Establishment of Novel Detection System for Embryonic Stem Cell-Derived Hepatocyte-Like Cells Based on Nongenetic Manipulation with Indocyanine Green

Abstract

Hepatocytes derived from embryonic stem cells (ESCs) are expected to be useful for basic research and clinical applications. However, in several studies, genetic methods used to detect and obtain them are difficult and pose major safety problems. Therefore, in this study, we established a novel detection system for hepatocytes by using indocyanine green (ICG), which is selectively taken up by hepatocytes, based on nongenetic manipulation. ICG has maximum light absorption near 780 nm, and it fluoresces between 800 and 900 nm. Making use of these properties, we developed flow cytometry equipped with an excitation lazer of 785 nm and specific bandpass filters and successfully detected ESC-derived ICG-positive cells that were periodic acid-Schiff positive and expressed hepatocyte phenotypic mRNAs. These results demonstrate that this detection system based on nongenetic manipulation with ICG will lead to isolate hepatocytes generated from ESCs and provide the appropriate levels of stability, quality, and safety required for cell source for cell-based therapy and pharmaceutical studies such as toxicology.

Introduction

Worldwide, there are millions of patients suffering from fatal liver disease. Further, the shortage of organ donors is a problem, with ∼15% of adult patients with life-threatening liver diseases dying while on the waiting list.¹ Therefore, cell therapies using primary hepatocytes and pluripotent stem cells for the treatment of end-stage hepatic diseases are currently under investigation internationally.² In particular, embryonic stem cells (ESCs) are expected to be a promising alternative resource for cell therapy, because they have the ability of self-renewal and pluripotency.^3,4 They can give rise to cells of all three germ layers and many different cell types under appropriate conditions. Thus, to develop cell-based therapies, hepatocytes generated from ESCs are attractive as a routine source for large numbers of cells. However, a large number of in vitro protocols for generating hepatocytes from ESCs are not efficient and result in the formation of many different cell types.^5–8 Thus, several studies have used ESC lines transfected with the green fluorescent protein reporter gene controlled by hepatocyte-specific promoters to select and/or detect ESC-derived hepatocytes.^9,10 However, this technique is relatively time consuming and leads to significant cell injury. Further, genetic modification carries risks such as possible tumor formation.^11–13 Hence, a safe method is required for detecting and/or selecting ESC-derived hepatocytes without genetic modification.

One of the major metabolic functions of the liver is the elimination of various endogenous and exogenous compounds such as bile acids, organic anions, and organic cations.^14,15 Indocyanine green (ICG) is a nontoxic organic anion that is exclusively eliminated by hepatocytes and is clinically used as a test substance to evaluate liver function.¹⁶ In a large number of reports, the uptake and release of ICG is frequently used to identify ESC-derived hepatocytes.^17–19 Moreover, ICG is not only selectively taken into hepatocytes, but it also has a wide optical absorption band, extending from 600 nm to above 800 nm. The maximum absorption is near 780 nm and has been used for the fluorescence diagnosis in ophthalmology for dye-enhanced photocoagulation. The fluorescence of ICG can be observed at 800–900 nm with appropriate excitation.²⁰ Therefore, making use of these properties, we developed a flow cytometer equipped with an excitation lazer of 785 nm with specific bandpass filters and attempted to detect ICG-positive cells.

We show here that rat primary hepatocytes and ESC-derived hepatocyte-like cells selectively took up ICG and could be detected by flow cytometry. Our approach will lead to the development of an effective system for purifying ESC-derived hepatocytes without genetic modification.

Materials and Methods

Isolation and culture of rat primary hepatocytes

All experimental procedures and protocols were approved by the animal care and use committees of Shinshu University. Primary hepatocytes were isolated from 8 week-old Wistar rats (Japan SLC, Inc.) by the collagenase perfusion method. Hepatocytes were separated from the resulting cell suspension by centrifugation. The isolated hepatocytes were plated onto gelatin-coated dishes (12-wells) at a density of 1×10⁵ cells/well and cultured in Lanford medium (Nissui Pharmaceutical Co.).

Cultured cell lines

AR42J cells of a rat pancreatic adenocarcinoma cell line, MCF7 cells of a human breast adenocarcinoma cell line, HEK 293T cells of a human embryonic kidney cell line, and HepG2 cells of a human hepatocellular carcinoma cell line were obtained from RIKEN Bioresource Center and cultured in Dulbecco's modified Eagle's medium (DMEM; GIBCO), containing 10% fetal bovine serum and 100 μM nonessential amino acids (GIBCO).

ESC culture and induction for hepatocyte-like cells

Mouse ESC line R1, a kind gift of Dr. Andras Nagy, was used throughout this study. Frozen stock was thawed and seeded on SNL feeder cells, a kind gift of Dr. Yoh-ichi Tagawa. ESCs were cultured in DMEM containing 15% knockout serum replacement (GIBCO), 100 μM nonessential amino acids, 1 mM sodium pyruvate (GIBCO), 100 μM 2-mercaptoethanol (Sigma-Aldrich Corp.), 10³ units/mL of leukemia inhibitory factor (Chemicon), and antibiotics. Induction of hepatocyte-like cells was performed as previously described.⁸

ICG staining of cultured cells and detection of ICG-positive cells by FISHMAN-R flow cytometry

A sterile stock solution of ICG (Daiichi-sankyou Pharmaceutical Co., Ltd) at 5 mg/mL was freshly diluted in culture medium. Primary hepatocytes, SNL, HepG2, and ESC-derived cells were incubated at 5% CO₂ and 37°C in diluted ICG at specific concentrations and times. After washing, they were dispersed by using 0.1% collagenase and 0.1% trypsin. Single cells were separated from the nondigested cell clusters by using a 40 μm cell strainer (BD Biosciences). The viability of each cell population by trypan blue exclusion was typically >90%. All cells were resuspended in phosphate buffered saline and then analyzed by a FISHMAN-R flow cytometer (On-chip Biotechnologies Co., Ltd) with an excitation lazer of 785 nm and 815–850 nm bandpass filters to detect ICG-positive cells.

Isolation and culture of ESC-derived ICG positive-cells

ESC-derived cells at day 22 were dispersed by 0.1% trypsin, and a 40-μm cell strainer was used to separate single cells from the nondigested cell clusters. The harvested cells were re-plated and cultured on Type I collagen-coated dishes (BD Biosciences) with Lanford medium for 5 days. Then, they were incubated in 1 mg/mL ICG for 30 min at 37°C. After washing, ICG-positive and ICG-negative cells were picked up under light microscopy and cultured on a Type I collagen-coated dish, which has been extensively used for the proliferation and culture of mature and immature hepatocytes,^21,22 with Lanford medium for 5 days.

Periodic acid-Schiff assay for glycogen

ESC-derived cells were incubated in 1 mg/mL ICG for 30 min at 37°C. After washing, cellular uptake of ICG was recorded by light microscopy. Then, the cells were returned to culture medium and incubated for 6 h, whereon the release of the ICG stain¹⁸ was documented by light microscopy. The cells were then fixed in 10% formalin in methanol for 30 min, and subjected to periodic acid-Schiff (PAS) staining (Polysciences) according to the manufacturer's instructions.

Reverse transcription–polymerase chain reaction

Total RNA was extracted by using Trizol reagent (Invitrogen) according to the manufacturer's protocol. First-strand cDNA was synthesized from 1 μg total RNA by using Primescript reverse transcriptase (TaKaRa Bio Inc.). cDNA samples were subjected to polymerase chain reaction (PCR) amplification with a thermal cycler (MyCycler; Bio-Rad). The PCR cycling conditions were as follows: cycle of 94°C for 4 min; 30 cycles of 94°C for 30 s, annealing at the temperatures specified for each of the primer sets for 30 s, 72°C for 30 s; and 1 cycle of 72°C for 7 min. The primer sets and the predicted size of the PCR product are shown in Table 1.

Table 1.

Primer Sets Used for Polymerase Chain Reaction Amplification of cDNA

Gene	Sense primer	Antisense primer	Product size	Annealing
AFP	TCGTATTCCAACAGGAGG	AGGCTTTTGCTTCACCAG	174	65
TTR	AGTCCTGGATGCTGTCCGAG	TTCCTGAGCTGCTAACACGG	441	65
Hex	AGTGGCTTCGGAGGCCCTCTGTA	TGACTGTGATCCAGCATTAA	539	70
AAT	AATGGAAGAAGCCATTCGAT	AAGACTGTAACTGCTGCAGC	484	65
ALB	GATGAAACATATGTGTCCCCAAAGA	TGTGTTCCTTAGGGTGTTGATTTT	381	65
LST1	AAGTGGTCTGTAACCAGCTG	GAAGGTACACAAGAGTATCC	250	60
G6P	CAGGACTGGTTCATCCTT	GTTGCTGTAGTAGTCGGT	210	58
Cyp7a1	ACACCATTCCTGCAACCTTC	GCTGTCCGGATATTCAAGGA	236	60
β-actin	TTCCTTCTTGGGTATGGAAT	GAGCAATGATCTTGATCTTC	200	53

Quantitative real-time RT-PCR

Real-time PCR analysis was performed by using the Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Cycling was performed for 10 min at 95°C, followed by 40 cycles of 5 s at 95°C and 30 s at 60°C, which were the default conditions of the Thermal Cycler Dice Real-Time System software (TP 800 ver. 3.0). The threshold cycle method was used to analyze the data, with gene expression levels calibrated to those of the housekeeping gene β-actin. The primer sets were as shown in Table 2.

Table 2.

Primer Sets Used for Quantitative Polymerase Chain Reaction

Gene	Sense primer	Antisense primer
AFP	TCGTATTCCAACAGGAGG	AGGCTTTTGCTTCACCAG
ALB	GACTTTGCACAGTTCCTGGATACA	TTGTGGTTGTGATGTGTTTAGGCTA
Nanog	AAGTACCTCAGCCTCCAGCA	GTGCTGAGCCCTTCTGAATC
Ugt1a1	TCTGAGCCCTGCATCTATCTG	CCCCAGAGGCGTTGACATA
Sult2a1	GGAAGGACCACGACTCATAAC	GATTCTTCACAAGGTTTGTGTTACC
Slcola4	GACGGCTCAGTGTTCATTC	CTTCTAGCTGGTCCCTCTT
Cyp1a1	ATAAGGTCATCACGATTGTTTTGG	GGTACATGAGGCTCCACGAGAT
Cyp2a10	CAGGTGATCGGCTCACACC	TGACTGCATCTGAGTATGGCATT
Cyp2b10	GCCCAATGTTTAGTGGAGGA	GACTTCTCCTTCTCCATGCG
β-actin	CATCCGTAAAGACCTCTATGCCAAC	ATGGAGCCACCGATCCACA

Results

Detection of ICG-positive cells by flow cytometry

For positive controls, primary adult hepatocytes were stained with ICG at 1 mg/mL. Although they took up some ICG (Fig. 1A), analysis by flow cytometry indicated that only 8% of the cells were ICG positive (Fig. 1Ba, b). The absorption wavelength of ICG changes depended on the concentration of ICG.²³ We assumed that primary hepatocytes took up so much ICG that they could not be easily detected by FISHMAN-R flow cytometry, because the absorption wavelength was changed by the high concentration. Therefore, we assessed ICG uptake at incubation concentrations between 50 ng/mL and 1 mg/mL for 30 min. ICG-positive cells were somewhat detectable at 20 μg/mL (Fig. 1Bc, d) and readily detected, about 90% of the cells, at 5 μg/mL (Fig. 1Be, f). At 50 ng/mL ICG, they were not detectable (Fig. 1Bg, h). These results showed that an appropriate concentration of ICG, one that does not change the absorption wavelength, is required for detecting ICG-positive cells.

FIG. 1.

Detection of ICG-positive cells. (A) Rat primary hepatocytes, serving as positive controls, were examined for ICG uptake at high concentration (1 mg/mL). Scale bars=60 μm. (B) The primary hepatocytes were analyzed by flow cytometry at various concentrations of ICG (a and b, 1 mg/mL; c and d, 20 μg/mL; e and f, 5 μg/mL; g and h; 50 ng/mL). Histograms, left panel; raw scatter plot, right panel; blue, negative control without ICG staining; red, ICG staining; FL4, 815–850 nm; FS, forward scatter; ICG, indocyanine green.

Time-dependent, nonspecific ICG staining of nonhepatocytes

We next examined the optimal time of ICG staining. We stained the nonhepatocytes such as SNL feeder cells, AR42J cells, MCF7 cells, and HEK 293T cells. After 30 min, there was almost no detectable staining with 5 μg/mL ICG (Fig. 2Aa, Ba, Ca, Da). Between 2 and 24 h, there was a detectable presence of ICG in the SNLs, AR42Js, MCF7s, and HEK 293Ts (Fig. 2Ab–d, Bb–d, Cb–d, Db-d). However, the levels were 10-fold lower than for primary hepatocytes (Fig. 1B). Thus, nonhepatocytes nonspecifically took up ICG when incubated for a sufficiently long time.

FIG. 2.

Time-dependent nonspecific uptake of ICG by nonhepatocytes. (A) SNL feeder cells, (B) AR42J cells, (C) MCF7 cells, and (D) HEK 293T cells were incubated with 5 μg/mL ICG for 30 min to 24 h. No ICG uptake was detectable at 30 min (a). However, uptake increased from 2 to 24 h (b–d). blue, negative control without ICG staining; red, ICG staining.

Detection and characterization of ESC-derived ICG-positive cells

We then determined whether ESC-derived ICG-positive cells could be detected by using the FISHMAN-R flow cytometer. ESC-derived hepatocyte-like cells⁸ were incubated in 5 μg/mL ICG for 30 min, which was the optimal time and concentration for staining of the primary hepatocytes. Based on FISHMAN-R flow cytometry, ESC-derived ICG-positive cells increased in a time-dependent manner (Fig. 3Aa–d). In particular, about 10% of the ESC-derived cells at day 22 were ICG-positive cells (Fig. 3Ad). Likewise, the expression of hepatocyte marker alpha-fetoprotein (AFP) and albumin (ALB) increased over time (Fig. 3Ba, b), and the expression of undifferentiated ESC-marker Nanog gradually decreased (Fig. 3Bc). Further, about 40% of human hepatocellular carcinoma HepG2 cells, which have some characteristics of hepatocytes, were also stained by ICG (Fig. 3C). HepG2 cells consisted of a relatively homogeneous population. It is possible that the phenotype and characteristics of these cells changed during the repeated passages. Taken together, these findings showed that we could detect ESC-derived ICG-positive cells by FISHMAN-R flow cytometry under appropriate conditions of ICG staining.

FIG. 3.

Detection of ESC-derived and HepG2 ICG-positive cells under optimal conditions. (A) ESC-derived cells at various stages (a, day 0; b, day 7; c, day 15; d, day 22) were examined by flow cytometry for ICG uptake (5 μg/mL, 30 min). ESC-derived ICG-positive cells increased over time. blue, negative control without ICG staining; red, ICG staining. (B) Transcripts of AFP (a), ALB (b), and Nanog (c) were quantified by real-time PCR. Relative expression levels of each gene to β-actin were compared with those in day 0. (C) HepG2 cells were examined by flow cytometry for ICG uptake (5 μg/mL, 30 min). About 40% of the cells were positive. blue, negative control without ICG staining; red, ICG staining; ESC, embryonic stem cell; PCR, polymerase chain reaction; AFP, alpha-fetoprotein; ALB, albumin.

The FISHMAN-R flow cytometer was not equipped with a cell sorting system to purify ICG-positive cells. Therefore, we could not determine whether the ESC-derived ICG-positive cells had the characteristics of hepatocyte-like cells. Hence, we examined them by ICG staining at a high concentration (1 mg/mL) for 30 min, after which we could visualize incorporation of ICG into the cells. The cells were then stained with PAS. A large number of the ESC-derived cells took up ICG (Fig. 4Aa) and then released it during the 6 h postuptake incubation (Fig. 4Ab). Further, the cells that took up and released ICG also stored glycogen as shown by PAS staining (Fig. 4Ac), which is a characteristic of hepatocyte-like cells.

FIG. 4.

Characterization of ESC-derived ICG-positive cells. (A) ESC-derived cells at day 22 were examined for uptake of 1 mg/mL ICG (a), release after 6 h of post-ICG incubation (b), and for periodic acid-Schiff assay (c). Scale bars=60 μm. (B) Real-time PCR analysis of hepatic markers in ICG-negative cell clusters (a), ICG-positive cell clusters (b), and primary hepatocytes (c). ESC-derived cells that did not take up ICG expressed only very weak or no mRNA expression of hepatocyte phenotypic genes (a). In contrast, ESC-derived cells that did take up ICG expressed readily detectable amounts of hepatocyte phenotypic mRNAs (b). Mouse primary hepatocytes, serving as positive control, strongly expressed hepatocyte phenotypic genes (c). The housekeeping gene β-actin served as a loading control.

To further analyze the properties of the ESC-derived ICG-positive cells, we examined the expression of hepatocyte-related genes by reverse transcription PCR. During the induction of hepatocyte differentiation and exposure to ICG, some of the cell clusters did not take up ICG. For these cells, the expression of hepatocyte phenotypic mRNAs for AFP, transthyretin (TTR), Hex, alpha 1-antitrypsin (AAT), ALB, and LST1 was weak or not detected (Fig. 4Ba). However, for all the ICG-positive cell clusters, the mRNAs were either weakly or strongly detected (Fig. 4Bb). The expressions of glucose-6-phosphatase (G6P) and cytochrome P450 7a1 (Cyp7a1) mRNAs, which are expressed by mature hepatocytes such as mouse primary hepatocytes (Fig. 4Bc), were only weakly detected in ICG-positive cell clusters (Fig. 4Bb). These results showed that cells within the ICG-positive ESC-derived cell clusters had the characteristics of hepatocyte-like cells.

Isolation and functional characterization of ESC-derived ICG-positive cells

Finally, we isolated ICG-negative cells and ICG-positive hepatocyte-like cells under light microscopy and enriched them on Type I collagen-coated dishes for functional characterization of the pure populations. Again, they were stained with ICG at 1 mg/mL. The population of ICG-negative cells remained ICG-negative (Fig. 5Aa), whereas the ICG-positive cells were nearly ICG-positive (Fig. 5Ab). The expression levels of AFP and ALB mRNAs were prominently higher in ICG-positive cells than in ICG-negative ones (Fig. 5B). Then, we quantified the expression of mRNAs for transferase, transporters, and cytochrome, which is a gene superfamily that catalyzes the oxidative metabolism of endogenous and exogenous compounds and plays a major role in the biotransformation of xenobiotics in the liver. The expression of Ugt1a1 (Fig. 5C), Sult2a1 (Fig. 5D), Slco1a4 (Fig. 5E), Cyp1a1 (Fig. 5F), Cyp2a10 (Fig. 5G), and Cyp2b10 (Fig. 5H) was obviously higher in ICG-positive cells (Fig. 5Cb–Hb) than in ICG-negative cells (Fig. 5Ca–Ha). Further, the expression levels of ICG-positive cells were similar to or higher than those in the fetal liver (Fig. 5Cc–Hc). However, the expression of these genes in ICG-positive cells was remarkably lower than that in the adult liver (Fig. 5Cd–Hd). These results indicated that the ICG-positive cells had functional characteristics of hepatocyte-like cells.

FIG. 5.

Isolation and functional characterization of ESC-derived ICG-positive cells. (A) ICG-negative cells (a) and ICG-positive cells (b). Scale bars=60 μm. (B) Transcripts of AFP and ALB were quantified by real-time PCR. (C–H) Real-time PCR analysis of hepatic functional markers in ICG-negative cells (a), ICG-positive cells (b), E13.5 fetal liver (c), and adult liver (d). Transcripts of Ugt1a1, Sult2a1, Slco1a4, Cyp1a1, Cyp2a10, and Cyp2b10 were quantified. Relative expression levels of each gene to β-actin were compared with those in ICG-negative cells. *p<0.05 and **p<0.01 versus ICG-negative cells (a).

Discussion

In the current study, we developed a new system for detecting hepatocytes that does not depend on any genetic modification. Rather, it utilizes the innate ability of hepatocytes to take up ICG, a nontoxic, fluorescent organic anion. Previous methods for detecting and/or isolating hepatocytes depended on transfer of reporter genes driven by liver-specific promoters^9,10 or the use of antibodies that capture single or multiple surface antigens in the hepatic cell membrane.^24,25 However, inserted exogenous genes that are randomly integrated into nuclear chromosomes can be silenced due to positional effects associated with local chromatin structure, especially in ESCs.^26,27 Further, targeted integration is not optimal, because it is difficult and time consuming,^26,27 and genetic modification may damage endogenous genes and increase the risk of tumorigenesis.¹² The use of antibodies also has drawbacks. For instance, the antibodies are expensive, and the activity may be inconsistent between batches and, thus, yield variable results. Our detection system overcomes these problems and has the advantage of being easy, inexpensive, and relies on the selective uptake by hepatocytes of ICG, a stable fluorescent chemical compound.

ICG absorbs light over a wide spectrum of wavelengths, and it has the unusual property that the absorption maximum is dependent on concentration. In solution, including plasma, it tends to aggregate, which changes its absorption properties.²³ Therefore, we could not detect ICG in primary hepatocytes when they were incubated with high concentrations. Moreover, cells other than hepatocytes can acquire it if incubated with ICG for long periods of time or at high concentrations (data not shown). Thus, the proper concentration and incubation time with ICG are required for detecting hepatocytes.

A previous study reported that irradiation of ICG with a lazer at 100 J/cm² can generate singlet oxygen (¹O₂), which is damaging to cells.²⁰ However, among the cells we analyzed by flow cytometry, most were alive as determined by trypan blue exclusion (data not shown). The power of the FISHMAN-R lazer was 5 mJ/cm², which is considerably lower than the 100 J/cm² lazer and much less likely to generate singlet oxygen. Thus, the ICG detection system for hepatocytes appears to do little or no damage to the cells.

The FISHMAN-R flow cytometer was successful in detecting ESC-derived ICG-positive cells. Interestingly, the fluorescence intensity of the ICG was similar to that of the HepG2 cells, but was lower than that of primary hepatocytes. These results indicate that our detection system can distinguish between mature hepatocytes and immature hepatocytes by the difference of fluorescence intensity. However, the FISHMAN-R cannot now isolate and purify ICG-positive cells. Therefore, we confirmed that ESC-derived ICG-positive cells had characteristics of hepatocytes by PAS staining of ESC-derived cell clusters which showed glycogen deposits. Additionally, reverse transcriptase PCR of ICG-positive ESC-derived cell clusters showed the expression of typical hepatocyte genes AFP, TTR, Hex, AAT, ALB, LST1, and G6P. Previous research reported that organic anion transporter, LST1, has been found to be exclusively expressed in the liver^28,29 and is considered to play a role in the hepatocellular uptake of ICG.¹⁷ Our results are also consistent with those reports.

Finally, we used light microscopy to identify and harvest individual ICG-positive cells that we then expanded in subsequent cultures. Using these isolated and expanded cells, we confirmed that expression of mRNAs for transferase, transporters, and major cytochrome P450s responsible for drug metabolism, such as Ugt1a1, Sult2a1, Slcola4, Cyp1a1, Cyp2a10, and Cyp2b10 was higher in ICG-positive cells than in ICG-negative cells. However, the expression levels of ICG-positive cells were lower than those of adult liver. Interestingly, these results were similar to those of flow cytometry, indicating that immature hepatocytes also have the ability to take up ICG. Further, a previous study reported that transplanted ESC-derived ICG-positive cells are normally incorporated into liver parenchymal structure.¹⁷ Further, these cells are morphologically indistinguishable from host hepatocytes and do not promote development of teratomas. These results indicate that ESC-derived ICG-positive cells exhibit functional characteristics of hepatocytes.

In conclusion, this study demonstrates that the FISHMAN-R flow cytometer ICG detection system could detect ICG-positive hepatocyte-like cells. It has the potential to be developed for purifying hepatocytes produced from pluripotent stem cells such as ESCs, induced pluripotent stem cells, and mesenchymal stem cells. Since it is based on technology that does not depend on gene analysis or manipulation, the FISHMAN-R flow cytometer provides an appropriate level of stability and safety required for identifying cell sources for the treatment of hepatic diseases. Additionally, our method also has the ability to screen for differentiated hepatocytes derived from ESCs.

Footnotes

Acknowledgments

The authors thank Kayo Suzuki and Dr. Kiyokazu Kametani (Research Center for Instrumental Analysis, Shinshu University) for their excellent technical assistance.

Disclosure Statement

No competing financial interests exist.

References

Pietrosi

, Vizzini

G.B.

, Gruttadauria

, Gridelli

Clinical applications of hepatocyte transplantation. World J Gastroenterol, 15:2074. 2009.

Ito

, Nagata

, Miyakawa

, Fox

I.J.

Review of hepatocyte transplantation. J Hepatobiliary Pancreat Surg, 16:97. 2009.

Evans

M.J.

, Kaufman

M.H.

Establishment in culture of pluripotential cells from mouse embryos. Nature, 292:154. 1981.

Martin

G.R.

Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA, 78:7634. 1981.

Teratani

, Yamamoto

, Aoyagi

, Sasaki

, Asari

, Quinn

, Sasaki

, Terada

, Ochiya

Direct hepatic fate specification from mouse embryonic stem cells. Hepatology, 41:836. 2005.

Shiraki

, Umeda

, Sakashita

, Takeya

, Kume

Differentiation of mouse and human embryonic stem cells into hepatic lineages. Genes Cells, 13:731. 2008.

Sasaki

, Ichikawa

, Takei

, No

, Tomotsune

, Kano

, Yokoyama

, Shirasawa

, Mogi

, Yoshie

, Sasaki

, Yamada

, Matsumoto

, Mizuguchi

, Yue

, Tanaka

Hepatocyte differentiation from human ES cells using the simple embryoid body formation method and the staged-additional cocktail. ScientificWorldJournal, 9:884. 2009.

Yoshie

, Shirasawa

, Yokoyama

, Kano

, Takei

, Mizuguchi

, Matsumoto

, Tomotsune

, Sasaki

Lanford medium induces high quality hepatic lineage cell differentiation directly from mouse embryonic stem cell-derived mesendoderm. Biochem Biophys Res Commun, 391:1477. 2010.

Heo

, Factor

V.M.

, Uren

, Takayama

, Lee

J.S.

, Major

, Feinstone

S.M.

, Thorgeirsson

S.S.

Hepatic precursors derived from murine embryonic stem cells contribute to regeneration of injured liver. Hepatology, 44:1478. 2006.

10.

Wallenstein

E.J.

, Barminko

, Schloss

R.S.

, Yarmush

M.L.

Transient gene delivery for functional enrichment of differentiating embryonic stem cells. Biotechnol Bioeng, 101:859. 2008.

11.

Recchia

, Bonini

, Magnani

, Urbinati

, Sartori

, Muraro

, Tagliafico

, Bondanza

, Stanghellini

M.T.

, Bernardi

, Pescarollo

, Ciceri

, Bordignon

, Mavilio

Retrovial vector integration deregulates gene expression but has no consequence on the biology and function of transplanted T cells. Proc Natl Acad Sci USA, 103:1457. 2006.

12.

Woods

N. B.

, Muessig

, Schmidt

, Flygare

, Olsson

, Salmon

, Trono

, Von

K, C.

, Karlsson

Lentiviral vector transduction of NOD/SCID repopulating cells results in multiple vector integrations per transduced cell: risk of insertional mutagenesis. Blood, 101:1284. 2003.

13.

Tsukahara

, Agawa

, Matsumoto

, Matsuda

, Ueno

, Yamashita

, Yamada

, Tanaka

, Kojima

, Takeshita

Murine leulemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line. Biochem Biophys Res Commun, 345:1099. 2006.

14.

Meier

P.J.

, Eckhardt

, Schroeder

, Hagenbuch

, Stieger

Substrate specificity of sinusoidal bile acid and organic anion uptake systems in rat and human liver. Hepatology, 26:1667. 1997.

15.

Müller

, Jansen

P.L.

The secretory function of the liver: new aspects of hepatobiliary transport. J Hepatol, 28:344. 1998.

16.

Berk

P.D.

, Stremmel

Hepatocellular uptake of organic anions. Prog Liver Dis, 8:125. 1986.

17.

Yamada

, Yoshikawa

, Kanda

, Kato

, Nakajima

, Ishizaka

, Tsunoda

In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. Stem Cells, 20:146. 2002.

18.

Agarwal

, Holton

K.L.

, Lanza

Efficient differentiation of functional hepatocytes from human embryonic stem cells. Stem Cells, 26:1117. 2008.

19.

Farzaneh

, Pournasr

, Ebrahimi

, Aghdami

, Baharvand

Enhanced functions of human embryonic stem cell-derived hepatocyte-like cells on three-dimensional nanofibrillar surfaces. Stem Cells Rev, 6:601. 2010.

20.

Hirano

, Kohno

, Gohto

, Obana

Singlet oxygen generation by irradaiation of Indocyanina Green (ICG) and its effect of tissues. Nippon Laser Igakkaishi, 28:122. 2007.

21.

Kamiya

, Kakinuma

, Yamazami

, Nakauchi

Enrichment and clonal culture of progenitor cells during mouse postnatal liver development in mice. Gastroenterology, 137:1114. 2009.

22.

Fassett

, Tobolt

, Hansen

L.K.

Type I collagen structure regulates cell morphology and EGF signaling in primary rat hepatocytes through cAMP-dependent protein kinase A. Mol Biol Cell, 17:345. 2006.

23.

Landsman

M.L.

, Kwant

, Mook

G.A.

, Zijlstra

W.G.

Light-absorbing properties, stability, and spectral stabilization of indocyanine green. J Appl Physiol, 40:575. 1976.

24.

Basma

, Soto-Gutiérrez

, Yannam

G.R.

, Liu

, Ito

, Yamamoto

, Ellis

, Carson

S.D.

, Sato

, Chen

, Muirhead

, Navarro-Alvarez

, Wong

R.J.

, Roy-Chowdhury

, Platt

J.L.

, Mercer

D.F.

, Miller

J.D.

, Strom

S.C.

, Kobayashi

, Fox

I.J.

Differentiation and transplantation of human embryonic stem cell-derived hepatocytes. Gastroenterology, 136:990. 2009.

25.

Zhao

, Chen

, Cai

, Guo

, Song

, Che

, Liu

, Wu

, Ding

, Deng

Derivation and characterization of hepatic progenitor cells from human embryonic stem cells. PLoS One, 4:e6468. 2009.

26.

Masui

, Shimosato

, Toyooka

, Yagi

, Takahashi

, Niwa

An efficient system to establish multiple embryonic stem cell lines carrying an inducible expression unit. Nucleic Acids Res, 33:e43. 2005.

27.

Gropp

, Reubinoff

Lentiviral vector-mediated gene delivery into human embryonic stem cells. Methods Enzymol, 420:64. 2006.

28.

Abe

, Kakyo

, Tokui

, Nakagomi

, Nishio

, Nakai

, Nomura

, Unno

, Suzuki

, Naitoh

, Matsuno

, Yawo

Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem, 274:17159. 1999.

29.

Kakyo

, Unno

, Tokui

, Nakagomi

, Nishio

, Iwasashi

, Nakai

, Seki

, Suzuki

, Naitoh

, Matsuno

, Yawo

, Abe

Molecular characterization and functional regulation of a novel rat liver-specific organic anion transporter rlst-1. Gastroenterology, 117:770. 1999.