IVDD are primarily aimed at relieving symptoms rather than at repairing the damage; therefore, new biological treatment strategies are still urgently sought. The nucleus pulposus (NP) plays a primary role in absorbing axial compressive forces, thereby facilitating load transmission and allowing for multi-axial flexibility of the spine.⁴ The NP maintains homeostasis under physiological conditions, which could be disturbed by an abnormal environmental change that decreases NP cell numbers, such as abnormal mechanical stress, nutrient decline, and aberrant expression of inflammatory cytokines⁵ It has been well established that inflammatory changes in the disk contribute to degeneration, and cytokines are believed to be key mediators for that.^6,7 In addition, our previous work also demonstrated that it has potential therapeutic effects with respect to IVDD treatment by blocking the function of these inflammatory cytokines.⁸ Furthermore, tumor necrosis factor-α (TNF-α) as a cytokine has been reported to strongly link to the pathogenesis of IVDD and triggers a range of pathogenic responses in the disk cells that promote autophagy, senescence, or apoptosis, which have been increasingly proved to be key components that are responsible for the process of IVDD.^5,9–12 Aside from that, several in vitro studies have demonstrated that a culture medium containing TNF-α causes pathological changes in disk cells and also affects disk vitality in vivo due to transfer through the endplate.¹³ This background suggests that TNF-α plays a critical role in the IVDD, and it is important to shed light on the degeneration of the NP to find an effective strategy for repairing the damage in IVDD.

Bone morphogenetic protein-7 (BMP-7) has been demonstrated to protect cells from apoptosis in many tissues, including the NP.^5,14–16 BMP-7-based biological therapeutics have also shown tremendous success for treating IVDD in animal models,^17–22 and our previous studies have demonstrated that they can increase extracellular matrix (ECM) synthesis in animal models.^23,24 Accordingly, BMP-7 is considered a promising prospective target for IVDD tissue engineering and regeneration medicine.

Recently, the use of self-assembling peptide scaffolds has become a tendency of intensive biomaterials research and draws increasing attention for NP tissue engineering.²⁵ Unlike other biomaterials, self-assembling peptide scaffolds are made of natural amino acids through undergoing gelation into a macroscopic hydrogel scaffolds with 5–200 nm pore size and 10 nm fiber diameter, a similar nanostructure to that of a natural ECM under physiological conditions.²⁶ Furthermore, self-assembling peptides share various advantages of reducing the need for chemical contaminants, the ability to form nanofibrous hydrogel scaffolds under physiological conditions, and their potential for modification to mimic natural ECM structures.^27,28 A typical example of this is Ac-RADARADARADARADA-CONH2 (RADA16-I), which was found to promote NP cell proliferation, migration, and ECM synthesis when conjugated to BMP-7 short peptides in our previous studies.^26,28,29 Among the BMP-7 short peptides tested, AcN-RADARADARADARADA-GG-KPSSAPTQLN-CONH2 (RKPS peptide) was found to be an ideal active fragment of BMP-7 protein for NP tissue regeneration.^29,30

It is widely acknowledged that the adverse and harsh microenvironment of intervertebral disks (IVDs), such as the acidic pH, hypoxia, hyperosmolarity, and limited nutrition, makes it difficult for exogenous cells to survive.^31,32 Moreover, because of the limited regeneration ability of NP cells, the newly found nucleus pulposus-derived stem cells (NPDCs) exhibit great potential for the endogenous repair of IVDD.^33–37

Therefore, in the present study, we investigated whether these BMP7-based functionalized self-assembling peptides (RADA-RKPS peptides) can prevent TNF-α-induced apoptotic effects in cultured human NPDCs obtained from IVDD. Thus, the viability, proliferation, apoptosis rate, and the BAX/BCL-2 ratio were compared between NPDCs cultured in the presence of RADA-RKPS or RADA16-I alone in an apoptosis-promoting environment induced by TNF-α for 48 h. Furthermore, the differentiation ability of NPDCs toward NP-like cells was compared among groups to assess its potential for use in IVDD treatment.

Materials and Methods

Preparation of self-assembling peptide solutions

The self-assembling peptide solutions were prepared as previously described.^28,29 Briefly, the RADA16-I and RKPS peptides (purity >90%) were synthesized by Sangon Biotech (Shanghai, China). Then, the powders of the RADA16-I and RKPS peptides were, respectively, dissolved in MilliQ water at a concentration of 1% (w/v, 10 mg/mL), and the RADA-RKPS peptide mixtures were formed by mixing the 1% RADA16-I and 1% RKPS solutions at a volume ratio of 1:1. After sonication for 30 min and filter-sterilization with a syringe-driven filter unit (0.22-mm HT Tuffrun membrane; Millipore), the two kinds of peptides (RADA-RKPS and RADA16-I) were ready for further use in the experiments.

Isolation and culture of NPDCs

The NP tissues were obtained from five patients who underwent a posterior diskectomy operation for lumbar degenerative disease. The details of all samples and patients are shown in Table 1. The application for approval of human research protocol has been reviewed and approved by the Navy General Hospital Ethical Committee. NPDCs were isolated and cultured in a manner previously described.^35,38 Briefly, after the patient NP tissues were cut and filtered by using a nylon mesh (100 mm), they were then digested with 0.025% collagenase type II solution (Sigma) in a serum-free medium overnight at 37°C with 5% CO₂. After centrifugation at 1000 × g for 5 min, the isolated cells were cultured at a density of 1 × 103 cells/cm² in standard MSC culture medium (Cyagen Biosciences, Guangzhou, China), consisting of Dulbecco's modified Eagle medium-low glucose with 10% fetal bovine serum (commercially selected as suitable for MSC culture by Cyagen), 2 mmol/L l-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin at 37°C and 5% CO₂. The medium was then removed after 1 day and refreshed with complete culture medium every 3 days. The cells were harvested with trypsin/ethylenediaminetetraacetic acid (0.05%/0.02%; Gibco) and passaged at a ratio of 1:3 at confluence. Finally, the passage 3 generation NPDCs were used for experiments.

Table 1.

Characteristics of the Patients from Whom Nucleus Pulposus Tissue Was Obtained

Case no.	Diagnosis	Disk level	Pfirrmann grade	Gender	Age (years)
1	Lumbar disk herniation	L4-L5	II	F	51
2	Spinal stenosis	L5-S1	III	M	56
3	Spondylolisthesis	L4-L5	II	F	49
4	Lumbar disk herniation	L4-L5	II	M	45
5	Lumbar disk herniation	L5-S1	II	M	47

Two-dimensional and three-dimensional culture of NPDCs in the self-assembling peptides

Cell culture millicell inserts (11-mm diameter, 0.4-mm polyester membrane; Corning) were used for self-assembling peptide hydrogel formation (Fig. 1). For the two-dimensional (2D) cell culture, the nine inserts were placed into a 24-well culture plate with 200 μL of culture medium that was placed in each well. Then, 100 μL of the peptide solution (RADA16-I or RADA-RKPS) was added slowly and carefully into the inserts and incubated at 37°C for 15 min for gelation. Next, 800 μL of culture medium was gently added into the 24-well culture plate and then incubated overnight at 37°C to equilibrate the physiological pH 7.40. After that, the culture medium was removed, 1 × 10⁴ NPDCs in 200 μL of the culture medium were seeded onto the surfaces of the peptide hydrogels for 4 h, and 800 μL culture medium was added to each well.

FIG. 1.

General views of the self-assembling peptide hydrogels in 2D and 3D culture models. Both peptides could self-assemble into transparent viscous hydrogel scaffolds in the culture medium. In the 2D culture model, NPDCs were seeded directly on the surface of peptides, which were immersed in DMEM/F12 medium. In the 3D culture, NPDCs were mixed and seeded on the RADA16-I or RADA-RKPS peptide, which were cultured in DMEM/F12 medium. NPDC, nucleus pulposus-derived stem cell. Color images available online at www.liebertpub.com/tea

For three-dimensional (3D) cell culture, the nien millicell inserts were placed into a 24-well culture plate with 200 μL of culture medium per well, and the NPDCs were suspended in 10% sucrose before seeding. Then, 1 × 10⁵ NPDCs in a 20-μL cell suspension were rapidly mixed with 100 μL of peptide solution, and the cell/peptide mixture was immediately moved into the insert. Two hundred microliters of the culture medium was very slowly and gently added onto the peptide for hydrogel gelation and incubated at 37°C, 5% CO₂ for 30 min. The medium was further changed at least twice every 30 min to equilibrate the physiological pH, and the final total culture medium volume was 1 mL for each group.

Apoptosis induction

Cell apoptosis was induced with TNF-α (B&D Systems, Inc., Minneapolis, MN) in 2D and 3D cultures as previously described.⁵ After NPDCs were cultured in both types of peptides (RADA16-I and RADA-RKPS) for 4 h, the culture medium was added with 20 ng/mL of TNF-α solution for apoptosis induction of 48 h. The three repetitive cell samples grown in RADA16-I peptide with complete culture medium served as the control group.

Cell viability assay

After 48 h of apoptosis induction, NPDCs seeded on the peptide hydrogels were dyed with the fluorogenic ester calcein-AM (CAM; Dojindo) to detect live cells and with propidium iodide (PI; Sigma) to stain dead cells. The cells/hydrogel were incubated with 2 mM CAM and 4.5 mM PI for 30 min at room temperature in the dark and were then gently rinsed with phosphate-buffered saline (PBS) three times. A fluorescence microscope (CFM-300; Nikon, Japan) was used to acquire images, and the numbers of live and dead cells were counted in five randomly collected nonoverlapping areas. The experiments were repeated three times, and the results were averaged for analyzed.

Cell proliferation and cell counting

Cell proliferation was evaluated by using cell counting kit-8 reagents (CCK-8; Dojindo, Japan). The absorbance at 450 nm was measured to indirectly reflect the number of cells, using a microplate reader (Elx800; Bio-Tek, USA). A sample of 5 × 10³ NPDCs from 2D culture and 1 × 10⁴ cells from 3D culture were seeded on each type of peptide hydrogel in 96-well culture plates. The peptide hydrogels without cell seeding served as controls; for each type of peptide, three repetitive samples were used and the experiments were repeated three times with the triplicate results averaged for analyzed. Finally, the CCK-8 solution (10 μL) was added and incubated for 30 min at room temperature.

For cell counting, 4′,6′-diamidino-2-phenylindole (DAPI) staining was used to visualize the cell nucleus, owing to its quick and convenient features. Briefly, the mixtures of cells/peptide in 2D or 3D culture were washed with PBS and fixed with 4% paraformaldehyde for 15 min, and then the cells were incubated with DAPI solution (1:1000; Invitrogen) at room temperature for another 15 min in the dark. The stained cells were photographed with a fluorescence microscope (CFM-300; Nikon, Japan). The cell numbers were counted repeatedly three times by the cell counter, and the triplicate cell numbers were averaged for analyzed.

In situ detection of DNA fragmentation

Cell apoptosis was detected with the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) kit (Promega, Madison, WI) according to the manufacturer's instructions. Briefly, three cell samples for each group were cultured in millicell inserts, fixed in 4% paraformaldehyde, and treated with proteinase K for 15 min. The endogenous peroxidase was blocked with 3% H₂O₂ for 10 min, and then the cells were incubated with TdT-mediated dUTP for 1 h in the dark. Negative controls were incubated with dUTP only. The cell nucleus was stained with DAPI solution (1:1000; Invitrogen) for 5 min at room temperature. Cells defined as apoptotic were those in which the whole nuclear area was labeled green. The counts were performed in three different sets of experiments, and the three sets of results were averaged for analyzed.

mRNA expression of NPDCs cultured with self-assembling peptides

The cell peptide hydrogels were disrupted mechanically, and a quantitative real-time polymerase chain reaction (qRT-PCR) was conducted as previously described.²⁹ Briefly, the total RNA was extracted by using Trizol reagent. Then, the cDNA of total RNA was obtained by using a reverse transcription reagent. One microliter of RNA was mixed with 2 μL of 5× PrimeScript^® RT MasterMix, and 10 μL of RNase Free dH₂O was added. The mixed solutions were incubated for 15 min at 37°C and then at 85°C for 5 s, and they were finally stored at −80°C for qRT-PCR. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the control, and the mRNA levels of apoptosis- and ECM-related genes collagen IIα1, Sox-9, aggrecan, BCL-2, and BAX were analyzed. The primers used for amplification are shown in Table 2, which were designed and produced by Sangon Biotech Corporation (Shanghai, China). After a cycle of 95°C for 20 s, the reactions were cycled 40 times at 95°C for 5 s and at 60°C for 20 s. The cycle threshold (Ct) value was then obtained for each sample, and the values of triplicate samples were averaged. The 2^−ΔΔCt values were used to evaluate the relative expression levels of the genes.

Table 2.

Nucleotide Sequences of the Primers Used for Quantitative Real-Time Polymerase Chain Reaction

Gene	GenBank ID	Forward sequence	Reverse sequence
GAPDH	NM_000576.2	GAAGGTCGGAGTCAACGG	GGAAGATGGTGATGGGATT
Collagen II α1	NM_001844.4	GGTAAGTGGGGCAAGACTGTTA	TGTTGTTTCTGGGTTCAGGTTT
Sox-9	NM_000346.3	GCCTCTACTCCACCTTCACCTA	GCTGTGTGTAGACAAGTTGTT
Aggrecan	NM_001135.3	GTCAGATACCCCATCCACACTC	CATAAAAGACCTCACCCTCCAT

Statistical analysis

The data are presented as mean ± standard deviation. A statistical comparison of the differences in means between groups was conducted by using analysis of variance with SPSS13.0 software (Chicago, IL). The Student−Newman−Keuls' test (homogeneity of variance) or the Tamhane's test (heterogeneity of variance) was performed to compare any two groups. A p value of < 0.05 was considered to indicate a significant difference.

Results

Culture of self-assembly peptides

After the peptide powders were dissolved in sucrose solution, both peptides (RADA16-I and RADA-RKPS) remained in liquid form. When 100 μL of this liquid added to millicells was cultured under physiological conditions, both peptides could self-assemble and formed transparent viscous hydrogels. The morphology of both self-assembled peptide hydrogels in 2D and 3D culture is shown in Figure 1.

Viability of NPDCs

Live/dead staining was used to detect the viability of NPDCs seeded on the peptide hydrogels; cells stained green indicate viability, whereas those stained red indicate dead cells. The percentages of live and dead cells were compared between groups and culture conditions. As shown in Figure 2, the live cell percentage decreased by 40% and 12% in the RADA16-I and RADA-RKPS groups, respectively, for 2D culture under apoptosis conditions (both p < 0.05), and by 46% and 17% (both p < 0.05) in 3D culture. Under apoptotic conditions, the application of the RADA-RKPS peptide increased the live cell number of NPDCs by 47% in 2D culture and by 54% in 3D culture (both p < 0.05) compared with RADA16-I.

FIG. 2.

Live/dead staining of NPDCs seeded on the self-assembling peptide hydrogel. Live/dead staining of cell-seeded peptides in different groups in 2D or 3D cultures (A, D: RADA16-I; B, E: RADA16-I+TNF-α; C, F: RADA-RKPS+TNF-α). Quantification of cell percentage (live and dead) from images in 2D (G) and 3D (H) culture after 48 h of apoptosis induction. All data are expressed as the mean ± standard error of the mean. n = 5. Bar = 100 μm. *p < 0.05 as compared with the RADA16-I group, ^#p < 0.05 as compared with the RADA16-I + TNF-α group. TNF-α, tumor necrosis factor-α. Color images available online at www.liebertpub.com/tea

Proliferation and numbers of NPDCs

Cell number counting and the CCK8 assay were used to determine the proliferation ability of NPDCs in each group. There was a significantly lower number of NPDCs in apoptotic 2D culture (decrease of 48% for RADA16-I and of 7% for RADA-RKPS, both p < 0.05) and 3D culture (decrease of 39% for RADA16-I and of 12% for RADA-RKPS, both p < 0.05) compared with the control group (Fig. 3). Moreover, the number of NPDCs was significantly higher in the RADA-RKPS group than the RADA16-I group, with an increase of 45% for 2D culture and of 24% for 3D culture (Fig. 3, both p < 0.05). In the CCK-8 assay, the optical density value showed a significant decrease of 67% for RADA16-I and of 28% for RADA-RKPS in 2D culture (both p < 0.05) and of 50% for RADA16-I and of 14% for RADA-RKPS in 3D culture (both p < 0.05) compared with the control (Fig. 3). Proliferation was obviously higher in the RADA-RKPS peptide group, with an increase of 55% in 2D culture and of 45% in 3D culture compared with the RADA16-I group.

FIG. 3.

Cell numbers and results of proliferation assay of NPDCs in 2D and 3D cultures. Representative images of NPDCs in the 2D (A–C) and 3D (D–F) cultured groups. (G) Investigation of growth rate of NPDCs culture using cell number counting in each group. (H) The CCK-8 values of NPDCs in the 2D and 3D culture hydrogels. All data are expressed as the mean ± standard error of mean. n = 5, Bar = 100 μm. *p < 0.05 as compared with the RADA16-I group, ^#p < 0.05 as compared with the RADA16-I + TNF-α group. Color images available online at www.liebertpub.com/tea

Cell apoptosis with in situ detection of DNA fragmentation

Apoptotic cells were clearly evident as visualized by the TUNEL assay (Fig. 4A). In the control group, there was only a small proportion of apoptotic cells (3.5% ± 2.2%), whereas the percentage of apoptotic cells was 11–15-fold higher in the RADA16-I group and 3–6-fold higher in the RADA-RKPS group after 48 h of apoptosis induction (both p < 0.05). Furthermore, the RADA-RKPS peptide showed a significant reduction of apoptosis compared with RADA16-I, with 67% less TUNEL-positive cells, in 3D culture (Fig. 4, p < 0.05).

FIG. 4.

Preventative effects of RADA-RKPS on TNF-α-induced apoptosis in cultured NPDCs detected by TUNEL staining. The green-stained cells indicate apoptotic cells, and the blue-stained cells (DAPI) indicate nuclei (A). The percentage of apoptotic cells showed an obvious reduction in the RADA-RKPS peptide group compared with the RADA16-I group in 3D culture (B). All data are expressed as the mean ± standard error of mean. n = 5. *p < 0.05 as compared with the RADA16-I group, ^#p < 0.05 as compared with the RADA16-I + TNF-α group. Color images available online at www.liebertpub.com/tea

Effect of self-assembling peptides on cell morphology and the expression of apoptosis-related gene in NPDCs

To examine the protective effect of the peptides on NPDCs cultured in an apoptosis environment, cell morphology was examined, and the ratio of BAX/BCL-2 expression was compared across groups. After culture in an apoptosis environment for 48 h, NPDCs in both groups exhibited a shrinking and disordered cell morphology compared with those cultured in the normal environment; however, these changes were reduced in the RADA-RKPS peptide group compared with the RADA16-I peptide group, indicating a protective role of the RADA-RKPS peptide to some extent (Fig. 5A–C). Furthermore, the BAX mRNA levels were significantly increased in 2D culture (66% in the RADA16-I group and 23% in the RADA-RKPS group, Fig. 5D, both p < 0.05) and in 3D culture (51% in the RADA16-I group and 17% in the RADA-RKPS group, Fig. 5D, both p < 0.05) compared with controls. Similarly, the BCL-2 expression level decreased by 41% and 27% in the RADA16-I and RADA-RKPS groups, respectively, in 2D culture, and by 46% and 25%, respectively, in 3D culture (Fig. 5E, all p < 0.05) after 48 h of apoptosis induction. Moreover, compared with the control group, the apoptosis environment increased the BAX/BCL-2 ratio in the RADA-16-I group and the RADA-RKPS group by 2.2–3.4-fold and 1.8–3.2-fold, respectively, in 2D culture, and by 1.3–1.7-fold and 1.1–1.4-fold, respectively, in 3D culture (both p < 0.05, Fig. 5F). In addition, the RADA-RKPS peptide reduced the BAX/BCL-2 ratio by 40% in 2D culture and by 58% in 3D culture (both p < 0.05, Fig. 5F) compared with RADA-16I. Thus, TNF-α highly induced cell apoptosis, but this process was suppressed in the presence of RADA-RKPS peptides.

FIG. 5.

Effect of self-assembling peptides on cell morphology and expression of apoptosis-related genes in NPDCs. Cell morphology of NPDCs in different groups (A–C). The gene expression of BAX, BCL-2 and BAX/BCL-2 ratios of NPDCs were compared across groups after 48 h of apoptosis induction in 2D or 3D culture (D–F). All data are expressed as the mean ± standard error of mean. n = 5. *p < 0.05 as compared with the RADA16-I group, ^#p < 0.05 as compared with the RADA16-I + TNF-α group. Color images available online at www.liebertpub.com/tea

Effect of self-assembling peptides on expression of ECM-related genes in an apoptotic environment

To examine the effect of the peptides on ECM production in the face of apoptosis, the expression levels of aggrecan, Sox-9, and collagen II a1 were examined in NPDCs obtained from the 2D and 3D cultures. In 2D culture with both peptides, the apoptotic environment significantly decreased the mRNA levels of all three genes compared with the control group (Fig. 6A–C). Furthermore, RADA-RKPS enhanced the mRNA expression levels of all three genes as compared with RADA16-I (Fig. 6A–C, all p < 0.05). Similar results were found for the 3D culture (Fig. 6A–C).

FIG. 6.

Effect of self-assembling peptides on expression of ECM production in an apoptotic environment. (A–C) The mRNA levels of aggrecan, Sox-9, and collagen II a1 in NPDCs after 48 h of apoptosis induction in 2D/3D culture. All data are expressed as the mean ± standard error of mean. n = 5. *p < 0.05 as compared with the RADA16-I group, ^#p < 0.05 as compared with the RADA16-I + TNF-α group. Color images available online at www.liebertpub.com/tea

Discussion

Biological therapy is a promising method for repairing the damage of IVDD rather than current treatments that simply relieve symptoms, and, thus, it has attracted increased attention in recent years. The advantage of IVD tissue engineering is the incorporation of both cells and growth factors.³⁹ Hence, in this work, we developed a functional self-assembling peptide, RADA-RKPS, by conjugating an important functional short motif (RKPS) onto the C-terminal of RADA16-I, which showed the protective ability of NPDCs in an apoptosis environment. Through several lines of evidence, our results collectively suggest the potential application of RADA-RKPS peptides in the development of further biological treatment strategies for IVDD.

TNF-α, as an inducer of necrosis, was believed to accelerate the degradation of IVD ECM, leading to denaturalization of the disk tissue and finally causing an imbalance between catabolism and anabolism.⁶ In several in vitro studies, exogenous TNF-α was used as an initiator and it plays a key role in IVDD in several studies.^13,40–43 On the other hand, several approaches studied the counteraction effects of TNF-α on disk degeneration.^44–46 In addition, anti-TNF-α therapy, given at the same time as TNF-α stimulation, was the most effective at inhibiting the expression of these cytokines.^7,47 Hence, TNF-α synthesized in the disk area is a key mediator in the pathogenesis of IVDD.^6,48 Moreover, TNF-α expression in the IVDs has been associated with the degree of IVDD severity.^49,50 Therefore, the apoptosis induction time and dose of TNF-α used in the present study was selected based on a number of published studies in IVDD.^5,18,51 These conditions were clearly sufficient to induce significant apoptosis of cells and the expression of related genes when compared with the control group, indicating that the in vitro apoptosis induction protocol of NPDCs adopted was feasible and trustworthy for further interpretation of the results.

RADA16-I, as a self-assembly peptide, was originally developed to overcome the shortcomings of current biomaterials and to provide a beneficial 3D microenvironment for different tissues. One of its greatest advantages is that it can enhance cellular behaviors through a combination with biomolecules or functionalized motifs.²⁶ The regeneration of various tissues has demonstrated to benefit from the application of RADA16-I peptide via its functional self-assembly properties.^52–54 Our previous studies have proved that RADA-RKPS conjugated with the KPSS motif (an active fragment of BMP-7 protein) is a promising candidate for NP tissue regeneration with good biocompatibility.^28–30 However, the environment in IVDD is completely different from the normal culture medium that was used for these in vitro studies. Therefore, in the present study, we sought to evaluate whether the RADA-RKPS peptide plays a protective role in cells in an apoptosis environment.

Seed cells are considered to have primary functions in IVD tissue engineering and regeneration medicine. Although numerous cell types have been tested for this application, such as IVD cells, Wharton's jelly cells, and stem cells,^55–58 the harsh environment of high compressive load, acidic pH, hypoxia, hyperosmolarity, and limited nutrition in the IVD makes it difficult for exogenously transplanted cells to survive and proliferate.⁵⁹ Therefore, the newly found cell type NPDCs has increasingly become a focal point as an optimal candidate for endogenous repair.^37,60 In this study, we used NPDCs to assess the biological effects of the RADA-RKPS peptide in the presence of an apoptosis environment and our results confirmed the improved cell survival rate and proliferation ability as compared with the RADA16-I group. These findings suggest that the RADA-RKPS peptide exerts a protective effect on the viability and proliferation of NPDCs in an apoptosis environment.

The central function of apoptosis in the degenerative process has been confirmed both in vivo and in vitro, mainly through the TUNEL assay.^61,62 Indeed, analysis of our 3D cell culture showed a significantly higher proportion of TUNEL-positive NPDCs in the apoptosis induction group than in the control group. In addition, the reduction in TUNEL-positive cells in cells grown with RADA-RKPS indicated a protective effect of the peptide. Because of the anti-apoptotic effects of the BCL-2 gene and the apoptosis-promoting role of the BAX gene,^63,64 the BAX/BCL-2 ratio serves as a useful marker to assess cell apoptosis.⁶⁵ RADA-RKPS was also found to strongly decrease this ratio, further supporting its protective role of NPDCs in an apoptosis environment.

Numerous studies have indicated that BMP-7 plays an important role in NP tissue regeneration,^66–68 including our own studies demonstrating its effects on decreasing disk degeneration in animal models.^23,24 Although the synthesis of ECM components was significantly enhanced by BMP-7, we further demonstrated that RADA-RKPS peptides can enhance the production of aggrecan, collagen II a1, and Sox-9 in an apoptosis environment. This suggests that the KPSS motif conjugated in RADA16-I caused the observed differences in the effects between the RADA16-I and RADA-RKPS peptides. Therefore, all of these findings prove that the RADA-RKPS peptide is a promising peptide and should be treated as a potential candidate for IVDD treatment, owing to its beneficial effects for promoting NPDCs to differentiate into NP-like cells.

There are several limitations of the current study that should be mentioned. First, the actual environment in IVDD is complicated with various factors that are hard to mimic completely. In addition, both the intrinsic and extrinsic pathways of apoptosis are likely to play critical roles in IVDD, and our study might only address one part of this process since only TNF-α was used to induce an in vitro apoptosis environment. Nevertheless, this apoptosis-inducing model has been demonstrated to be effective based on independent lines of evidence, and it has been supported by several other reports.^49–51 Finally, since this study was only conducted in vitro, the next stage would be to confirm these effects of RADA-RKPS peptides in vivo by using an animal model of IVDD.

Conclusion

In conclusion, we demonstrate that the RADA-RKPS peptide can enhance the viability, proliferation, and differentiation ability of NPDCs toward NPC-like cells, while reducing the cell apoptosis in an induced apoptosis environment in vitro. Hence, it is believed that the RADA-RKPS functional peptide should be taken as a promising and potential material for NPDCs encapsulation in the regenerative process of IVDD.

Footnotes

Acknowledgments

The authors thank Prof. Wang Xiumei and Chen Yingying, MD, both from Tsinghua University, for helping with the design of the self-assembling peptide and for providing guidance in forming the hydrogels.

Disclosure Statement

No competing financial interests exist.

References

Rubin

D.I.

Epidemiology and risk factors for spine pain. Neurol Clin, 25, 353, 2007.

Adams

M.A.

, and Roughley

P.J.

What is intervertebral disc degeneration, and what causes it? Spine, 31, 2151, 2006.

Colombier

, Clouet

, Hamel

, Lescaudron

, and Guicheux

The lumbar intervertebral disc: from embryonic development to degeneration. Joint Bone Spine, 81, 125, 2014.

Sakai

, and Grad

Advancing the cellular and molecular therapy for intervertebral disc disease. Adv Drug Deliv Rev, 84, 159, 2015.

Wei

, Brisby

, Chung

S.A.

, and Diwan

A.D.

Bone morphogenetic protein-7 protects human intervertebral disc cells in vitro from apoptosis. Spine J, 8, 466, 2008.

Risbud

M.V.

, and Shapiro

I.M.

Role of cytokines in intervertebral disc degeneration: pain and disc content. Nat Rev Rheumatol, 10, 44, 2014.

Johnson

Z.I.

, Schoepflin

Z.R.

, Choi

, Shapiro

I.M.

, and Risbud

M.V.

Disc in flames: roles of TNF-alpha and IL-1beta in intervertebral disc degeneration. Eur Cell Mater, 30, 104, 2015.

, Liu

, Wu

, Chen

, Jia

, Bai

, and Ruan

Blocking the function of inflammatory cytokines and mediators by using IL-10 and TGF-beta: a potential biological immunotherapy for intervertebral disc degeneration in a beagle model. Int J Mol Sci, 15, 17270, 2014.

Ding

, Shao

Z.W.

, and Xiong

L.M.

Cell death in intervertebral disc degeneration. Apoptosis, 18, 777, 2013.

10.

Jiang

, Zhang

, Zheng

, Ru

, Ni

, Wu

, Tian

, Huang

, Xue

, Wang

, and Xu

Apoptosis, senescence, and autophagy in rat nucleus pulposus cells: implications for diabetic intervertebral disc degeneration. J Orthop Res, 31, 692, 2013.

11.

Zhang

, Zhao

, Shen

, and Zhang

Molecular mechanisms of cell death in intervertebral disc degeneration (Review). Int J Mol Med, 37, 1439, 2016.

12.

Park

J.B.

, Chang

, and Kim

K.W.

Expression of Fas ligand and apoptosis of disc cells in herniated lumbar disc tissue. Spine, 26, 618, 2001.

13.

Markova

D.Z.

, Kepler

C.K.

, Addya

, Murray

H.B.

, Vaccaro

A.R.

, Shapiro

I.M.

, Anderson

D.G.

, Albert

T.J.

, and Risbud

M.V.

An organ culture system to model early degenerative changes of the intervertebral disc II: profiling global gene expression changes. Arthritis Res Ther, 15, R121, 2013.

14.

, Surendran

, Zawaideh

M.A.

, Mathew

, and Hruska

K.A.

Bone morphogenetic protein 7: a novel treatment for chronic renal and bone disease. Curr Opin Nephrol Hypertens, 13, 417, 2004.

15.

Vukicevic

, Basic

, Rogic

, Basic

, Shih

M.S.

, Shepard

, Jin

, Dattatreyamurty

, Jones

, Dorai

, Ryan

, Griffiths

, Maliakal

, Jelic

, Pastorcic

, Stavljenic

, and Sampath

T.K.

Osteogenic protein-1 (bone morphogenetic protein-7) reduces severity of injury after ischemic acute renal failure in rat. J Clin Invest, 102, 202, 1998.

16.

R.X.

, Yiu

W.H.

, and Tang

S.C.

Role of bone morphogenetic protein-7 in renal fibrosis. Front Physiol, 6, 114, 2015.

17.

Ellman

M.B.

, Kim

, An

H.S.

, Chen

, Kc

, Li

, Xiao

, Yan

, Suh

, van Wjnen

A.J.

, Wang

J.H.

, Kim

S.G.

, and Im

H.J.

Lactoferricin enhances BMP7-stimulated anabolic pathways in intervertebral disc cells. Gene, 524, 282, 2013.

18.

Masuda

, Takegami

, An

, Kumano

, Chiba

, Andersson

G.B.

, Schmid

, and Thonar

Recombinant osteogenic protein-1 upregulates extracellular matrix metabolism by rabbit annulus fibrosus and nucleus pulposus cells cultured in alginate beads. J Orthop Res, 21, 922, 2003.

19.

Kawakami

, Hashizume

, Matsumoto

, Enyo

, Okada

, Yoshida

, and Chubinskaya

Safety of epidural administration of Osteogenic Protein-1 (OP-1/BMP-7): behavioral and macroscopic observation. Spine, 32, 1388, 2007.

20.

Masuda

, Imai

, Okuma

, Muehleman

, Nakagawa

, Akeda

, Thonar

, Andersson

, and An

H.S.

Osteogenic protein-1 injection into a degenerated disc induces the restoration of disc height and structural changes in the rabbit anular puncture model. Spine, 31, 742, 2006.

21.

Kawakami

, Matsumoto

, Hashizume

, Kuribayashi

, Chubinskaya

, and Yoshida

Osteogenic protein-1 (osteogenic protein-1/bone morphogenetic protein-7) inhibits degeneration and pain-related behavior induced by chronically compressed nucleus pulposus in the rat. Spine, 30, 1933, 2005.

22.

H.S.

, Takegami

, Kamada

, Nguyen

C.M.

, Thonar

E.J.

, Singh

, Andersson

G.B.

, and Masuda

Intradiscal administration of osteogenic protein-1 increases intervertebral disc height and proteoglycan content in the nucleus pulposus in normal adolescent rabbits. Spine, 30, 25, 2005.

23.

Wang

, Ruan

D.K.

, Zhang

, Wang

D.L.

, Xin

, and Zhang

Effects of adeno-associated virus-2-mediated human BMP-7 gene transfection on the phenotype of nucleus pulposus cells. J Orthop Res, 29, 838, 2011.

24.

, Shi

, Wang

, Chen

, Wu

, Wang

, Xu

, He

, and Ruan

Human bone morphogenetic protein 7 transfected nucleus pulposus cells delay the degeneration of intervertebral disc in dogs. J Orthop Res, 2015. DOI: 0.1002/jor.22995

25.

Maude

, Ingham

, and Aggeli

Biomimetic self-assembling peptides as scaffolds for soft tissue engineering. Nanomedicine (Lond), 8, 823, 2013.

26.

Meng

, Yao

, Wang

, and Chen

RADA16: a self-assembly peptide hydrogel for the application in tissue regeneration. J Biomat Tissue Eng, 4, 1019, 2014.

27.

Holmes

T.C.

, de Lacalle

, Su

, Liu

, Rich

, and Zhang

Extensive neurite outgrowth and active synapse formation on self-assembling peptide scaffolds. Proc Natl Acad Sci U S A, 97, 6728, 2000.

28.

Tao

, Wu

, Li

, Wang

, Zhang

, Li

, Wen

, Wang

, He

, Wang

, and Ruan

BMP7-based functionalized self-assembling peptides for nucleus pulposus tissue engineering. ACS Appl Mater Interfaces, 7, 17076, 2015.

29.

Tao

, Zhang

, Wang

C.F.

, Zhang

, Wang

X.M.

, Wang

D.L.

, Bai

X.D.

, Wen

T.Y.

, Xin

H.K.

, Wu

J.H.

, Liu

, He

, and Ruan

Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A, 20, 1621, 2014.

30.

, Jia

, Liu

, Zhao

, Li

, Wang

, Tao

, Tang

, He

, and Ruan

Functional self-assembled peptide nanofibers for bone marrow mesenchymal stem cell encapsulation and regeneration in nucleus pulposus. Artif Organs, 40, E112, 2016.

31.

Han

, Wang

H.C.

, Li

, Tao

Y.Q.

, Liang

C.Z.

, Li

F.C.

, Chen

, and Chen

Q.X.

Nucleus pulposus mesenchymal stem cells in acidic conditions mimicking degenerative intervertebral discs give better performance than adipose tissue-derived mesenchymal stem cells. Cells Tissues Organs, 199, 342, 2014.

32.

Huang

Y.C.

, Leung

V.Y.

, Lu

W.W.

, and Luk

K.D.

The effects of microenvironment in mesenchymal stem cell-based regeneration of intervertebral disc. Spine J, 13, 352, 2013.

33.

Wang

, Zhou

, Chu

T.W.

, Li

C.Q.

, Wang

, Zhang

Z.F.

, and Huang

Distinguishing characteristics of stem cells derived from different anatomical regions of human degenerated intervertebral discs. Eur Spine J, 25, 2691, 2016.

34.

Sakai

, Nakamura

, Nakai

, Mishima

, Kato

, Grad

, Alini

, Risbud

M.V.

, Chan

, Cheah

K.S.

, Yamamura

, Masuda

, Okano

, Ando

, and Mochida

Exhaustion of nucleus pulposus progenitor cells with ageing and degeneration of the intervertebral disc. Nat Commun, 3, 1264, 2012.

35.

Navaro

, Bleich-Kimelman

, Hazanov

, Mironi-Harpaz

, Shachaf

, Garty

, Smith

, Pelled

, Gazit

, Seliktar

, and Gazit

Matrix stiffness determines the fate of nucleus pulposus-derived stem cells. Biomaterials, 49, 68, 2015.

36.

Blanco

J.F.

, Graciani

I.F.

, Sanchez-Guijo

F.M.

, Muntion

, Hernandez-Campo

, Santamaria

, Carrancio

, Barbado

M.V.

, Cruz

, Gutierrez-Cosio

, Herrero

, San Miguel

J.F.

, Brinon

J.G.

, and del Canizo

M.C.

Isolation and characterization of mesenchymal stromal cells from human degenerated nucleus pulposus: comparison with bone marrow mesenchymal stromal cells from the same subjects. Spine, 35, 2259, 2010.

37.

, Peroglio

, Alini

, and Grad

Potential and limitations of intervertebral disc endogenous repair. Curr Stem Cell Res Ther, 10, 329, 2015.

38.

Mizrahi

, Sheyn

, Tawackoli

, Ben-David

, Su

, Li

, Oh

, Bae

, Gazit

, and Gazit

Nucleus pulposus degeneration alters properties of resident progenitor cells. Spine J, 13, 803, 2013.

39.

Sun

, Luo

, Liu

, Huang

, Liu

, Ma

, Gao

, Liu

Z.H.

, Chen

Y.F.

, Huang

J.H.

, and Luo

Effect of perfluorotributylamine-enriched alginate on nucleus pulposus cell: implications for intervertebral disc regeneration. Biomaterials, 82, 34, 2016.

40.

Hayashi

, Taira

, Inoue

, Koshi

, Ito

, Yamashita

, Yamauchi

, Suzuki

, Takahashi

, and Ohtori

TNF-alpha in nucleus pulposus induces sensory nerve growth: a study of the mechanism of discogenic low back pain using TNF-alpha-deficient mice. Spine, 33, 1542, 2008.

41.

Larrick

J.W.

, and Wright

S.C.

Cytotoxic mechanism of tumor necrosis factor-alpha. FASEB J, 4, 3215, 1990.

42.

Ponnappan

R.K.

, Markova

D.Z.

, Antonio

P.J.

, Murray

H.B.

, Vaccaro

A.R.

, Shapiro

I.M.

, Anderson

D.G.

, Albert

T.J.

, and Risbud

M.V.

An organ culture system to model early degenerative changes of the intervertebral disc. Arthritis Res Ther, 13, R171, 2011.

43.

Purmessur

, Walter

B.A.

, Roughley

P.J.

, Laudier

D.M.

, Hecht

A.C.

, and Iatridis

A role for TNFalpha in intervertebral disc degeneration: a non-recoverable catabolic shift. Biochem Biophys Res Commun, 433, 151, 2013.

44.

Wang

, Hutton

W.C.

, and Yoon

S.T.

Bone morphogenetic protein-7 antagonizes tumor necrosis factor-alpha-induced activation of nuclear factor kappaB and up-regulation of the ADAMTS, leading to decreased degradation of disc matrix macromolecules aggrecan and collagen II. Spine J, 14, 505, 2014.

45.

Kim

H.J.

, Yeom

J.S.

, Koh

Y.G.

, Yeo

J.E.

, Kang

K.T.

, Kang

Y.M.

, Chang

B.S.

, and Lee

C.K.

Anti-inflammatory effect of platelet-rich plasma on nucleus pulposus cells with response of TNF-alpha and IL-1. J Orthop Res, 32, 551, 2014.

46.

Liu

, Pan

, Yang

, Wang

, Zhang

, Li

, Wang

, Ding

, Li

, and Zheng

LIM mineralization protein-1 suppresses TNF-alpha induced intervertebral disc degeneration by maintaining nucleus pulposus extracellular matrix production and inhibiting matrix metalloproteinases expression. J Orthop Res, 33, 294, 2015.

47.

Walter

B.A.

, Purmessur

, Likhitpanichkul

, Weinberg

, Cho

S.K.

, Qureshi

S.A.

, Hecht

A.C.

, and Iatridis

J.C.

Inflammatory kinetics and efficacy of anti-inflammatory treatments on human nucleus pulposus cells. Spine, 40, 955, 2015.

48.

Kang

, Li

, Rickers

, Ringgaard

, Xie

, and Bunger

Intervertebral disc degenerative changes after intradiscal injection of TNF-alpha in a porcine model. Eur Spine J, 24, 2010, 2015.

49.

Weiler

, Nerlich

A.G.

, Bachmeier

B.E.

, and Boos

Expression and distribution of tumor necrosis factor alpha in human lumbar intervertebral discs: a study in surgical specimen and autopsy controls. Spine, 30, 44, 2005.

50.

Igarashi

, Kikuchi

, Shubayev

, and Myers

R.R.

2000 Volvo Award winner in basic science studies: exogenous tumor necrosis factor-alpha mimics nucleus pulposus-induced neuropathology. Molecular, histologic, and behavioral comparisons in rats. Spine, 25, 2975, 2000.

51.

Zhang

, An

H.S.

, Song

, Toofanfard

, Masuda

, Andersson

G.B.

, and Thonar

E.J.

Growth factor osteogenic protein-1: differing effects on cells from three distinct zones in the bovine intervertebral disc. Am J Phys Med Rehabil, 83, 515, 2004.

52.

Sun

, Li

, Wu

, Zhang

, Ouyang

, Song

, Fang

, Seeram

, Xue

, He

, and Wu

Functional self-assembling peptide nanofiber hydrogels designed for nerve degeneration. ACS Appl Mater Interfaces, 8, 2348, 2016.

53.

Zhang

, Luo

, He

, Zhou

, and Wu

A self-assembly peptide nanofibrous scaffold reduces inflammatory response and promotes functional recovery in a mouse model of intracerebral hemorrhage. Nanomedicine, 12, 1205, 2016.

54.

Liu

, Wang

, Ren

, He

, Qiao

, and Cui

F.Z.

Functionalized self-assembling peptide nanofiber hydrogels mimic stem cell niche to control human adipose stem cell behavior in vitro. Acta Biomater, 9, 6798, 2013.

55.

Zhang

, Tao

, Gu

, Zhou

, Jia

, Jiang

, Chen

, Han

, Xu

, Wang

, He

, and Ruan

The effects of human Wharton's jelly cell transplantation on the intervertebral disc in a canine disc degeneration model. Stem Cell Res Ther, 6, 154, 2015.

56.

Nukaga

, Sakai

, Tanaka

, Hiyama

, Nakai

, and Mochida

Transplantation of activated nucleus pulposus cells after cryopreservation: efficacy study in a canine disc degeneration model. Eur Cells Mater, 31, 95, 2016.

57.

Mochida

, Sakai

, Nakamura

, Watanabe

, Yamamoto

, and Kato

Intervertebral disc repair with activated nucleus pulposus cell transplantation: a three-year, prospective clinical study of its safety. Eur Cells Mater, 29, 202, 2015.

58.

Wei

, Chung

S.A.

, Tao

, Brisby

, Lin

, Shen

, Ma

D.D.

, and Diwan

A.D.

Differentiation of rodent bone marrow mesenchymal stem cells into intervertebral disc-like cells following coculture with rat disc tissue. Tissue Eng Part A, 15, 2581, 2009.

59.

Chan

S.C.

, and Gantenbein-Ritter

Intervertebral disc regeneration or repair with biomaterials and stem cell therapy—feasible or fiction? Swiss Med Wkly, 142, w13598, 2012.

60.

Shen

, Zhang

, Chai

, and Ma

Isolation and characterization of mesenchymal stem-like cells from human nucleus pulposus tissue. Sci China Life Sci, 58, 509, 2015.

61.

Vasiliadis

E.S.

, Pneumaticos

S.G.

, Evangelopoulos

D.S.

, and Papavassiliou

A.G.

Biologic treatment of mild and moderate intervertebral disc degeneration. Mol Med, 20, 400, 2014.

62.

Buckwalter

J.A.

Aging and degeneration of the human intervertebral disc. Spine, 20, 1307, 1995.

63.

Filipovic

, Zlatkovic

, Inta

, Bjelobaba

, Stojiljkovic

, and Gass

Chronic isolation stress predisposes the frontal cortex but not the hippocampus to the potentially detrimental release of cytochrome c from mitochondria and the activation of caspase-3. J Neurosci Res, 89, 1461, 2011.

64.

Grang

, Gaudin

, Trocme

, Phelip

, Morel

, and Juvin

Intervertebral disk degeneration and herniation: the role of metalloproteinases and cytokines. Joint Bone Spine, 68, 547, 2001.

65.

Kermani

H.R.

, Hoboubati

, Esmaeili-Mahani

, and Asadi-Shekaari

Induction of intervertebral disc cell apoptosis and degeneration by chronic unpredictable stress. J Neurosurg Spine, 20, 578, 2014.

66.

Pratsinis

, and Kletsas

Organotypic cultures of intervertebral disc cells: responses to growth factors and signaling pathways involved. BioMed Res Int, 2015, 427138, 2015.

67.

Hiyama

, Sakai

, and Mochida

Cell signaling pathways related to pain receptors in the degenerated disk. Global Spine J, 3, 165, 2013.

68.

Than

K.D.

, Rahman

S.U.

, Vanaman

M.J.

, Wang

A.C.

, Lin

C.Y.

, Zhang

, La Marca

, and Park

Bone morphogenetic proteins and degenerative disk disease. Neurosurgery, 70, 996, 2012.