Association of the Protein Tyrosine Phosphatase Nonreceptor 22 Haplotypes with Autoimmune Thyroid Disease in the Japanese Population

Abstract

Background:

A missence single-nucleotide polymorphism (SNP) in the protein tyrosine phosphatase nonreceptor 22 (PTPN22) gene known as R620W (rs2476601) was recently reported to be associated with several autoimmune diseases including Graves' disease (GD). The association was repeatedly confirmed in the populations of North European ancestry. However, this amino acid was reported to be nonpolymorphic in the Asian populations. Since the gene confers an impact on autoimmune diseases, we attempt to explore an association between the PTPN22 gene and autoimmune thyroid disease (AITD) in a Japanese population without restricting to rs2476601. Previous investigations have also demonstrated that two intronic SNPs (rs706778 and rs3118470) in the interleukin-2 receptor-α (IL2RA) gene were associated with type 1 diabetes in the Japanese population.

Patients and Methods:

We genotyped the five SNPs (rs12760457, rs2797415, rs1310182, rs2476599, and rs3789604) of the PTPN22 and the two SNPs (rs706778 and rs3118470 in the IL2RA gene) in 456 Japanese patients with AITD (286 with GD, 170 with Hashimoto's thyroiditis) and 221 matched Japanese control subjects. Seven SNPs were analyzed by either the SNAPshot method or the high-resolution melting and unlabeled probe methods. Case-control association studies were performed using the χ ² and Fisher's exact tests with Yates correction. Haplotype was conducted using the expectation-maximization algorithm.

Results:

No association was found between any of the individual SNPs of the PTPN22 gene and AITD. Permutation analysis revealed that the distribution of one haplotype is significantly different between patients with AITD and controls (p = 0.0036). A novel protective effect of a haplotype containing five SNPs was observed (p < 0.0001 for AITD, p < 0.0001 for GD, and p < 0.0001 for Hashimoto's thyroiditis, respectively). The GG allele of rs3118470 in the IL2RA gene was significantly associated with GD (p = 0.03), although the association was weak.

Conclusions:

Significant difference in the distribution of the haplotype suggests that the PTPN22 gene rather than rs2476601 is involved in the development of AITD in the Japanese population.

Introduction

A utoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are among the most common human autoimmune diseases. The prevalence in Caucasians is 1% (1,2), and the prevalence in Japanese may be similar. GD is clinically characterized by hyperthyroidism, diffuse goiter, and the presence of thyrotropin (TSH) receptor antibodies. Some patients develop extrathyroidal manifestations, mainly ophthalmopathy and dermopathy [reviewed in Ref. (3)]. The HT is characterized by apoptosis of thyrocytes leading to hypothyroidism [reviewed in Ref. (4)]. However, despite their contrasting clinical presentations, GD and HT share many common features, mainly the infiltration of the thyroid by T cells and the production of antithyroid autoantibodies (antithyroglobulin and antithyroid peroxidase antibodies) (3 –5).

The pathogenesis of AITDs is thought to involve several risk factors, including genetic risk factors [reviewed in Ref. (6)] and environmental triggers such as cigarette smoking, iodine intake, and infection (7,8) [reviewed in Ref. (3)]. However, the evidence for interactions between hereditary factors and environmental influences appears to be much stronger for cigarette smoking and iodine intake than for infections (8).

The first locus shown to be associated with AITDs was the HLA-DR (HLA-DRB1) locus [reviewed in Ref. (6)]. The HLA-DR3 (DRB1*03) has been consistently shown to be associated with GD in Caucasians, with an odds ratio of 2.0–3.0 (6). Other HLA alleles have been shown to be associated with GD in nonCaucasian populations [reviewed in Ref. (9)]. Non-HLA genes have also been shown to influence the expression of GD. These genes include the genes for cytotoxic T lymphocyte antigen-4 (CTLA-4), CD40, thyroglobulin (Tg), and TSH receptor [reviewed in Ref. (10)].

Lymphoid tyrosine phosphatase (LYP) is a protein tyrosine phosphatase (PTP) that plays a negative role in T cell signaling by dephosphorylating the Src family of kinases, thus preventing initiation of T cell activation (11). Recent studies have identified association of T allele (W620) of a functional missense single-nucleotide polymorphism (SNP), +1858C>T encoding an arginine to tryptophan (R620W) substitution at codon 620 (dbSNP accession number rs2476601) of PTP nonreceptor 22 (PTPN22) encoding LYP, with many autoimmune diseases, including type 1 diabetes (T1D) (12 –14), systemic lupus erythematosus (SLE) (15,16), GD (13,17,18), rheumatoid arthritis (RA) (19 –21), HT (16), juvenile idiopathic arthritis (21), and vitiligo (22) (Table 1).

Table 1.

Some Protein Tyrosine Phosphatase Nonreceptor 22 Association Studies in Different Autoimmune Diseases in Different Populations

dbSNP ID	Country	Ethnic group	Disease	Number	OR/p-value	Reference
rs2476601	United States	Caucasians	T1D	294	1.83/<0.001	(12)
rs2476601	United Kingdom	Caucasians	T1D	1599	1.78/6.02 × 10⁻²⁷	(13)
rs2476601	United States	Caucasians	T1D	341	0.005	(14)
rs2488457	Japan	Japanese	T1D	317	1.42/0.015	(25)
rs2476601	United Kingdom	Caucasians	GD	1734	1.43/6.24 × 10⁻⁴	(13)
rs2476601	United Kingdom	Caucasians	GD	549	1.88/3.4 × 10⁻⁵	(17)
rs2476601	Poland	Caucasians	GD	290	1.7/<0.0008	(18)
rs3789604	Japan	Japanese	GD	414	1.45/0.0085	(40)
rs2476601	United States	Caucasians	HT	194	1.77	(16)
rs2476601	United States	Caucasians	SLE	525	1.37/9.0 × 10⁻⁵	(15)
rs2476601	United States	Caucasians	SLE	101	1.58	(16)
rs2476601	United States	Caucasians	RA	475	6.6 × 10⁻⁴	(19)
rs2476601	United States	Caucasians	RA	968	1.75/1.3 × 10⁻⁹	(20)
rs2476601	Norway	Caucasians	RA	555	1.58/0.001	(21)
rs1310182	United States	Caucasians	RA	475	1.48/3.2 × 10⁻⁵	(28)
rs3789604	United States	Caucasians	RA	475	1.39/0.0071	(28)
rs2476601	Norway	Caucasians	JIA	320	1.41/0.04	(21)
rs2476601	United Kingdom	Caucasians	vitiligo	165	1.82/0.006	(22)

SNP, single-nucleotide polymorphism; OR, odds ratio; T1D, type 1 diabetes; GD, Graves'disease; HT, Hashimoto's thyroiditis; SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; JIA, juvenile idiopathic arthritis.

However, rs2476601 was reported to be nonpolymorphic in the Asian populations (23,24). Recently, Kawasaki et al. reported that heterozygousity (molecular heterosis) of the polymorphism in the promoter region of PTPN22 gene (dbSNP accession number rs2488457) is associated with Japanese acute onset T1D (25). In Caucasians, rs2488457 is strongly linked to the rs2476601; and several studies have disclosed that the association of rs2488457 and autoimmune diseases is a result of the linkage to the rs2476601, and real susceptible allele is 1858T (620W) (26,27).

Carlton et al. (28) identified 37 SNPs in the PTPN22 gene and reported that several SNPs including rs1310182 and rs3789604 are also associated with RA independent of rs2476601 in the Caucasian population. They also studied the haplotype and found that some haplotypes which do not contain R620W are associated with RA. However, these SNPs were not associated with Japanese RA (24). If the functional change of LYP is important for the process of autoimmune diseases, there might be disease susceptible alleles other than 620W in the Japanese population.

Another molecule with a role in the control of immune responses and the maintenance of immune homeostasis that has been demonstrated to have a role in autoimmunity is the interleukin-2 receptor-α (IL2RA). The IL2RA encodes the α-chain of the IL2R complex (also known as CD25), which is central to immune regulation as an important modulator of self-tolerance and immunity (29), and the IL2RA association with T1D was originally identified by Vella and coworkers (30). The IL2RA gene has also been associated with GD (31), RA (32), and multiple sclerosis (33) in Caucasians, which implies that this locus may have a general effect on predisposition to autoimmunity. Recently, two SNPs in intron 1 of the IL2RA, rs706778 and rs3118470, were associated with T1D in the Japanese population (34).

In this study, we examined whether the SNPs associated with Caucasian RA are also associated with Japanese AITD. We also analyzed the haplotype and found that the PTPN22 gene plays some role in the susceptibility or the protection of AITD in the Japanese population.

Materials and Methods

Subjects

This project was approved by the Institutional Review Board of Showa University. Two hundred eighty-six Japanese patients with GD, 170 patients with HT, and 221 Japanese controls were studied. GD was diagnosed based on clinical symptoms and biochemical confirmation of hyperthyroidism, including diffuse goiter, elevated radioactive iodine uptake, the presence of antithyrotropin receptor antibodies, (TRAbs) and elevated thyroid hormone levels. The patients with HT had documented clinical and biochemical hypothyroidism requiring thyroid hormone replacement therapy and showed autoantibodies against thyroid peroxidase (TPOAb) with or without antibodies against Tg (TgAb). Two hundred twenty-one age-matched Japanese volunteers served as controls in our association studies. All controls had no personal or family history of any autoimmune disease or thyroid condition.

SNP genotyping

DNA was extracted from whole blood using the Puregene kit (Gentra Systems, Minneapolis, MN). We analyzed the following five SNPs in the PTPN22 gene: rs12760457 in intron 11; rs2797415 in intron 15; rs1310182 in intron 16; rs2476599 in intron 19; and rs3789604 in putative transcription factor-binding sites downstream of the PTPN22 gene. We also analyzed the following two SNPs in the IL2RA gene: rs706778 and rs3118470 in intron 1of the IL2RA gene. The SNPs rs1310182 and rs3789604 were analyzed by the SNAPshot (PE Applied Biosystems, Foster city, CA) based on the manufacturer's protocol. The SNPs rs12760457, rs2797415, rs2476599, rs706778, and rs3118470 were genotyped by the high-resolution melting and unlabeled probe methods using LightScanner^® (Idaho Technology, Salt Lake City, Utah) based on the manufacturer's protocol. Details of the primers are given in Table 2.

Table 2.

Primers Used for Typing the Analyzed Single-Nucleotide Polymorphisms in Protein Tyrosine Phosphatase Nonreceptor 22 and Interleukin-2 Receptor-α Genes

Gene	dbSNP ID	Forward Primer	Reverse primer	Interrogator primer or 3′-aminolinked probes
PTPN22	rs12760457	TATCACTGTTGCTCAGACTGG	CAGTAACTGAAGCAAAATAGATG	TTTCCGTACCCTCTATTCTGC
	rs2797415	GCTGAGCAACATTTGATGTC	GGATTTGGGAACATTTGGTG	ATACTATTCCTAAGAACCGAAC
	rs1310182	ATGGACATATTTTCCCATGATG	AAATGCCTACTGTATGCCAG	GATCGATCGATCGATCGTACAAGAGGTTCAC
	rs2476599	TCAGGTACCTCCTCGAAAAG	CACTGTGTGAACTGCATATGC	CCTAGTATTACGTATGCATGTGC
	rs3789604	CAGCATGAGGTTTCTCCTTC	CAATAGAAGCTCGGTTGGAG	CCACAAACACACATTTAAATGGCCCGACCGCCCCCCCTCCGCGCA
IL2RA	rs706778	CCCCTGTGTCTTGGGGCCTC	CATGAGGGTGACATGGAAAG	TCCCTGGAATGTCACTGATGG
	rs3118470	TTTTGGCTCATTGGGGTCTC	ATGTAAAGGGAGCCCCAAG	CTCCCTGGAATCTCACTGATG

PTPN22, protein tyrosine phosphatase nonreceptor 22; IL2RA, interleukin-2 receptor-α.

Laboratory tests

The serum concentrations of free triiodothyronine, free thyroxine, and TSH were determined by enzyme immunoassay. The TRAb was measured by a radioreceptor assay using a commercially available kit (TRAb Cosmic III; Cosmic, Tokyo, Japan). The cutoff value for TRAb was 10%. The TPOAb and TgAb were measured by a radioimmunoassay using a commercially available kit (TPOAb Cosmic II and TgAb Cosmic II; Cosmic). The cutoff value for TPOAb and TgAb was 0.3 U/mL.

Statistical analysis

Case-control analysis and Hardy–Weinberg equilibrium (HWE) test of SNP were performed using SNPAlyze ver. 7.0 (Dynacom, Yokohama, Japan) (35). The HWE tests were carried out for all loci among subjects and controls separately. Tests in subjects and controls did not show any significant deviation from HWE for any of the SNPs. Linkage disequilibrium (LD) between SNPs was evaluated by the D′ and r ² of pair-wise LD using SNPAlyze ver. 7.0 (Dynacom). Haplotype frequencies for multiple loci were estimated by phase estimation using the expectation-maximization algorithm. Permutation p-values were calculated by comparing haplotype frequencies between cases and controls on the basis of 10,000 replications using SNPAlyze ver. 7.0.

Results

PTPN22 variants and AITD

The frequencies of the alleles and genotypes of the five PTPN22 SNPs in our Japanese population are shown in Table 3. The individual SNPs were not associated with AITD, GD, or HT in our Japanese population (Table 3). All cases and controls were in HWE.

Table 3.

Distribution of the Protein Tyrosine Phosphatase Nonreceptor 22 Single-Nucleotide Polymorphisms in Autoimmune Diseases Patients and Controls

ID	dbSNP ID	Allele/genotype	AITD (n = 450)	GD (n = 281)	HT (n = 169)	Controls (n = 176)	AITD vs. controls p-value	GD vs. controls p-value	HT vs. controls p-value
1 (SNP18^a)	rs12760457	C	840 (93.3)	525 (93.4)	315 (93.2)	329 (93.5)	0.93	0.98	0.89
		T	60 (6.7)	37 (6.6)	23 (6.8)	23 (6.5)
		CC	394 (87.6)	246 (87.5)	148 (87.6)	154 (87.5)	0.91	0.98	0.81
		CT	52 (11.6)	33 (11.7)	19 (11.2)	21 (11.9)
		TT	4 (0.8)	2 (0.7)	2 (1.2)	1 (0.6)
2 (SNP25^a)	rs2797415	T	532 (59.1)	334 (59.4)	198 (58.6)	212 (60.2)	0.72	0.81	0.66
		C	368 (40.9)	228 (40.6)	140 (41.4)	140 (39.8)
		TT	157 (34.9)	98 (34.9)	59 (34.9)	68 (38.6)	0.49	0.46	0.72
		TC	218 (48.4)	138 (49.1)	80 (47.3)	76 (43.2)
		CC	75 (16.7)	45 (16.0)	30 (17.8)	32 (18.2)
3 (SNP27^a)	rs1310182	T	721 (80.1)	453 (80.6)	268 (79.3)	286 (81.3)	0.65	0.81	0.66
		C	179 (19.9)	109 (19.4)	70 (20.7)	66 (18.7)
		TT	297 (66.0)	188 (66.9)	109 (64.5)	118 (67.0)	0.83	0.86	0.80
		TC	127 (28.2)	77 (27.4)	50 (29.6)	50 (28.4)
		CC	26 (5.8)	16 (5.7)	10 (5.9)	8 (4.5)
4 (SNP33^a)	rs2476599	G	779 (86.6)	486 (86.5)	293 (86.7)	309 (87.8)	0.56	0.57	0.67
		A	121 (13.4)	76 (13.5)	45 (13.3)	43 (12.2)
		GG	341 (75.8)	214 (76.2)	127 (75.1)	135 (76.7)	0.51	0.36	0.86
		GA	97 (21.6)	58 (20.6)	39 (23.1)	39 (22.2)
		AA	12 (2.6)	9 (3.2)	3 (1.8)	2 (1.1)
5 (SNP37^a)	rs3789604	A	714 (79.3)	447 (79.5)	267 (79.0)	291 (82.7)	0.18	0.24	0.22
		C	186 (20.7)	115 (20.5)	71 (21.0)	61 (17.3)
		AA	227 (61.6)	175 (62.3)	102 (60.4)	122 (69.3)	0.097	0.21	0.091
		AC	160 (35.6)	97 (34.5)	63 (37.3)	47 (26.7)
		CC	13 (2.8)	9 (3.2)	4 (2.4)	7 (4.0)

Values given are the number of subjects, with the percentage in parentheses.

SNP numbers corresponding to those reported by Carlton et al.²⁸

AITD, autoimmune thyroid disease.

PTPN22 haplotype analysis

Due to the strong LD between five variants, haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Five haplotypes were identified, three of which (haplotypes 1, 2, and 4) were correlated with haplotypes 1, 4, and 5 identified in the report by Carlton et al. (Table 4). Four haplotypes (haplotypes 1–4) were relatively common and 1 haplotype was rare. Distribution of the haplotype was significantly different between AITD and control by permutation procedure (p = 0.0036). A novel protective effect of a haplotype containing five SNPs was observed (p < 0.0001 for AITD, p < 0.0001 for GD, and p < 0.0001 for HT, respectively) (Table 4).

Table 4.

Protein Tyrosine Phosphatase Nonreceptor 22 Haplotype Structure and Frequencies

	SNP ID					Haplotype comparison ^a
Haplotype	1	2	3	4	5	AITD	GD	HT	Controls	AITD vs. controls p-value	GD vs. controls p-value	HT vs. controls p-value
1	C	T	T	G	A	0.59	0.59	0.59	0.60	0.69	0.75	0.69
2	C	C	T	G	C	0.20	0.20	0.20	0.17	0.24	0.29	0.28
3	C	C	C	A	A	0.13	0.13	0.13	0.12	0.54	0.66	0.47
4	T	C	C	G	A	0.067	0.066	0.070	0.060	0.63	0.72	0.61
5	C	C	T	G	A	0.013	0.017	0.0061	0.051	<0.0001	<0.0001	0.0004

The program, SNPAlyze ver. 7.0 Standard (Dynacom, Yokohama, Japan), was used to estimate common (frequencies >0.01) haplotypes for the five SNPs genotyped.

Each haplotype was compared with the other haplotypes combined.

IL2RA variants and AITD

The frequencies of the alleles and genotypes of the two IL2RA SNPs in our Japanese population are shown in Table 5. As shown in Table 5, the GG allele was significantly associated with GD (p = 0.03), although the association was weak. All cases and controls were in HWE.

Table 5.

Distribution of the Interleukin-2 Receptor-α Single-Nucleotide Polymorphisms in Autoimmune Disease Patients and Controls

dbSNP ID	Allele/genotype	AITD (n = 456)	GD (n = 286)	HT (n = 170)	Controls (n = 221)	AITD vs. controls p-value	GD vs. controls p-value	HT vs. controls p-value
rs706778	A	522 (57.2)	345 (60.3)	177 (52.1)	243 (55.0)	0.43	0.08	0.42
	G	390 (42.8)	227 (39.7)	163 (47.9)	199 (45.0)
	AA	153 (33.6)	106 (37.1)	47 (27.6)	73 (33.0)	0.46	0.16	0.49
	AG	216 (47.4)	133 (46.5)	83 (48.8)	97 (43.9)
	GG	87 (19.1)	47 (16.4)	40 (23.5)	51 (23.1)
rs3118470	G	466 (51.1)	305 (53.3)	161 (47.4)	206 (46.6)	0.12	0.03	0.84
	A	446 (48.9)	267 (46.7)	179 (52.6)	236 (53.4)
	GG	118 (25.9)	79 (27.6)	39 (22.9)	47 (21.3)	0.30	0.10	0.91
	GA	230 (50.4)	147 (51.4)	83 (48.8)	112 (50.7)
	AA	108 (23.7)	60 (21.0)	48 (28.2)	62 (28.1)

Values given are the number of subjects, with the percentage in parentheses.

Discussion

The LYP is encoded by PTPN22 on chromosome 1p13 (36) and exerts its effect on T cell activation via association with a variety of adaptor molecules, including c-src tyrosine kinase (Csk) kinase (37), c-Cbl (36), and Grb2 (38). It is known that the presence of tryptophan at position 620 (W620) can disrupt the ability of LYP to bind to at least one of these adaptor molecules, such as Csk kinase, due to the inability of W620 to fit into the binding pocket on the Csk molecule (12). This has been shown experimentally in both Escherichia coli and COS cells, where only the construct containing R620 was precipitated by Csk (12). The combination of these genetic and functional data suggests that LYP plays an important role in regulating the autoimmune process.

The SNP rs2476601 of the PTPN22 gene was reported to be nonpolymorphic in the Asian populations (23,24). The T allele of rs2476601 of the PTPN22 gene has been shown to increase susceptibility to AITD in Caucasians (16 –18). Further, a metaanalysis showed associations of the PTPN22 1858T allele with RA, SLE, GD, and T1D in Caucasians (39). It has been proposed that the disease-associated T allele encodes a protein that does not bind to the protein tyrosine kinase Csk and may, therefore, cause general hyperresponsiveness of T cells (12). Among Japanese populations, however, the PTPN22 T variant has not been found in patients with GD, patients with T1D, patients with RA, or control subjects (23 –25,40), confirming that the PTPN22 gene polymorphism shows ethnic differences.

Recently, rs2488457 in the promoter region was reported to be associated with acute onset T1D in a Japanese population (25). However, there was no association of rs2488457 with GD (40). Further, rs3789604 of the PTPN22 gene was found to be associated with RA, independently of rs2476601 (22). The SNP rs3789604 lies 1496 bases downstream of PTPN22 at the 50 end of the round spermatid basic protein 1 gene, where it encodes either a silent mutation or putative transcription factor-binding sites, depending on the transcript. Recently, the AA-genotype and A-allele frequencies of rs3789604 were significantly higher in patients with GD than in control subjects (40), suggesting that the SNP37 polymorphism or a gene with LD may be relevant to susceptibility to GD in Japanese populations. Therefore, we further analyzed five other SNPs including rs12760457, rs2797415, rs1310182, rs2476599, and rs3789604, to clarify whether a susceptibility locus for AITD exists at another location within the PTPN22 gene. However, there was no association of any of the individual SNPs with disease.

We also analyzed the haplotype and found that the PTPN22 gene plays some role in the susceptibility or the protection of AITD in the Japanese population. There was significant LD between the SNPs tested. Five haplotypes were present in the PTPN22 gene, and a novel protective effect of a haplotype containing five SNPs (haplotype 5) was observed. Combined with the results arising from previous studies, we reveal that the association between the haplotype of the PTPN22 gene and autoimmune diseases is complicated. Identification of the precise risk or protective alleles in the region of the PTPN22 gene linked to the associated haplotypes requires further investigation. Recently, a loss-of-function mutation in the PTPN22 gene that does not exist in the Asian population was shown to confer protection against human SLE (41). It has also been proposed that significant LD may extend for several hundred kilobases surrounding PTPN22 and, thus, potentially include additional genes including round spermatid basic protein 1 and DNA cross-link repair 1B (DCLRE1B) (42). Therefore, the possibility that a gene other than PTPN22 is responsible for the association with AITD cannot be fully excluded.

In the present study, we analyzed the two SNPs in the IL2RA gene, and the GG allele of the rs3118470 was significantly associated with GD (p = 0.03), although the association was weak.

In summary, our data suggest that genetic polymorphisms within PTPN22 are influencing susceptibility in a disease-specific manner, a finding that warrants further functional analysis to elucidate their true role in AITD and the autoimmune disease process, in general. We find an evidence to support a weak effect at the IL2RA locus on susceptibility to GD, perhaps due to ethnic differences.

Footnotes

Acknowledgments

This work was supported in part by a Showa University Grant-in-aid for Innovative Collaborative Research Projects (to Yoshiyuki Ban [Y.B.]), the Showa University Medical Foundation (to Y.B.), a grant from Showa University School of Medicine Alumni Association (to Y.B.), and a grant from Yamaguchi Endocrine Research Association (to Y.B.).

Disclosure Statement

The authors declare that they have no competing financial interests.

References

Jacobson

, Gange

, Rose

, Graham

. 1997. Epidemiology and estimated population burden of selected autoimmune diseases in the United States. Clin Immunol Immunopathol, 84:223–243.

Hollowell

, Staehling

, Flanders

, Hannon

, Gunter

, Spencer

, Braverman

. 2002. Serum TSH, T(4), and thyroid antibodies in the United States population (1988 to 1994): National Health and Nutrition Examination Survey (NHANES III) J Clin Endocrinol Metab, 87:489–499.

Davies

. 2000. Graves' diseases: pathogenesis. Braverman

, Utiger

. Werner and Ingbar's The Thyroid: A Fundamental and Clinical Text. Lippincott-Raven: Philadelphia, 518–530.

Weetman

. 1996. Chronic autoimmune thyroiditis. Braverman

, Utiger

. Werner and Ingbar's The Thyroid: A Fundamental and Clinical Text. Lippincott-Raven: Philadelphia, 738–748.

Tomer

. 1997. Anti-thyroglobulin autoantibodies in autoimmune thyroid diseases: Cross-reactive or pathogenic? Clin Immunol Immunopathol, 82:3–11.

Tomer

, Davies

. 2003. Searching for the autoimmune thyroid disease susceptibility genes: from gene mapping to gene function. Endocr Rev, 24:694–717.

Tomer

, Davies

. 1993. Infection, thyroid disease and autoimmunity. Endocr Rev, 14:107–120.

Brix

, Hansen

, Kyvik

, Hegedus

. 2000. Cigarette smoking and risk of clinically overt thyroid disease: a population-based twin case-control study. Arch Intern Med, 160:661–666.

Ban

, Tomer

. 2003. The contribution of immune regulatory and thyroid specific genes to the etiology of Graves' and Hashimoto's diseases. Autoimmunity, 36:367–379.

10.

Jacobson

, Tomer

. 2007. The CD40, CTLA-4, thyroglobulin, TSH receptor, and PTPN22 gene quintet and its contribution to thyroid autoimmunity: back to the future. J Autoimmun, 28:85–98.

11.

Mustelin

, Alonso

, Bottini

, Huynh

, Rahmouni

, Nika

, Louis-dit-Sully

, Tautz

, Togo

, Bruckner

, Mena-Duran

, al-Khouri

. 2004. Protein tyrosine phosphatases in T cell physiology. Mol Immunol, 41:687–700.

12.

Bottini

, Musumeci

, Alonso

, Rahmouni

, Nika

, Rostamkhani

, MacMurray

, Meloni

, Lucarelli

, Pellecchia

, Eisenbarth

, Comings

, Mustelin

. 2004. A functional variant of lymphoid tyrosine phosphatase is associated with type 1 diabetes. Nat Genet, 36:337–338.

13.

Smyth

, Cooper

, Collins

, Heward

, Franklyn

, Howson

, Vella

, Nutland

, Rance

, Maier

, Barratt

, Guja

, Ionescu-Tirgoviste

, Savage

, Dunger

, Widmer

, Strachan

, Ring

, Walker

, Clayton

, Twells

, Gough

, Todd

. 2004. Replication of an association between the lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus. Diabetes, 53:3020–3023.

14.

Ladner

, Bottini

, Valdes

, Noble

. 2005. Association of the single nucleotide polymorphism C1858T of the PTPN22 gene with type 1 diabetes. Hum Immunol, 66:60–64.

15.

Kyogoku

, Langefeld

, Ortmann

, Lee

, Selby

, Carlton

, Chang

, Ramos

, Baechler

, Batliwalla

, Novitzke

, Williams

, Gillett

, Rodine

, Graham

, Ardlie

, Gaffney

, Moser

, Petri

, Begovich

, Gregersen

, Behrens

. 2004. Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE. Am J Hum Genet, 75:504–507.

16.

Criswell

, Pfeiffer

, Lum

, Gonzales

, Novitzke

, Kern

, Moser

, Begovich

, Carlton

, Li

, Lee

, Ortmann

, Behrens

, Gregersen

. 2005. Analysis of families in the multiple autoimmune disease genetics consortium (MADGC) collection: the PTPN22 620W allele associates with multiple autoimmune phenotypes. Am J Hum Genet, 76:561–571.

17.

Velaga

, Wilson

, Jennings

, Owen

, Herington

, Donaldson

, Ball

, James

, Quinton

, Perros

, Pearce

. 2004. The codon 620 tryptophan allele of the lymphoid tyrosine phosphatase (LYP) gene is a major determinant of Graves' disease. J Clin Endocrinol Metab, 89:5862–5865.

18.

Skórka

, Bednarczuk

, Bar-Andziak

, Nauman

, Ploski

. 2005. Lymphoid tyrosine phosphatase (PTPN22/LYP) variant and Graves' disease in a Polish population: association and gene dose-dependent correlation with age of onset. Clin Endocrinol (Oxf ), 62:679–682.

19.

Begovich

, Carlton

, Honigberg

, Schrodi

, Chokkalingam

, Alexander

, Ardlie

, Huang

, Smith

, Spoerke

, Conn

, Chang

, Saiki

, Catanese

, Leong

, Garcia

, McAllister

, Jeffery

, Lee

, Batliwalla

, Remmers

, Criswell

, Seldin

, Kastner

, Amos

, Sninsky

, Gregersen

. 2004. A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis. Am J Hum Genet, 75:330–337.

20.

Lee

, Li

, Liew

, Bombardier

, Weisman

, Massarotti

, Kent

, Wolfe

, Begovich

, Gregersen

. 2005. The PTPN22 R620W polymorphism associates with RF positive rheumatoid arthritis in a dose-dependent manner but not with HLA-SE status. Genes Immun, 6:129–133.

21.

Viken

, Amundsen

, Kvien

, Boberg

, Gilboe

, Lilleby

, Sollid

, Førre

, Thorsby

, Smerdel

, Lie

. 2005. Association analysis of the 1858C>T polymorphism in the PTPN22 gene in juvenile idiopathic arthritis and other autoimmune diseases. Genes Immun, 6:271–273.

22.

Cantón

, Akhtar

, Gavalas

, Gawkrodger

, Blomhoff

, Watson

, Weetman

, Kemp

. 2005. A single-nucleotide polymorphism in the gene encoding lymphoid protein tyrosine phosphatase (PTPN22) confers susceptibility to generalised vitiligo. Genes Immun, 6:584–587.

23.

Ban

, Tozaki

, Taniyama

, Tomita

, Ban

. 2005. The codon 620 single nucleotide polymorphism of the protein tyrosine phosphatase-22 gene does not contribute to autoimmune thyroid disease susceptibility in the Japanese. Thyroid, 15:1115–1118.

24.

Ikari

, Momohara

, Inoue

, Tomatsu

, Hara

, Yamanaka

, Kamatani

. 2006. Haplotype analysis revealed no association between the PTPN22 gene and RA in a Japanese population. Rheumatology, 45:1345–1348.

25.

Kawasaki

, Awata

, Ikegami

, Kobayashi

, Maruyama

, Nakanishi

, Shimada

, Uga

, Kurihara

, Kawabata

, Tanaka

, Kanazawa

, Lee

, Eguchi

. 2006. Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations. Am J Med Genet A, 140:586–593.

26.

Cinek

, Hradsky

, Ahmedov

, Slavcev

, Kolouskova

, Kulich

, Sumnik

. 2007. No independent role of the −1123 G>C and +2740 A>G variants in the association of PTPN22 with type 1 diabetes and juvenile idiopathic arthritis in two Caucasian populations. Diabetes Res Clin Pract, 76:297–303.

27.

Viken

, Olsson

, Flåm

, Førre

, Kvien

, Thorsby

, Lie

. 2007. The PTPN22 promoter polymorphism −1123G>C association cannot be distinguished from the 1858C>T association in a Norwegian rheumatoid arthritis material. Tissue Antigens, 70:190–197.

28.

Carlton

, Hu

, Chokkalingam

, Schrodi

, Brandon

, Alexander

, Chang

, Catanese

, Leong

, Ardlie

, Kastner

, Seldin

, Criswell

, Gregersen

, Beasley

, Thomson

, Amos

, Begovich

. 2005. PTPN22 genetic variation: evidence for multiple variants associated with rheumatoid arthritis. Am J Hum Genet, 77:567–581.

29.

Kim

, Imbert

, Leonard

. 2006. Both integrated and differential regulation of components of the IL-2/IL-2 receptor system. Cytokine Growth Factor Rev, 17:349–366.

30.

Vella

, Cooper

, Lowe

, Walker

, Nutland

, Widmer

, Jones

, Ring

, McArdle

, Pembrey

, Strachan

, Dunger

, Twells

, Clayton

, Todd

. 2005. Localization of a type 1 diabetes locus in the IL2RA/CD25 region by use of tag single-nucleotide polymorphisms. Am J Hum Genet, 76:773–779.

31.

Brand

, Lowe

, Heward

, Franklyn

, Cooper

, Todd

, Gough

. 2007. Association of the interleukin-2 receptor α (IL-2Rα)/CD25 gene region with Graves' disease using a multilocus test and tag SNPs. Clin Endocrinol (Oxf ), 66:508–512.

32.

Wellcome Trust Case Control Consortium. 2007. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature, 447:661–678.

33.

Hafler

, Compston

, Sawcer

, Lander

, Daly

, De Jager

, de Bakker

, Gabriel

, Mirel

, Ivinson

, Pericak-Vance

, Gregory

, Rioux

, McCauley

, Haines

, Barcellos

, Cree

, Oksenberg

, Hauser

. 2007. Risk alleles for multiple sclerosis identified by a genomewide study. N Engl J Med, 357:851–862.

34.

Kawasaki

, Awata

, Ikegami

, Kobayashi

, Maruyama

, Nakanishi

, Shimada

, Uga

, Kurihara

, Kawabata

, Tanaka

, Kanazawa

, Eguchi

. Japanese Study Group on Type 1 Diabetes Genetics. 2009. Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese population. J Clin Endocrinol Metab, 94:947–952.

35.

Dynacom SNPAlyze program. 2010. www.dynacom.co.jp/e/products/package/snpalyze/.

36.

Cohen

, Dadi

, Shaoul

, Sharfe

, Roifman

. 1999. Cloning and characterization of a lymphoid-specific, inducible human protein tyrosine phosphatase. Lyp. Blood, 93:2013–2024.

37.

Cloutier

, Veillette

. 1999. Cooperative inhibition of T-cell antigen receptor signaling by a complex between a kinase and a phosphatase. J Exp Med, 189:111–121.

38.

Hill

, Zozulya

, Lu

, Ward

, Gishizky

, Jallal

. 2002. The lymphoid protein tyrosine phosphatase Lyp interacts with the adaptor molecule Grb2 and functions as a negative regulator of T-cell activation. Exp Hematol, 30:237–244.

39.

Lee

, Rho

, Choi

, Ji

, Song

, Nath

, Harley

. 2007. The PTPN22 C1858T functional polymorphism and autoimmune diseases: a meta-analysis. Rheumatology (Oxf ), 46:49–56.

40.

Ichimura

, Kaku

, Fukutani

, Koga

, Mukai

, Miyake

, Yamada

, Koda

, Hiromatsu

. 2008. Associations of protein tyrosine phosphatase nonreceptor 22 (PTPN22) gene polymorphisms with susceptibility to Graves' disease in a Japanese population. Thyroid, 18:625–630.

41.

Orrú

, Tsai

, Rueda

, Fiorillo

, Stanford

, Dasgupta

, Hartiala

, Zhao

, Ortego-Centeno

, D'Alfonso

. Italian Collaborative Group. Arnett

, Wu

, Gonzalez-Gay

, Tsao

, Pons-Estel

, Alarcon-Riquelme

, He

, Zhang

, Allayee

, Chen

, Martin

, Bottini

. 2009. A loss-of-function variant of PTPN22 is associated with reduced risk of systemic lupus erythematosus. Hum Mol Genet, 18:569–579.

42.

Onengut-Gumuscu

, Buckner

, Concannon

. 2006. A haplotype-based analysis of the PTPN22 locus in type 1 diabetes. Diabetes, 55:2883–2889.