ZC3H13 Regulates Ferroptosis to Enhance Osteogenic Differentiation in Osteoporotic BMSCs

Abstract

Objectives:

N6-methyladenosine (m⁶A) modification is critical in the regulation of osteoporosis (OP). Although ZC3H13 is an important m⁶A methyltransferase, its specific regulatory effects and mechanisms in osteoporosis are not yet fully understood. Therefore, we investigated the impact of ZC3H13 on the osteogenic potential of bone marrow-derived mesenchymal stem cells (BMSCs) in osteoporosis and attempted to elucidate its underlying mechanism.

Materials and Methods:

Western blotting, quantitative reverse transcription polymerase chain reaction, and immunohistochemical staining were used to identify changes in ZC3H13 and osteogenic factor (RUNX2 and OPN) expression in osteoporosis. Gain- and loss-of-function experiments were conducted to study the impact of ZC3H13 on the osteogenic differentiation of osteoporotic BMSCs (OP-BMSCs). Transcriptomic sequencing, transmission electron microscopy, and intraperitoneal injection of the ferroptosis inhibitor ferrostatin-1 (Fer-1) were used to elucidate the downstream mechanisms regulated by ZC3H13 in osteoporosis. In addition, rescue assays were performed to elucidate the underlying molecular mechanisms involved.

Results:

Here, we revealed that ZC3H13 was downregulated in OP-BMSCs and osteoporotic rat femurs, which correlated with the reduced osteogenic differentiation of OP-BMSCs. Functionally, ZC3H13 knockdown resulted in decreased osteogenic differentiation of the BMSCs, whereas ZC3H13 overexpression promoted the osteogenic differentiation of the OP-BMSCs. Furthermore, ZC3H13 knockdown was closely related to metal ion binding, reduced cell proliferation, and altered mitochondrial morphology. Treatment with the ferroptosis inhibitor Fer-1 partially reversed osteoporotic phenotypes in vivo. Mechanistically, ZC3H13 was shown to promote osteogenic differentiation in OP-BMSCs by inhibiting ferroptosis.

Conclusions:

Our study revealed that ZC3H13 promoted the osteogenic differentiation of BMSCs by inhibiting ferroptosis in osteoporosis. This research offers a reliable theoretical foundation for predicting and treating osteoporosis.

Impact Statement

Introduction

Osteoporosis (OP) is a prevalent metabolic bone disease characterized by an imbalance between bone formation and resorption, which results in decreased bone mass, destruction of the bone microstructure, and increased susceptibility to fractures.^1,2 As the global population ages, the prevalence of OP is expected to reach 212 million by 2050, significantly impacting public health and increasing fracture rates.^3,4 Currently, traditional drugs for the treatment of OP present several disadvantages, including prolonged treatment cycles, toxic side effects, and complications such as atypical femoral fractures, osteonecrosis of the jaw, and gastrointestinal irritation.⁵ These limitations have prompted the exploration of novel therapeutic approaches, such as stem cell therapy. Autologous bone marrow-derived mesenchymal stem cells (BMSCs) demonstrate significant osteogenic potential and immunomodulatory properties, making them a preferred choice for regenerative medicine.⁶ In preliminary studies, we observed that BMSCs from ovariectomy (OVX) models exhibited significantly reduced osteogenic differentiation potential compared with controls,⁷ yet the underlying mechanism remains unclear. Elucidating these molecular mechanisms is essential for improving their osteogenic capacity and therapeutic application.

N6-methyladenosine (m⁶A) is the most prevalent internal RNA modification in eukaryotes,⁸ playing a crucial role in posttranscriptional gene regulation.^9,10 It regulates key biological processes such as stem cell proliferation, differentiation,¹¹ and bone homeostasis.¹² The m⁶A modification is dynamically and reversibly regulated by methyltransferases and demethylases.^13,14 The m⁶A methyltransferase complex, composed of METTL3, METTL14, and WTAP,¹⁵ facilitates m⁶A modification of target RNA. Auxiliary proteins, such as zinc finger CCCH domain-containing protein 13 (ZC3H13),^16,17 and METTL16¹⁸ are also integral to m⁶A formation. Recent studies highlight the regulatory role of m⁶A modification in osteogenesis. Huang¹⁹ et al. demonstrated that METTL14 downregulation in osteoporosis patients and OVX mice decreased osteogenesis-related markers, leading to reduced bone mineralization. Wang²⁰ et al. reported that METTL3 overexpression enhances osteoblast function and mitigates age-related bone loss. In addition, Yang²¹ et al. discovered that m⁶A modification of osteoclast differentiation-related genes can diminish osteoclast activity, further underscoring the importance of m⁶A in bone homeostasis.

Currently, research on m⁶A modification in osteoporosis primarily focuses on the methyltransferase complex, with limited investigation into auxiliary proteins. In this study, we assessed the expression levels of m⁶A-related enzymes and identified that ZC3H13 was significantly downregulated in both the GEO database osteoporosis population and OP-BMSCs. Given its known role in facilitating m⁶A formation, we hypothesized that ZC3H13 may serve as a key regulator of the osteogenic potential of OP-BMSCs.

This study investigates the impact of ZC3H13 on OP development. We demonstrate that ZC3H13 promotes osteogenesis by inhibiting ferroptosis, a unique form of programmed cell death characterized by lipid peroxidation and iron overload. Transcriptomic sequencing revealed increased ferroptosis in OP-BMSCs compared with controls. These findings highlight the pivotal role of ZC3H13 in regulating OP progression and suggest potential therapeutic targets for the treatment of OP.

Materials and Methods

Establishment of an osteoporotic rat model and conducting of animal experiments

A total of forty 4-week-old female Sprague–Dawley rats were purchased from Southwest Medical University (Luzhou, China) and raised under standard conditions following the guidelines outlined in the Guide for the Care and Use of Laboratory Animals by the Ministry of Science and Technology of China (2006). The study was approved by the Ethics Committee of Southwest Medical University (20220819-017).

To construct the OP rat model, we randomly assigned the rats to either a control group (10 rats) or an osteoporosis (OP) group (30 rats). The rats in the OP group underwent bilateral OVX, whereas the rats in the control group underwent sham surgery involving an equal amount of adipose tissue. After 4 months, femurs were extracted from each group (10 rats per group) and scanned via a SCANCO medical instrument. The femurs were then decalcified and stained with hematoxylin and eosin (H&E) and Masson’s reagents and underwent ZC3H13 immunohistochemical (IHC) staining for further analysis. For Masson’s trichrome staining, collagen deposition was quantified to evaluate osteogenic potential. The blue-stained collagen areas were analyzed using ImageJ software. Specifically, the percentage of collagen-stained area relative to the total tissue area was calculated as follows: collagen area percentage = (collagen-stained area/total tissue area) × 100%. This quantification was performed on three biological replicates for each group, and the results were expressed as mean ± standard deviation (SD). Statistical significance was assessed to compare groups.

To investigate the regulatory role of ferroptosis in bone formation in vivo, we divided the remaining OP rats into two groups: a control group (OP) and a treatment group (OP+ferrostatin-1 [Fer-1]). The treatment group received intraperitoneal injections of 5 mg/kg Fer-1 twice a week for 8 weeks, whereas the control group received sodium citrate buffer. After 1 month, the rat femurs were collected for microcomputed tomography (micro-CT), H&E staining, and Masson staining, and the results were semiquantified by ImageJ.

Isolation and cultivation of CON-BMSCs and OP-BMSCs

To obtain the CON-BMSCs and OP-BMSCs, we employed the whole bone marrow culture method, culture femoral and tibial bone marrow from rats in the control and OP groups, respectively. The harvested cells were then cultured in T25 flasks at 37°C with 5% CO₂ overnight. After nonadherent cells were removed through two washes with phosphate-buffered saline (PBS), the remaining adherent cells were cultured in α-minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (PS). The cells were passaged using the enzymatic digestion method when the cell density reached 80%. All experiments, including characterization, were performed using BMSCs at passage 3 (P3).

Flow cytometric analysis

OP-BMSCs from three osteoporotic rats were selected for flow cytometric analysis. A suspension of OP-BMSCs was prepared with PBS and divided into two parts. One part was incubated with fluorescently labeled antibodies against CD29, CD90, CD44, CD31, CD45, and CD34, while the other part served as a control without fluorophore antibodies. Following a 30-min incubation in the dark, the expression levels of positive cells were determined via a fluorescence-activated cell sorter (FACSCalibur). Flow cytometric analyses were performed on three biological replicates, with each replicate corresponding to cells isolated from an individual rat. The percentage of cells expressing each marker (positive: CD29, CD90, CD44; negative: CD31, CD45, CD34) was calculated for each replicate, and the results were averaged and expressed as mean ± SD. All flow cytometric analyses were conducted on BMSCs at P3 to ensure consistency.

Cell transfection

The BMSCs were cultured until they reached 70% confluency and then transfected with ZC3H13-specific small interfering RNA (siRNA) or a negative control siRNA to generate a ZC3H13 knockdown model (CON-Si-ZC3H13) and corresponding control cells (CON-NC). This approach was used to investigate the role of ZC3H13 in the osteogenic differentiation of BMSCs. The transfection was carried out for 48 h using the riboFECT™ CP Transfection Kit (Qiagen), following the manufacturer’s protocol. The specific siRNA sequences used to target ZC3H13 were as follows: sense, 5′-CGAUUAUGUUCAUGAGUUATT-3′; antisense, 5′-UAACUCAUGAACAUAAUCGTT-3′.

To construct OP-BMSCs that overexpress ZC3H13 (OP-OE-ZC3H13) and their corresponding control cells (OP-NC), a ZC3H13 overexpression plasmid or an empty control plasmid was transfected into OP-BMSCs. The ZC3H13 gene (GENE_ID 305955; NM_001170471) was cloned into the GV712 vector to construct the overexpression plasmid, while the control plasmid contained an empty CMV enhancer-MCS-SV40-puromycin backbone. Transfection was performed using EndoFectin™ Max (Genechem), following the manufacturer’s protocol. These models were used to study the functional role of ZC3H13 in osteogenic differentiation and ferroptosis-related pathways in BMSCs.

Alkaline phosphatase and Alizarin red staining

The cells were cultured in 6-well plates until they reached 80% confluency. Subsequently, osteogenic induction medium comprising 10% FBS, 1% β-glycerophosphate, 1% PS, 1% glutamine, 0.2% ascorbic acid, and 0.01% dexamethasone (Cyagen) was added. The alkaline phosphatase (ALP) activity was assessed 3 and 5 days postosteogenic induction via a BCIP/NBT ALP kit (Shenggong, China). After 21 days of osteogenic induction, calcium nodules were visualized via Alizarin red staining (Cyagen), and ImageJ software was employed for the semiquantitative analysis of the staining results. BMSCs at P3 were used for both ALP and Alizarin red staining experiments to maintain uniformity across assays.

Quantitative reverse transcription-polymerase chain reaction

Total RNA extraction was carried out via RZ lysis buffer (Tiangen), followed by cDNA synthesis with a RevertAid kit (Thermo) following the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) analysis was performed on a Bio-Rad system (USA) via a TB Green kit (TaKaRa). GAPDH served as the endogenous control, and the fold change in gene expression between the treatment and control groups was calculated via the comparative threshold cycle method (2^−ΔΔCt). The primer sequences utilized for real-time PCR are listed in Table 1.

Table 1.

The Sequences of Primers Used for Real-Time Polymerase Chain Reaction

Gene	Primers	Sequence (5′→3′)
Gapdh	Forward	TTTGAGGGTGCAGCGAACTT
	Reverse	ACAGCAACAGGGTGGTGGAC
Zc3h13	Forward	CAGAGACCGGCTTCAAGAAC
	Reverse	GCCACTCTTTGTCTGCTTCC
Mettl3	Forward	CTCAGATCTCGCCTTAACCTTGCC
	Reverse	GACAGCTTGGAGTGGTCAGCATAG
Wtap	Forward	GCAAGAGTGCACCACTCAAA
	Reverse	CATTTTGGGCTTGTTCCAGT
Fto	Forward	TCTTACAACGCTGCCAGTTG
	Reverse	GAAACCAGAACTGCCTCAGC
Rbm15	Forward	AACGCTGGAGTTCAAGAGGA
	Reverse	ACAGCACTAGGGCTCTTCCA
Ythdf1	Forward	TTGGTGGCACAGTTGTTGAT
	Reverse	ACCATTGCCAGAAAGGACAC
Ythdf2	Forward	TGAAGGACGTTCCCAATAGC
	Reverse	TCCAGAGGCACTTCCTGAGT
Ythdf3	Forward	CCTCACCAAGTGCAGTCTCA
	Reverse	CAGCACTGGATGCACCTCTA
Ythdc1	Forward	GAAGTGGCAGTTCTGCATCA
	Reverse	CCTTTGCTTTGGCAAGAGAC
Ythdc2	Forward	GGAAAATGGTCCTGTGTGCT
	Reverse	GCATAGCTGCACGTTTTTGA
Opn	Forward	CACTCCAATCGTCCCTACA
	Reverse	CTTAGACTCACCGCTCTTCAT
Gpx4	Forward	CCGGCTACAATGTCAGGTTT
	Reverse	CTCTATCACCTGGGGCTCCT
Runx2	Forward	GAACCAAGAAGGCACAGAC
	Reverse	AATGCGCCCTAAATCACTG
Fth1	Forward	GAGCCCTTTGCAACTTCGTC
	Reverse	CCTTGGGGACGTCAGCTTAG

Western blot

Western blot analysis was carried out according to a previously described established protocol. Total protein was extracted via a protein extraction kit from Keygen Biotech. Subsequently, 20 μg of protein was separated via SDS–PAGE (10%) and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was then incubated with specific primary antibodies, including those against GAPDH (1:1000, Abcam), OPN (1:1000, Abcam), RUNX2 (1:1000, Abcam), ZC3H13 (1:1000, Invitrogen), glutathione peroxidase 4 (GPX4) (1:1000, Abmart), and ferritin heavy chain 1 (FTH1) (1:1000, Abmart). The protein–antibody complexes were detected via an Affinity ECL substrate and visualization was performed via the ECL system, and semiquantified by ImageJ.

IHC staining

Tissue slides from the femurs of both OP and control rats were processed for standard IHC staining. The slides were deparaffinized, rehydrated, and subjected to antigen retrieval via 0.01 M citrate buffer (pH 6.0) for 30 min. The slides were subsequently blocked with 5% BSA and incubated overnight at 4°C with a ZC3H13-targeting antibody (1:500, Invitrogen). After incubation, a secondary biotin-conjugated antibody was applied for 1 h at room temperature. IHC staining was visualized via a diaminobenzidine detection kit (Gene Tech, China), and the samples were counterstained with hematoxylin.

RNA sequencing

The RNA samples extracted from both the CON-NC and CON-Si-ZC3H13 groups were processed via the TRIzol method and sent to OBiO Biotechnology Company for transcriptome sequencing. After sequencing, the data were subjected to filtering, comparison, and quantification of gene expression with differentially expressed genes identified with the criteria of fold change (FC) ≥ 2 or FC ≤ 0.5 and a q-value of <0.05. Gene Ontology (GO) analysis was conducted on the differentially expressed genes.

Transmission electron microscopy

The cells of CON-BMSC, OP-BMSCs, CON-NC, CON-Si-ZC3H13, OP-NC, and OP-OE-ZC3H13 were collected via centrifugation and fixed at room temperature with 2.5% glutaraldehyde for 3 h. The samples were subsequently washed three times with 0.1 M phosphate buffer and further fixed for an additional hour with 1% osmium tetroxide. After fixation, a graded ethanol series was used for gradual dehydration, followed by two rounds of propylene oxide infiltration and ultimately embedding in EMBed 812. The samples were then sectioned into 70-nm thick slices, stained with lead citrate and 2% uranium acetate, and finally examined and photographed via transmission electron microscopy. The mitochondrial morphology, including mitochondrial cristae structure, volume, and membrane integrity, was semiquantitatively assessed from TEM images using ImageJ software. Specifically, 10 images per group were analyzed, and the average mitochondrial area and cristae density were calculated to reflect mitochondrial integrity.

Malondialdehyde assays

Protein was extracted from six groups of cells: CON-NC, CON-Si-ZC3H13, and CON-Si-ZC3H13 treated with Fer-1 (CON-Si-ZC3H13+Fer-1), OP-NC, OP-OE-ZC3H13, and OP-NC treated with Fer-1 (OP-NC+Fer-1) and 0.2 mL of a working solution (Beyotime, China). The mixture was then heated at 100°C for 15 min, followed by cooling to room temperature. After centrifugation at 1000 × g for 10 min to remove debris, 200 μL of the supernatant was used to measure the absorbance at 532 nm.

FerroOrange fluorescence assays

FerroOrange fluorescent probe was employed to assess the intracellular Fe²⁺ levels in six groups (CON-NC, CON-Si-ZC3H13, CON-CON-Si-ZC3H13+Fer-1, OP-NC, OP-OE-ZC3H13, and OP-NC+Fer-1). The cells were incubated with 5 μM FerroOrange (MKbio, China) at 37°C for 40 min, and fluorescence was detected via a G excitation filter piece under a fluorescence microscope. For flow cytometric analysis, the cells were washed with PBS, digested with pancreatin, and then resuspended in 200 μL of PBS for detection.

Cell viability assays

Cell viability was assessed via Cell Counting Kit-8 (CCK-8) assays (APExBIO, China) following the manufacturer’s instructions. First, the cells were plated at a density of 2 × 10³ cells per well in 96-well plates and then incubated at 37°C for 24, 48, 72, or 96 h. Subsequently, 100 μL of CCK-8 solution was added to the cell culture medium at each time point. After a 1-h incubation, the absorbance at 450 nm was measured via a microplate reader.

Analysis of m⁶A methylation-related modifying enzymes

To investigate the potential involvement of m⁶A methylation-related modifying enzymes in OP, we analyzed the publicly available GEO dataset GSE56815. This dataset includes gene expression profiles of women with high and low bone mineral density. Differential expression analysis was performed to compare the expression levels of m⁶A-related enzymes, including METTL3, RBM15, ZC3H13, YTHDF1-3, and others, between the two groups. Validation of these findings was conducted using quantitative reverse transcription-PCR (qRT-PCR) in OP-BMSCs and CON-BMSCs, followed by IHC staining of ZC3H13 in the femurs of OP rats.

Statistical analyses

The data are presented as mean ± SD. Statistical analyses were conducted via SPSS 19.0 software. The normality of data distribution was assessed using the Shapiro–Wilk test, and the homogeneity of variances was evaluated using Levene’s test. Only data that met the assumptions of normal distribution (p > 0.05) and homogeneity of variances (p > 0.05) were included in the analysis. Student’s t-test was used to compare data between two groups, and one-way analysis of variance (ANOVA) followed by Bonferroni post hoc correction was used for multiple comparisons. The use of one-way ANOVA was deemed appropriate as the data met the necessary assumptions for this parametric test. A value of p less than 0.05 was considered statistically significant.

For the Masson’s trichrome staining analysis, the collagen-stained area percentage was compared between groups using a two-tailed Student’s t-test. Results are presented as mean ± SD, with p < 0.05 considered statistically significant.

Results

The OP rat model was successfully established

The micro-CT results of the control group and the OVX rats revealed that the bone microstructure of the rats in the experimental group was disrupted, characterized by sparsely and discontinuously arranged trabeculae, reduced trabecular number (Tb.N) and density, and an enlarged bone cavity (Fig. 1A). Subsequent statistical analysis revealed a significant decrease in bone volume and Tb.N in the experimental group compared with those in the control group. Conversely, the trabecular separation (Tb.Sp) and structure model index (SMI) significantly increased in the experimental group (Fig. 1C). Furthermore, histological examination involving H&E and Masson staining confirmed that the femoral bone morphology of the rats in the experimental group displayed irregularities, fewer trabeculae, loss of normal trabecular structure, and altered continuity (Fig. 1B, D). Quantification of collagen deposition using ImageJ software revealed a significant reduction in the collagen-stained area in the OP group compared with the CON group (12.8 ± 3.8% vs. 25.7 ± 4.3%, p < 0.05), further supporting impaired bone microstructure.

FIG. 1.

Successful establishment of an osteoporotic rat model. (A) Micro-CT scan images of femurs from the ovariectomized and control rats after OVX surgery for 4 months. (B) H&E and Masson staining of femurs from the ovariectomized and control rats. (C) Statistical analysis of micro-CT images of the femurs of the ovariectomized and control rats. (D) Semiquantitative analysis of H&E and Masson staining by using ImageJ. Data represent the mean ± SD (n ≥ 3) (**p < 0.01, ***p < 0.001). H&E, Hematoxylin and eosin; OVX, ovariectomy; SD, standard deviation.

The osteogenic differentiation capacity was reduced in OP-BMSCs

The OP-BMSCs and CON-BMSCs displayed a characteristic long shuttle-shaped appearance and were arranged in parallel or swirling patterns when observed under a microscope (Fig. 2A). Flow cytometric analysis confirmed the mesenchymal lineage of the isolated cells. The positive surface markers CD90, CD29, and CD44 were expressed at high levels, with average expression rates of 99.61 ± 0.11%, 98.46 ± 0.01%, and 97.86 ± 0.63%, respectively. Conversely, the negative surface markers CD31, CD34, and CD45 showed low expression levels, with average expression rates of 1.50 ± 1.10%, 0.75 ± 0.33%, and 0.05 ± 0.02%, respectively, across three biological replicates (Fig. 2C). Subsequent assessment of osteogenic activity via ALP and Masson’s trichrome staining revealed a lower osteogenic potential in the OP-BMSCs than in the CON-BMSCs. Quantitative analysis of collagen deposition using ImageJ software demonstrated a significantly reduced collagen-stained area in the OP-BMSCs compared with the CON-BMSCs (46.8 ± 4.5% vs. 89.3 ± 2.9%, p < 0.01). This was further supported by reduced ALP activity in the OP-BMSCs (Fig. 2E, G). In addition, analysis of the osteogenic transcription factors OPN and RUNX2 via Western blotting and qRT–PCR revealed a significant decrease in their expression levels in OP-BMSCs (Fig. 2I, J). Therefore, these findings suggest that the OP-BMSCs exhibit impaired osteogenic differentiation compared with the CON-BMSCs.

FIG. 2.

The osteogenic differentiation of OP-BMSCs was reduced, and ZC3H13 was downregulated in OP. (A) Morphology of CON-BMSCs and OP-BMSCs under a microscope. (B) Expression of m⁶A-related modification enzymes in 40 women with high bone density and 40 women with low bone density in the GSE56815 dataset. (C) Flow cytometric analysis results of the surface markers CD29, CD90, CD44, CD31, CD45, and CD34 on OP-BMSCs. (D) mRNA and protein expression levels of ZC3H13, RUNX2, and OPN in CON-BMSCs and OP-BMSCs. (E) ALP staining results of OP-BMSCs after osteogenic induction for 3 and 5 days. Alizarin red staining results of OP-BMSCs after osteogenic induction for 21 days. (F) IHC staining results of ZC3H13 in the femurs of the CON and OP rats. (G) Semiquantitative analysis of ALP staining, Alizarin red staining, and (H) IHC staining by utilizing ImageJ. (I) Western blot results and (J) statistical analysis of mRNA and protein expression levels of ZC3H13, RUNX2, and OPN in CON-BMSCs and OP-BMSCs. Data represent the mean ± SD (n ≥ 3) (**p < 0.01, ***p < 0.001). ALP, alkaline phosphatase; BMSCs, bone marrow-derived mesenchymal stem cells; IHC, immunohistochemical; OP, osteoporotic.

ZC3H13 was downregulated in OP

Analysis of m⁶A methylation-related modifying enzymes revealed that ZC3H13, RBM15B, FTO, YTHDF1-3, and YTHDC1 were significantly upregulated in the high-BMD group, whereas the expression of METTL3 and YTHDC2 remained unchanged (Fig. 2B). Subsequent validation through qRT–PCR in the OP-BMSCs and CON-BMSCs revealed that METTL3, RBM15, ZC3H13, YTHDF2-3, and YTHDC2 were expressed at significantly lower levels in the OP-BMSCs, whereas YTHDF1, HAKAI, and FTO showed no significant changes (Fig. 2D). These findings suggest that dysregulation of m⁶A methylation enzymes, particularly ZC3H13, may be associated with the occurrence of OP. Furthermore, IHC staining provided additional evidence of ZC3H13 downregulation in the OP rats, which was supported by a decrease in the number of ZC3H13-positive stained cells and lighter staining in the femurs of the OP rats (Fig. 2F, H).

ZC3H13 promoted the osteogenic differentiation of BMSCs in OP

Knockdown of ZC3H13 in BMSCs resulted in its successful downregulation at both the protein and mRNA levels (Fig. 3A–C). This downregulation led to a significant decrease in the expression of key osteogenic markers, such as OPN and RUNX2 (Fig. 3A–C), along with reduced ALP staining intensity and fewer mineralized nodules after osteogenic induction (Fig. 3D, I).

FIG. 3.

ZC3H13 promoted the osteogenic differentiation of BMSCs in OP. (A) Western blot results, (B) statistical analysis, and (C) qRT—PCR statistical analysis results of ZC3H13, RUNX2, and OPN in the CON-BMSCs and ZC3H13-silenced CON-BMSCs (CON-Si-ZC3H13) after osteogenic induction for 3 days. (D) ALP staining results of the CON-BMSCs and CON-Si-ZC3H13 after osteogenic induction for 3 days and Alizarin red staining results after osteogenic induction for 21 days. (E) Western blot results, (F) statistical analysis, and (G) qPCR statistical analysis results of ZC3H13, RUNX2, and OPN in the OP-BMSCs and ZC3H13-overexpressing OP-BMSCs (OP-OE-ZC3H13) after osteogenic induction for 3 days. (H) ALP staining results of the OP-BMSCs and CON-Si-ZC3H13 after osteogenic induction for 3 days and Alizarin red staining results after osteogenic induction for 21 days. (I) Semiquantitative analysis of ALP staining and Alizarin red staining by utilizing ImageJ. Data represent the mean ± SD (n ≥ 3) (*p < 0.05, **p < 0.01, ***p < 0.001). qRT—PCR, quantitative reverse transcription-polymerase chain reaction.

Conversely, overexpression of ZC3H13 in OP-BMSCs resulted in its significant upregulation at both the mRNA and protein levels (Fig. 3E–G). This upregulation enhanced the expression of OPN and RUNX2 (Fig. 3E–G), as well as ALP staining intensity and mineralized nodule formation following osteogenic induction (Fig. 3H, I). Overall, these findings suggest that ZC3H13 promotes the osteogenic differentiation of BMSCs in OP.

ZC3H13 affected the proliferation and mitochondrial morphology of BMSCs

The results of transcriptomic sequencing and GO analysis on CON-NC and CON-Si-ZC3H13 groups revealed significant changes in molecular function (MF) related to metal ion binding following ZC3H13 silencing (Fig. 4A). Moreover, both osteoporotic conditions and ZC3H13 silencing led to decreased cell proliferation, whereas ZC3H13 overexpression increased the proliferative capacity of OP-BMSCs (Fig. 4B). In addition, TEM analysis revealed significant alterations in mitochondrial morphology in the BMSCs under osteoporotic conditions and ZC3H13 silencing. Quantitative measurements showed that the average mitochondrial area in OP-BMSCs was significantly smaller (0.49 ± 0.19 μm²) compared with CON-BMSCs (0.88 ± 0.12 μm², p < 0.05), while mitochondrial cristae density was significantly reduced in OP-BMSCs (33.2 ± 2.7%) compared with CON-BMSCs (64.8 ± 4.5%, p < 0.05). Silencing of ZC3H13 further exacerbated these changes, with the mitochondrial area decreasing to 0.24 ± 0.04 μm² and cristae density decreasing to 23.4 ± 2.1% (p < 0.05 compared with OP-BMSCs). In contrast, ZC3H13 overexpression partially restored mitochondrial morphology in the OP-BMSCs, increasing the mitochondrial area to 0.76 ± 0.27 μm² and increasing cristae density to 59.8 ± 3.9% (p < 0.05 compared with OP-BMSCs). These findings provide quantitative evidence of ZC3H13′s role in preserving mitochondrial integrity in OP-BMSCs (Fig. 4C). In conclusion, our findings suggest that ZC3H13 may protect against ferroptosis in the context of OP.

FIG. 4.

ZC3H13 affects the proliferation and mitochondrial morphology of OP-BMSCs. (A) GO analysis of the transcriptome sequences of CON-Si-ZC3H13 and CON-ZC3H13. (B) CCK-8 assay results of the absorbance values of CON-BMSCs and OP-BMSCs and CON-Si-ZC3H13, CON-NC, OP-NC, and OP-OE-ZC3H13 cells at 24, 48, 72, and 96 h. (C) Transmission electron microscopy images of CON-BMSCs and OP-BMSCs and CON-Si-ZC3H13, CON-NC, OP-NC, and OP-OE-ZC3H13 cells (**p < 0.01, ***p < 0.001).

Fer-1 reversed OP in OP rats

The micro-CT results of the OP and OP+Fer-1 group indicated that Fer-1 treatment reversed bone loss in the distal femur metaphysis of the OP rats (Fig. 5A). Furthermore, the treatment resulted in a significant increase in bone volume and the number of trabeculae and a significant decrease in Tb.Sp and SMI (Fig. 5C). Histological analyses via H&E and Masson’s trichrome staining further confirmed the positive effects of Fer-1, which resulted in a reduction in the size of the bone marrow cavity, an increase in the number of trabeculae, and the restoration of the trabecular morphology (Fig. 5B, D).

FIG. 5.

Fer-1 reversed OP in the OP rats. (A) Micro-CT and (C) statistical analysis results of femurs from the OP rats and OP rats injected intraperitoneally with Fer-1 (OP+Fer-1). (B) H&E and Masson staining results of femurs from the OP and OP+ Fer-1 rats. (D) Semiquantitative analysis of H&E and Masson staining by utilizing ImageJ. Data represent the mean ± SD (n ≥ 3) (*p < 0.05, **p < 0.01). Fer-1, Ferrostatin-1.

ZC3H13 regulated the osteogenic differentiation of BMSCs by inhibiting ferroptosis

The FerroOrange live cell imaging results from the cells of three groups (CON-NC, CON-Si-ZC3H13, and CON-Si-ZC3H13+Fer-1) indicated that ZC3H13 knockdown increased the fluorescence intensity in the CON-BMSCs, and this effect was reversed with Fer-1 treatment (Fig. 6A). These findings were further supported by flow cytometry (Fig. 6B) and MDA (Fig. 6C) measurements, indicating that Fer-1 treatment reversed the increase in ferroptosis in the CON-BMSCs caused by ZC3H13 knockdown. Moreover, a CCK-8 assay revealed that ZC3H13 knockdown suppressed the proliferation of the CON-BMSCs, but Fer-1 treatment increased the proliferation of the CON-Si-ZC3H13 cells (Supplementary Fig. S1C). ALP staining revealed that ZC3H13 knockdown decreased ALP activity in the CON-BMSCs, which was restored by Fer-1 treatment (Supplementary Fig. S1A). Alizarin red staining further demonstrated that ZC3H13 knockdown reduced calcium nodule formation, but this effect was significantly increased after Fer-1 treatment (Fig. 6D, E). In addition, ZC3H13 knockdown resulted in decreased expression of the osteogenic factors OPN and RUNX2, as well as the antioxidant enzymes GPX4 and FTH1. However, Fer-1 treatment partially restored the protein and mRNA expression levels of OPN, RUNX2, and GPX4, whereas FTH1 expression remained unchanged (Fig. 6F–H, Supplementary Fig. S2A–C).

FIG. 6.

ZC3H13 promoted the osteogenic differentiation of BMSCs by inhibiting ferroptosis. (A) FerroOrange staining, (B) flow cytometric analysis, and (C) MDA staining analysis of the BMSCs transfected with empty siRNA (CON-NC), siZC3H13 (CON-Si-ZC3H13), or siZC3H13 and treated with Fer-1 (CON-Si-ZC3H13+Fer-1). (D) ALP staining results of the three groups (CON-NC, CON-Si-ZC3H13, and CON-Si-ZC3H13+Fer-1) of cells after 5 days of osteogenic induction and Alizarin red staining results after 21 days of osteogenic induction. (E) Semiquantitative analysis of ALP staining and Alizarin red staining by utilizing ImageJ. (F) Western blot analysis and (G) statistical analysis, as well as (H) statistical analysis of the qRT—PCR results of the expression levels of the osteogenic transcription factors RUNX2 and OPN and the ferroptosis-related factors GPX4 and FTH1 in the three groups (CON-NC, CON-Si-ZC3H13, and CON-Si-ZC3H13+Fer-1) of cells after 3 days of osteogenic induction. Data represent the mean ± SD (n ≥ 3) (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, compared with the CON-NC group; ^&p < 0.05, ^&&p < 0.01, compared with the CON-Si-ZC3H13 group). MDA, malondialdehyde.

Fer-1, as a therapeutic treatment for OP, had similar effects as ZC3H13 overexpression

The FerroOrange live cell imaging results from the cells of three groups (OP-NC, OP-OE-ZC3H13, and OP-NC+Fer-1) revealed a reduction in the fluorescence intensity of OP-BMSCs after ZC3H13 overexpression and Fer-1 treatment (Fig. 7A), as observed via flow cytometry (Fig. 7B) and MDA (Fig. 7C) experiments. Furthermore, both ZC3H13 overexpression and Fer-1 treatment increased cell proliferation (Supplementary Fig. S1D), ALP activity (Supplementary Fig. S1A), and calcium structure formation during osteogenic induction (Fig. 7D, E). Fer-1 treatment also upregulated the expression of OPN and RUNX2 in OP-BMSCs after 3 and 5 days of osteogenic induction, as confirmed by qRT–PCR and Western blot analysis. In addition, after 5 days of osteogenic induction, Fer-1 treatment significantly increased GPX4 expression in the OP-NC group of BMSCs, whereas FTH1 expression remained unchanged (Fig. 7F–H, Supplementary Fig. S2D–F).

FIG. 7.

Fer-1, as a therapeutic treatment for OP, had similar effects as ZC3H13 overexpression. (A) FerroOrange staining, (B) flow cytometric analysis, and (C) MDA staining analysis of the OP-BMSCs transfected with empty siRNA (OP-NC), overexpressing ZC3H13 (OP-OE-ZC3H13), and treated with Fer-1 (OP-NC+Fer-1). (D) ALP staining results of the three groups (OP-NC, OP-OE-ZC3H13, and OP-NC+Fer-1) of cells after 5 days of osteogenic induction and Alizarin red staining results after 21 days of osteogenic induction. (E) Semiquantitative analysis of ALP staining and Alizarin red staining by utilizing ImageJ. (F) Western blot analysis and (G) statistical analysis, as well as (H) statistical analysis of the qRT—PCR results of the expression levels of the osteogenic transcription factors RUNX2 and OPN and the ferroptosis-related factors GPX4 and FTH1 in the three groups (OP-NC, OP-OE-ZC3H13, and OP-NC+Fer-1) of cells after 3 days of osteogenic induction. Data represent the mean ± SD (n ≥ 3) (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, compared with the OP-NC group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, compared with the OP-OE-ZC3H13 group).

Discussion

This study demonstrated that ZC3H13 plays a pivotal role in maintaining bone homeostasis by regulating ferroptosis and promoting osteogenic differentiation in OP-BMSCs. We observed that ZC3H13 expression was significantly downregulated in both osteoporotic rats and BMSCs, and its knockdown led to impaired osteogenic differentiation. Conversely, ZC3H13 overexpression enhanced osteogenic capacity, as evidenced by increased expression of key osteogenic markers (e.g., OPN and RUNX2) and improved mitochondrial morphology. These findings establish ZC3H13 as a crucial regulator of osteogenic differentiation and suggest that its dysregulation contributes to the pathogenesis of osteoporosis.

In the context of m⁶A modification, previous studies have demonstrated that ZC3H13 acts as an essential methyltransferase regulating stem cell self-renewal.^22,23 Dysregulated m⁶A modification has been implicated in impaired osteogenic differentiation and osteoporosis development.²⁴ Our findings expand upon this by revealing a novel role of ZC3H13 in ferroptosis regulation, suggesting that m⁶A-dependent mechanisms may underlie its effects on osteogenesis. Future research should explore the specific contribution of m⁶A modification to ZC3H13′s regulatory functions in BMSCs.

Ferroptosis is a form of regulated cell death that differs from apoptosis, necrosis, and autophagy.^25,26 It is characterized by the conversion of lipid peroxides into lipid radicals mediated by Fe²⁺, leading to mitochondrial shrinkage, increased membrane density, disrupted outer membrane integrity, disappearance of mitochondrial cristae, and eventual cell death.^27,28 Our study revealed that ZC3H13 modulates ferroptosis in BMSCs by regulating the expression of key antioxidant enzymes, such as GPX4,^29–31 and iron storage proteins, such as FTH1.³² ZC3H13 silencing led to reduced GPX4 and FTH1 expression, increased intracellular Fe²⁺ levels, and impaired mitochondrial morphology, ultimately decreasing osteogenic differentiation.³³ Conversely, ZC3H13 overexpression restored these parameters and enhanced osteogenic potential.

Our findings align with recent studies highlighting the role of ferroptosis in bone metabolism. For instance, Balogh et al. demonstrated that intracellular iron accumulation disrupts osteoblast activity, extracellular matrix mineralization, and osteoblast differentiation, leading to bone resorption.³⁴ In addition, Xie et al. found that Fer-1 inhibited ferroptosis and improved BMSC survival.³⁵ Furthermore, Long et al. reported that suppressing ferroptosis via increased GPX4 expression enhances osteoblast differentiation in diabetic osteoporosis.³⁶ In comparison, our study identifies ZC3H13 as a novel upstream regulator of ferroptosis, providing new insights into the interplay between ferroptosis, iron metabolism, and osteogenic differentiation.

This study demonstrates that ZC3H13 influences the osteogenic capacity of OP-BMSCs by regulating ferroptosis. However, the specific downstream target genes regulated by ZC3H13 remain unclear, and it is uncertain whether ZC3H13 regulates the osteogenic ability of OP-BMSCs dependent on m⁶A modification. Therefore, our future research will focus on elucidating how ZC3H13 regulates ferroptosis to promote osteogenesis of OP-BMSCs.

Limitations

While this study provides important insights into the role of ZC3H13 in regulating ferroptosis and osteogenic differentiation in BMSCs, several limitations should be acknowledged: (1)

Unclear downstream targets of ZC3H13: Although our results demonstrated that ZC3H13 regulates the expression of GPX4 and FTH1, the specific downstream target genes of ZC3H13 remain unknown. Further transcriptomic or proteomic studies are needed to identify these targets and explore their involvement in m⁶A modification or other pathways related to ferroptosis and osteogenesis.

(2)

Relationship between ZC3H13 and m⁶A modification: It remains uncertain whether ZC3H13 regulates the osteogenic ability of OP-BMSCs in a manner dependent on m⁶A modification. Our findings suggest a role for ZC3H13 in ferroptosis regulation and osteogenesis; however, additional studies are required to determine whether these effects are directly mediated by m⁶A-related mechanisms or independent pathways.

(3)

Lack of in vivo validation: While our study provides strong in vitro evidence for the regulatory role of ZC3H13, the lack of in vivo experiments to validate its effects on osteogenesis and ferroptosis in animal models is a limitation. Future research should incorporate in vivo approaches to strengthen the translational relevance of these findings.

Addressing these limitations in future research will provide a more comprehensive understanding of ZC3H13′s regulatory mechanisms and its potential therapeutic implications for osteoporosis.

Conclusion

In summary, our findings suggest that ZC3H13 plays a positive regulatory role in the osteogenic differentiation of OP-BMSCs by inhibiting ferroptosis. Further research has elucidated the underlying mechanisms and potential therapeutic implications of ZC3H13 and ferroptosis. Overall, these results provide valuable insights into the molecular mechanisms involved in the development of OP and have potential implications for the development of novel therapeutic strategies for the treatment of this disease.

Footnotes

Data Availability Statement

All experimental data, including Western blot data, microscope images, primer sequences, and antibody information, can be obtained by contacting the first author or corresponding author.

Ethics Approval and Consent to Participate

The animal experiments performed were approved by the Laboratory Animal Center of Southwest Medical University (20220819-017).

Authors’ Contributions

Q.Z. performed most experiments and wrote the article; C.Z. and T.F. conducted culture of cells, and collection and analysis of experimental data. Y.L. fed the rat and performed part experiments. X.L. performed data analysis and article revision. J.X. and L.L. conceived, designed, and supervised the study. All coauthors have reviewed and approved this version of the article.

Disclosure Statement

The authors declare that there are no competing interests associated with the article.

Funding Information

This study was supported by the National Natural Science Foundation of China (81870746), the Special Project for Local Science and Technology Development Guided by the Central Government of Sichuan Province (2022ZYD0082), the Project of Science & Technology Department of Sichuan Province (2022NSFSC0599), the Youth Science Climbing Program of The Affiliated Stomatology Hospital of Southwest Medical University (2020QY03), and the Sichuan Science and Technology Program (2022YFS0634).

Supplementary Material

References

, Xiao

, Quarles

, et al. Osteoporosis: Mechanism, molecular target and current status on drug development. Curr Med Chem, 2021; 28(8):1489–1507.

Lane

. Epidemiology, etiology, and diagnosis of osteoporosis. Am J Obstet Gynecol, 2006; 194(2 Suppl):S3–S11.

, Winzenberg

, Jiang

, et al. Projection of osteoporosis-related fractures and costs in China: 2010–2050. Osteoporos Int, 2015; 26(7):1929–1937.

Bleibler

, Konnopka

, Benzinger

, et al. The health burden and costs of incident fractures attributable to osteoporosis from 2010 to 2050 in Germany–a demographic simulation model. Osteoporos Int, 2013; 24(3):835–847.

Khosla

, Hofbauer

. Osteoporosis treatment: Recent developments and ongoing challenges. Lancet Diabetes Endocrinol, 2017; 5(11):898–907.

Zhang

, Zhang

, Zhu

, et al. Nanoparticles functionalized with stem cell secretome and CXCR4-overexpressing endothelial membrane for targeted osteoporosis therapy. J Nanobiotechnology, 2022; 20(1):35.

, Tang

, Yang

, et al. METTL3-m6 A methylase regulates the osteogenic potential of bone marrow mesenchymal stem cells in osteoporotic rats via the Wnt signalling pathway. Cell Prolif, 2022; 55(5):e13234.

Zhang

, Dai

, Teng

, et al. Visualization and quantification of single-base m6A methylation. Angew Chem Int Ed Engl, 2025; 64(6):e202420977.

, He

. m(6) A RNA methylation: From mechanisms to therapeutic potential. Embo j, 2021; 40(3):e105977.

10.

Lan

, Liu

, Haase

, et al. The critical role of RNA m(6)A Methylation in Cancer. Cancer Res, 2019; 79(7):1285–1292.

11.

, Zhang

. The roles of RNA N6-Methyladenosine in regulating stem cell fate. Front Cell Dev Biol, 2021; 9:765635.

12.

Chen

, Hua

, Huang

, et al. Regulatory role of RNA N(6)-Methyladenosine modification in bone biology and osteoporosis. Front Endocrinol (Lausanne), 2019; 10:911.

13.

Roundtree

, Evans

, Pan

, et al. Dynamic RNA modifications in gene expression regulation. Cell, 2017; 169(7):1187–1200.

14.

Frye

, Harada

, Behm

, et al. RNA modifications modulate gene expression during development. Science, 2018; 361(6409):1346–1349.

15.

Oerum

, Meynier

, Catala

, et al. A comprehensive review of m6A/m6Am RNA methyltransferase structures. Nucleic Acids Res, 2021; 49(13):7239–7255.

16.

Wen

, Lv

, Ma

, et al. Zc3h13 regulates nuclear RNA m(6)A methylation and mouse embryonic stem cell self-renewal. Mol Cell, 2018; 69(6):1028–1038.e6.

17.

Knuckles

, Lence

, Haussmann

, et al. Zc3h13/Flacc is required for adenosine methylation by bridging the mRNA-binding factor Rbm15/Spenito to the m(6)A machinery component Wtap/Fl(2)d. Genes Dev, 2018; 32(5–6):415–429.

18.

, Gui

, Ma

, et al. N6-methyladenosine writer METTL16-mediated alternative splicing and translation control are essential for murine spermatogenesis. Genome Biol, 2024; 25(1):193.

19.

Huang

, Wang

. Downregulation of METTL14 improves postmenopausal osteoporosis via IGF2BP1 dependent posttranscriptional silencing of SMAD1. Cell Death Dis, 2022; 13(11):919.

20.

Wang

, Chen

, Xiao

, et al. METTL3-mediated m6A modification increases Hspa1a stability to inhibit osteoblast aging. Cell Death Discov, 2024; 10(1):155.

21.

Yang

, Sun

, Wang

, et al. Exosome-targeted delivery of METTL14 regulates NFATc1 m6A methylation levels to correct osteoclast-induced bone resorption. Cell Death Dis, 2023; 14(11):738.

22.

Huang

, Xu

, Liu

, et al. m6A methylation regulates osteoblastic differentiation and bone remodeling. Front Cell Dev Biol, 2021; 9:783322.

23.

Cai

, Ji

, Han

, et al. METTL3-Dependent glycolysis regulates dental pulp stem cell differentiation. J Dent Res, 2022; 101(5):580–589.

24.

, Meng

, Zhao

. The roles of N6-methyladenosine methylation in the regulation of bone development, bone remodeling and osteoporosis. Pharmacol Ther, 2022; 238:108174.

25.

Dixon

, Lemberg

, Lamprecht

, et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell, 2012; 149(5):1060–1072.

26.

Galluzzi

, Vitale

, Aaronson

, et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ, 2018; 25(3):486–541.

27.

Lei

, Mao

, Yan

, et al. Ferroptosis, radiotherapy, and combination therapeutic strategies. Protein Cell, 2021; 12(11):836–857.

28.

Liu

, Zhou

, Xie

, et al. Forthrightly monitoring ferroptosis induced by endoplasmic reticulum stresses through fluorescence lifetime imaging of microviscosity increases with a specific rotor. Chinese Chemical Letters, 2022; 33(5):2537–2540.

29.

, Liu

, Shan

, et al. ATM orchestrates ferritinophagy and ferroptosis by phosphorylating NCOA4. Autophagy, 2023; 19(7):2062–2077.

30.

Cheng

, He

, Liu

, et al. SGK2 promotes prostate cancer metastasis by inhibiting ferroptosis via upregulating GPX4. Cell Death Dis, 2023; 14(1):74.

31.

, Xing

, Shen

, et al. A GSH-depleted platinum (IV) prodrug triggers ferroptotic cell death in breast cancer. Chinese Chemical Letters, 2022; 33(10):4595–4599.

32.

Rochette

, Dogon

, Rigal

, et al. Lipid peroxidation and iron metabolism: Two corner stones in the homeostasis control of ferroptosis. Int J Mol Sci, 2022; 24(1).

33.

, Wei

, Sun

, et al. Melatonin inhibits ferroptosis and delays age-related cataract by regulating SIRT6/p-Nrf2/GPX4 and SIRT6/NCOA4/FTH1 pathways. Biomed Pharmacother, 2023; 157:114048.

34.

Balogh

, Paragh

, Jeney

. Influence of iron on bone homeostasis. Pharmaceuticals (Basel), 2018; 11(4):107.

35.

Xie

, Sun

, Xu

, et al. Ferrostatin-1 improves BMSC survival by inhibiting ferroptosis. Arch Biochem Biophys, 2023; 736:109535.

36.

Long

, Li

, et al. Identification of osteoporosis ferroptosis-related markers and potential therapeutic compounds based on bioinformatics methods and molecular docking technology. BMC Med Genomics, 2024; 17(1):99.

ZC3H13 Regulates Ferroptosis to Enhance Osteogenic Differentiation in Osteoporotic BMSCs

Abstract

Objectives:

Materials and Methods:

Results:

Conclusions:

Impact Statement

Introduction

Materials and Methods

Establishment of an osteoporotic rat model and conducting of animal experiments

Isolation and cultivation of CON-BMSCs and OP-BMSCs

Flow cytometric analysis

Cell transfection

Alkaline phosphatase and Alizarin red staining

Quantitative reverse transcription-polymerase chain reaction

Western blot

IHC staining

RNA sequencing

Transmission electron microscopy

Malondialdehyde assays

FerroOrange fluorescence assays

Cell viability assays

Analysis of m6A methylation-related modifying enzymes

Statistical analyses

Results

The OP rat model was successfully established

The osteogenic differentiation capacity was reduced in OP-BMSCs

ZC3H13 was downregulated in OP

ZC3H13 promoted the osteogenic differentiation of BMSCs in OP

ZC3H13 affected the proliferation and mitochondrial morphology of BMSCs

Fer-1 reversed OP in OP rats

ZC3H13 regulated the osteogenic differentiation of BMSCs by inhibiting ferroptosis

Fer-1, as a therapeutic treatment for OP, had similar effects as ZC3H13 overexpression

Discussion

Limitations

Conclusion

Footnotes

Data Availability Statement

Ethics Approval and Consent to Participate

Authors’ Contributions

Disclosure Statement

Funding Information

Supplementary Material

References

Analysis of m⁶A methylation-related modifying enzymes