Association of Toll-Like Receptor 10 Polymorphisms with Autoimmune Thyroid Disease in Korean Children

Abstract

Background:

The Toll-like receptors (TLRs) are germline-encoded receptors that play an essential role in initiating the immune response against pathogens. In this study, we assess the association of TLR polymorphism with autoimmune thyroid disease (AITD) in Korean children.

Methods:

We investigated three polymorphisms in the TLR10 gene (rs4129009, rs11096956, and rs10004195) in 85 Korean AITD patients (Graves' disease, [GD]=50, Hashimoto's disease [HD]=35; thyroid-associated ophthalmopathy [TAO]=23, non-TAO=62; male=16, female=69; mean age=13.4±3.1 years) and 279 healthy control subjects.

Results:

In patients with AITD, the frequencies of the TLR10 rs4129009 A allele (odds raio [OR]=3.9, corrected p=0.04) and rs10004195 T allele (OR=2.8, corrected p=0.02) were higher than in the healthy controls, whereas the TLR10 rs4129009 GG genotype (OR=0.3, corrected p=0.04) and rs10004195 AA genotype (OR=0.4, corrected p=0.02) showed lower frequencies. The TLR10 rs11096956 did not show any significant association. These significant associations were also found in the non-thyroid–associated ophthalmopathy (TAO) group, but not in the TAO group. The haplotype (AGT) frequency of TLR10 rs4129009, rs11096956, and rs10004195 was higher in the AITD group than in healthy controls (OR=2.1, corrected p=0.03).

Conclusions:

Our results suggest that TLR10 polymorphisms may contribute to the pathogenesis of AITD.

Introduction

Autoimmune thyroid disease (AITD) is the most common of all autoimmune disorders, affecting 1.5% of the population (1). AITD comprises two main clinical entities: Graves' disease (GD) and Hashimoto's disease (HD). AITD may occur when genetically susceptible individuals are exposed to environmental modulating triggers such as infection, iodine, or stress (2). Thyroid-associated ophthalmopathy (TAO) is a common inflammatory autoimmune disease of the orbit, which is closely associated with GD and sometimes occurs in patients with HD (3).

Recently, innate immunity has become a central focus in immunologic pathogenesis of AITD. Toll-like receptors (TLRs) recognize a wide variety of pathogen-associated molecular patterns (PAMPs) such as bacteria, viruses, fungi, and certain host-derived molecules (4). TLRs enable the innate immune system and induce an appropriate cascade of effector responses. TLRs are type I transmembrane glycoproteins with an extracellular domain composed of numerous leucine-rich repeats and an intracellular region containing a Toll IL-1 receptor (TIR) homology domain (5). Among the 10 TLRs, the functions and biologic role of TLR 1 to 9 have been well characterized (6,7). TLR10 is the most recently reported receptor and the only human TLR that has no known data concerning it's ligands or cellular location (8). The TLR10 gene is clustered together with TLR1 and TLR6 on chromosome 4p14 and was shown to be able to homodimerize and heterodimerize with TLR1 and TLR2 (9). TLR10 may potentially act as a TLR2 coreceptor (9).

TLRs are major factors in the pathogenesis of inflammatory disease, injury, and cancers. Previous disease association studies have revealed a role for TLRs in the development of chronic inflammatory disease including systemic lupus erythematosus (SLE), Crohn's disease, type 1 diabetes, and rheumatoid arthritis (6). The TLR10 rs4129009 showed associations with prostate cancer (10) and asthma (11) and TLR10 rs10004195 showed an association with IgA nephropathy (12).

Recently, TLRs including TLR3 and TLR4 have been described on thyrocytes and are reported to be associated with thyroid autoimmune or inflammatory disease (13,14). In addition, TLR9 single nucleotide polymorphisms (SNPs) have been reported to be associated with TAO in Taiwanese males (15). However, to the best of our knowledge, there have been no reports on possible associations with TLR10 polymorphisms and AITD. In the present work, we investigate the potential association between TLR10 SNPs and AITD in Korean children.

Methods

Subjects

The present study included 85 patients diagnosed with AITD (35 HD; 50 GD) who were treated in the pediatric endocrine clinic at Seoul St. Mary's Hospital and Yeouido St. Mary's Hospital between March 2009 and January 2013. Sixty-one of these patients were also included in a previous study by our research group (16). Age of patients at enrollment of the study was 13.4±3.1 years and age at diagnosis of AITD was 11.5±2.9 years. Among 35 HD patients, 21 patients were hypothyroid on thyroxine (T4) replacement and 9 patients showed an euthyroid state with thyroid antibodies alone (Table 1).

Table 1.

Characteristics of Eighty-Five Autoimmune Thyroid Disease Patients

Characteristics
Sex (F/M)	69/16
Age (years) at diagnosis	11.5±2.9
Age (years) at enrollment	13.4±3.1
HD/GD	35/50
HD condition at diagnosis
Euthyroid state	9 (25.7%)
Subclinical hypothyroid state	2 (5.7%)
Overt hypothyroid state	20 (57.1%)
Hyperthyroid state	4 (11.4%)
HD patients on T4 replacement	21 (60%)
Class of TAO
0–1 No sign–only sign	62
2 soft tissue involvement	6
3 Proptosis	14
4 Extraocular muscle involvement	3
5 Corneal involvement	0
6 Sight loss	0

HD, Hashimoto's disease; GD, Graves' disease; T4, thyroxine; TAO, thyroid-associated ophthalmopathy.

For comparison, 279 genetically unrelated healthy Korean adults without a history of AITD were studied as a control group. The control subjects consisted mainly of staff and students from the Medical College of the Catholic University of Korea and hematopoietic stem cell transplantation (HSCT) donor volunteers at the Catholic HSCT center. All subjects gave informed consent for a genetic study. The Institutional Review Board of the Catholic University of Korea approved our study.

HD was diagnosed when at least three of the following criteria established by Fisher et al. (17) were met: (i) goiter, (ii) diffuse goiter and decreased radionuclide uptake during thyroid scan, (iii) presence of either circulating thyroglobulin or microsomal autoantibodies, and (iv) hormonal evidence of hypothyroidism. The diagnosis of GD was based on the confirmation of clinical symptoms and the biochemical confirmation of hyperthyroidism, including the diagnosis of goiter, elevated thyroid ¹³¹I uptake, the presence of antibodies reactive against the thyrotropic receptor, and elevated thyroid hormone levels. Patients with other forms of autoimmune diseases, hematologic diseases, or endocrine diseases were excluded. The diagnosis of TAO was based on the presence of typical clinical features and was classified according to the criteria set by the American Thyroid Association (18,19). Patients with no symptoms or with only the lid lag sign were considered non-TAO, whereas those with soft tissue changes, proptosis, or extraocular muscle dysfunction, or both were considered to have a disease of the eye (20).

DNA extraction

Genomic DNA was extracted from 4 mL of peripheral blood mixed with ethylenediaminetetraacetic acid (EDTA) using the AccuPrep DNA extraction Kit (Bioneer, Daejeon, Republic of Korea): 20 μL of proteinase K and 200 μL of lysis buffer (200 mM Tris-HCl, 25 mM EDTA, 300 mM NaCl, 1.2% sodium dodecyl sulfate) were added to the peripheral blood leukocytes. The mixture was incubated at 60°C for 10 min. The lysate was extracted with an equal volume of isopropanol, and 500 μL of washing buffer with ethanol added. The pellet was dried and suspended in 200 μL of sterile distilled water. DNA extracts were stored at −20°C.

Restriction fragment length polymorphism analysis of TLR

We used the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to characterize polymorphisms of the TLR genes. We designed new primers for the detection of gene polymorphisms. The specific sequences of designed primer pairs and the restriction enzymes used are listed in Table 1. PCR amplifications were performed in 20 μL of reaction mixtures in 96-well thin-walled trays (Nippon Genetics, Tokyo, Japan). The reaction mixtures consisted of 1.5–2.0 μM target-specific primers, 0.1 μg genomic DNA, 10× buffer (50 mM KCL, 10 mM Tris-HCL pH 9.0, 1.5 mM MgCl₂, 0.1% Triton X-100), 200 μM of each dNTP (Roche, Mannheim, Germany), and 0.25 units of Taq polymerase (Intron Biotechnology, Seongnam, Republic of Korea). A MyCycler Thermalcycler (Bio-Rad Inc., Hercules, CA) was used to perform PCR as follows: initial denaturation at 95°C for 5 min; 30 cycles of denaturation at 95°C for 30 sec, annealing at 55–60°C (slight variations with different primer sets) for 30 sec, elongation at 72°C for 1 min, and final extension at 72°C for 10 min. The PCR products were digested with a specific restriction enzyme overnight at 37°C, and were separated by electrophoresis in 3% agarose gel stained with ethidium bromide. The primer sequences for each TLR SNP are shown in Table 2.

Table 2.

Primer Sequences for Each Single Nucleotide Polymorphism

Gene	SNP		Primer sequence
TLR10	rs4129009	F	CTTACTGGAACCCATTCCATTCTATTGC
		R	TCAATGTACATCCCAACAGTGTATGTGG
	rs11096956	F	AGTTGATTT ACTCTGGGAC GACC
		R	CTGTTAAGATATTATTGGCAAAATTTAAATATTGGAATTTCGTAGGAGAA
	rs10004195	F	AAAGCTAAGGTTCTTACCCCACG
		R	AAGATGGTGAGCATGATAACTCCTATGTTATGTGTATTTGACCACAAGTT

SNP, single nucleotide polymorphism.

Statistical analysis

Allele frequencies were estimated by direct counting. Fisher's exact test was applied when the expected frequency was less than 5. We multiplied the p value by the number of alleles observed to give a corrected p value that accounts for the multiple comparisons we performed. A corrected p value of <0.05 was considered statistically significant. We used Haldane's formula correction when critical entries were zero. Linkage disequilibrium (LD) blocks were established with the Haploview program (Haploview 4.2) and are shown in Figure 1. Hardy-Weinberg equilibrium (HWE) in controls was analyzed for each SNP using SNPStats on the website (http://bioinfo.iconcologia.net/snpstats/start.htm) and for the Korean controls, all genotyped SNPs fit the Hardy-Weinberg equilibrium (p>0.05). The haplotypes were analyzed using SNPStats and haplotypes frequencies are estimated using the implementation of the EM algorithm (21).

FIG. 1.

Linkage disequilibrium (LD) blocks of single nucleotide polymorphisms in TLR10 genes. Boxes are colored deep red if the D′ values are high, which means LD is strong. Color images available online at www.liebertpub.com/thy

Results

The genotype and allele frequencies of the SNPs in the TLR10 gene in controls and patients with thyroid disease are presented in Table 3. In patients with AITD, the frequencies of the TLR10 rs4129009 A allele (OR=3.9 [1.4–11.2], corrected p=0.04) and rs10004195 T allele (OR=2.8 [1.4–5.6], p=0.004, corrected p=0.02) was higher than in controls. However, the TLR10 rs4129009 GG genotype (OR=0.3 [0.1–0.7], p=0.007, corrected p=0.04) and rs10004195 AA genotype (OR=0.4 [0.2–0.7], p=0.004, corrected p=0.02) showed lower frequencies than controls. The TLR10 rs11096956 did not show any significant association.

Table 3.

Frequencies of Genotype and Allele of TLR10 Genes in Controls and Patients with Thyroid Disease

			Controls	AITD	GD	HD	TAO	Non-TAO
Gene	SNP	Genotype	n=279 (%)	n=85 (%)	n=50 (%)	n=35 (%)	n=23 (%)	n=62 (%)
TLR10	(+2322)	AA	96 (34.4%)	34 (40%)	20 (40%)	14 (40%)	8 (34.8%)	26 (41.9%)
	rs4129009	AG	138 (49.5%)	47 (55.3%)	27 (54%)	20 (57.1%)	13 (56.5%)	34 (54.8%)
		GG	45 (16.1%)	4 (4.7%)^a	3 (6%)	1 (2.9%) ^g	2 (8.7%)	2 (3.2%)^m
		A	234 (83.9%)	81 (95.3%)^b	47 (94%)	34 (97.1%)^h	21 (91.3%)	60 (96.8%)ⁿ
		G	183 (65.6%)	51 (60%)	30 (60%)	21 (60%)	15 (65.2%)	36 (58.1%)
	(C. 1032)	GG	51 (18.3%)	22 (25.9%)	12 (24%)	10 (28.6%)	3 (13%)	19 (30.6%)^o
	rs11096956	GT	132 (47.3%)	42 (49.4%)	25 (50%)	17 (48.6%)	14 (60.9%)	28 (45.2%)
		TT	96 (34.4%)	21 (24.7%)	13 (26%)	8 (22.9%)	6 (26.1%)	15 (24.2%)
		G	183 (65.6%)	64 (75.3%)	37 (74%)	27 (77.1%)	17 (73.9%)	47 (75.8%)
		T	228 (81.7%)	63 (74.1%)	38 (76%)	25 (71.4%)	20 (87%)	43 (69.3%)^p
	(−113)	AA	75 (26.9%)	10 (11.8%)^c	7 (14%)	3 (8.6%)ⁱ	4 (17.4%)	6 (9.7%)^q
	rs10004195	AT	150 (53.8%)	48 (56.5%)	28 (56%)	20 (57.1%)	14 (60.9%)	34 (54.8%)
		TT	54 (19.4%)	27 (31.8%)^d	15 (30%)	12 (34.3%)^j	5 (21.7%)	22 (35.5%)^r
		A	225 (80.6%)	58 (68.2%)^e	35 (70%)	23 (65.7%)^k	18 (78.3%)	40 (64.5%)^s
		T	204 (73.1%)	75 (88.2%)^f	43 (86%)	32 (91.4%)^l	19 (82.6%)	56 (90.3%)^t

Normal vs. AITD: ^aOR=0.3 (0.1–0.7), p=0.007, corrected p=0.04; ^bOR=3.9 (1.4–11.2), p=0.007, corrected p=0.04; ^cOR=0.4 (0.2–0.7), p=0.004, corrected p=0.02; ^dOR=1.9 (1.1–3.3), p=0.02; ^eOR=0.5 (0.3–0.9), p=0.01; ^fOR=2.8 (1.4–5.6), p=0.004, corrected p=0.02.

Normal vs. HD: ^gOR=0.2 (0.02–1.1), p=0.04; ^hOR=6.5 (0.9–49.0), p=0.04; ⁱOR=0.3 (0.08–0.9), p=0.02; ^jOR=2.2 (1.1–4.6), p=0.04; ^kOR=0.5 (0.2–1.0), p=0.04; ^lOR=3.9 (1.2–13.2), p=0.02.

Normal vs. non-TAO: ^mOR=0.2 (0.04–0.7), p=0.008, corrected p=0.048; ⁿOR=5.8 (1.4–24.5), p=0.008, corrected p=0.048; ^oOR=2.0 (1.1–3.7), p=0.03; ^pOR=0.5 (0.3–0.9), p=0.03; ^qOR=0.3 (0.1–0.7), p=0.004, corrected p=0.02; ^rOR=2.3 (1.3–4.2), p=0.006, corrected p=0.04; ^sOR=0.4 (0.2–0.8), p=0.006, corrected p=0.04; ^tOR=3.4 (1.4–−8.3), p=0.004, corrected p=0.02.

OR, odds ratio; AITD, autoimmune thyroid diseases; HD, Hashimoto disease; GD, Graves' disease; TAO, thyroid associated ophthalmopathy.

These significant associations were also found in the non-TAO group but not in patients with TAO. For patients in the non-TAO group, the frequencies of the TLR10 rs4129009 A allele (OR=5.8 [1.4–24.5], corrected p=0.048), rs10004195 TT genotype (OR=2.3 [1.3–4.2], p=0.006, corrected p=0.04) and T allele (OR=3.4 [1.4–8.3], p=0.004, corrected p=0.02) were higher than in controls. In contrast, the TLR10 rs4129009 GG genotype (OR=0.2 [0.04–0.7], p=0.008, corrected p=0.048), rs10004195 AA genotype (OR=0.3 [0.1–0.7], p=0.004, corrected p=0.02) and A allele (OR=0.4 [0.2–0.8], p=0.006, corrected p=0.04) showed lower frequencies. TLR10 rs11096956 did not show any significant association. Between the TAO and non-TAO groups, there were no significant differences in the frequencies of genotypes or alleles in the TLR10 gene.

When categorized by disease subgroup (GD or HD), there were no significant differences in the frequencies of genotype and allele in the TLR10 gene compared to controls. Between GD and HD patients, there were no significant differences in the frequencies of genotype or allele in the TLR 10 gene.

The rs4129009 and rs11096956 SNPs were found to be in strong linkage disequilibrium (D′=1.0, r ²=0.499; Fig. 1). The haplotype frequencies of the TLR 10 gene in patients with AITD and controls are shown in Table 4. The haplotype (AGT) frequency of TLR10 rs4129009, rs11096956, and rs10004195 was higher in AITD than in controls (OR=2.1 [1.3–3.4], p=0.004, corrected p=0.03). However, we did not find any differences between other haplotypes and AITD.

Table 4.

TLR10 Haplotype Frequencies Identified in Controls and Autoimmune Thyroid Disease Patients

	Controls	AITD
Haplotype (+2322/C.1032/−113)	n=279 (%)	n=85 (%)
GTA	97 (34.8%)	27 (31.8%)
AGT	84 (30.0%)	40 (47.1%)^a
ATT	29 (10.3%)	11 (12.9%)
AGA	33 (11.9%)	3 (3.5%)
ATA	20 (7.0%)	4 (4.7%)
GTT	16 (6.0%)	0 (0%)
GGA	0 (0%)	0 (0%)

Normal vs. AITD:

OR=2.1 (1.3–3.4), p=0.004, corrected p=0.03.

AITD, autoimmune thyroid diseases; OR, odds ratio.

Discussion

According to previous genetic studies, variations in genes involving adaptive immunity including HLA class II, cytotoxic T cell antigen-4, CD40 and protein tyrosine phosphatase-22 have been considered to be major factors associated with the development of AITD. Moreover, recently published articles have focused on possible connections between the innate immune system including interferon-α, CD1, and TLR and the genetics of AITD (7). More recently, genome-wide association studies (GWAS) have been conducted to identify genes that confer susceptibility for the development of AITD (22 –24).

In Korean children with AITD, we observed increased allele frequencies of HLA-B*46, -DRB1*08 and -Cw*01 and also reported an increased frequency of the MICA*010 allele (16,25). The statistical significance found in our previous results in children are stronger than results conducted in Korean adults (26) and the highly significant p value might suggest that early onset AITD is more strongly influenced by genetic factors than late onset. In the present study we found for the first time an association between TLR10 SNPs and AITD.

Little information on a possible biologic function of the TLR10 rs10004195 SNP (c. −113T>A) is available. The TLR10 rs4129009 SNP (c. +2322A>G) has been reported to introduce a change from isoleucine to valine at amino acid position 775 in the TLR10 protein, which is in the cytoplasmic TIR domain of the protein (11). A change in this region could participate in the transduction of extracellular signaling and provide a plausible basis for an effect on TLR10 signaling (27).

The underlying mechanism of the roles and expression profiles of TLR in AITD are still unclear. TLRs were reported to affect the pathogenesis of chronic inflammatory lung disease including asthma (11,28,29). The interactions between TLRs and hyaluronan degradation products generated after tissue injury might have a role in regulating lung injury (28). Hyaluronan is a nonsulfated glycosaminoglycan composed of repeating disaccharide structures with features of PAMPs and very abundant in the thyroid glands of patients with AITD (30). Therefore, hyaluronan fragments could support a TLR mediated pathway and induce gene expression in a variety of cell types and may initiate inflammatory responses. In both GD and HD, hyaluronan accumulates in connective tissues, although the mechanism for deposition and tissue distribution differs in each case (31). Based on previous evidence, we suspected that our current findings, which show that TLR10 SNPs are associated with AITD, might be explained by the interaction between TLRs and hyaluronan in thyroid tissue, with a similar process as in asthma.

Interestingly, the T allele of the TLR10 rs11466653 polymorphism has been associated with small tumor size PTC in the Korean population (32,33). The significant association between the TLR10 rs11466653 polymorphism and AITD in this study is consistent with previous reports, which showed an association of TLR10 with PTC. We suspect that the role of TLRs in certain cancers might be a key to understanding the function of TLRs in the pathogenesis of AITD.

Because of their capacity to induce a potent inflammatory response, TLRs play a major role in driving tumorigenesis. TLR-dependent mechanisms contribute to activation of the effectors of innate immunity, thereby augmenting the adaptive immune response to cancers (34). The inflammatory response has an important role in maintaining and promoting cancer development, and specific inflammatory conditions have been associated with certain cancers. An association between HD and papillary thyroid cancer has also been reported (35). HD was reported to be associated with PTC as was chronic inflammation of other organ with certain cancer (36).

Our report suggests a possible relation between the SNPs of TLR10 rs10004195, and rs4129009 and the pathogenesis of AITD and non-TAO patients. The data presented here suggest that innate immunity may contribute to the pathogenesis of AITD. However, there are limitations in our study such as the small sample size and the low power. Studies with ethnically diverse populations including large numbers of patients are needed to confirm the role of TLRs in AITD.

Footnotes

Acknowledgments

This study was supported by a grant of the Korean Health Technology R&D Project, Ministry for Health & Welfare, Republic of Korea (HI09C1555).

Author Disclosure Statement

No competing financial interests exist.

References

Jacobson

, Gange

, Rose

, Graham

. 1997. Epidemiology and estimated population burden of selected autoimmune diseases in the United States. Clin Immunol Immunopathol, 84:223–243.

Tomer

, Davies

. 2003. Searching for the autoimmune thyroid disease susceptibility genes: from gene mapping to gene function. Endocr Rev, 24:694–717.

Bahn

. 2010. Graves' ophthalmopathy. N Engl J Med, 362:726–738.

Beutler

. 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature, 430:257–263.

Ulevitch

. 2004. Therapeutics targeting the innate immune system. Nat Rev Immunol, 4:512–520.

Drexler

, Foxwell

. 2010. The role of toll-like receptors in chronic inflammation. Int J Biochem Cell Biol, 42:506–518.

Caturegli

, Kimura

, Rocchi

, Rose

. 2007. Autoimmune thyroid diseases. Curr Opin Rheumatol, 19:44–48.

Chuang

, Ulevitch

. 2001. Identification of hTLR10: a novel human Toll-like receptor preferentially expressed in immune cells. Biochim Biophys Acta, 1518:157–161.

Hasan

, Chaffois

, Gaillard

, Saulnier

, Merck

, Tancredi

, Guiet

, Briere

, Vlach

, Lebecque

, Trinchieri

, Bates

. 2005. Human TLR10 is a functional receptor, expressed by B cells and plasmacytoid dendritic cells, which activates gene transcription through MyD88. J Immunol, 174:2942–2950.

10.

Sun

, Wiklund

, Hsu

, Balter

, Zheng

, Johansson

, Chang

, Liu

, Li

, Turner

, Li

, Adami

, Isaacs

, Xu

, Gronberg

. 2006. Interactions of sequence variants in interleukin-1 receptor-associated kinase4 and the toll-like receptor 6-1-10 gene cluster increase prostate cancer risk. Cancer Epidemiol Biomarkers Prev, 15:480–485.

11.

Lazarus

, Raby

, Lange

, Silverman

, Kwiatkowski

, Vercelli

, Klimecki

, Martinez

, Weiss

. 2004. TOLL-like receptor 10 genetic variation is associated with asthma in two independent samples. Am J Respir Crit Care Med, 170:594–600.

12.

Park

, Hahn

, Suh

, Kim

, Kang

, Lee

, Kim

, Chung

, Cho

. 2011. Association between toll-like receptor 10 (TLR10) gene polymorphisms and childhood IgA nephropathy. Eur J Pediatr, 170:503–509.

13.

Harii

, Lewis

, Vasko

, McCall

, Benavides-Peralta

, Sun

, Ringel

, Saji

, Giuliani

, Napolitano

, Goetz

, Kohn

. 2005. Thyrocytes express a functional toll-like receptor 3: overexpression can be induced by viral infection and reversed by phenylmethimazole and is associated with Hashimoto's autoimmune thyroiditis. Mol Endocrinol, 19:1231–1250.

14.

Nicola

, Velez

, Lucero

, Fozzatti

, Pellizas

, Masini-Repiso

. 2009. Functional toll-like receptor 4 conferring lipopolysaccharide responsiveness is expressed in thyroid cells. Endocrinology, 150:500–508.

15.

Liao

, Chen

, Lin

, Liu

, Chen

, Tsai

, Wan

, Tsai

. 2010. Toll-like receptor gene polymorphisms are associated with susceptibility to Graves' ophthalmopathy in Taiwan males. BMC Med Genet, 11:154.

16.

Cho

, Jung

, Choi

, Kim

, Suh

. 2011. Association of HLA alleles with autoimmune thyroid disease in Korean children. Horm Res Paediatr, 76:328–334.

17.

Fisher

, Oddie

, Johnson

, Nelson

. 1975. The diagnosis of Hashimoto's thyroiditis. J Clin Endocrinol Metab, 40:795–801.

18.

Werner

. 1977. Modification of the classification of the eye changes of Graves' disease: recommendations of the Ad Hoc Committee of the American Thyroid Association. J Clin Endocrinol Metab, 44:203–204.

19.

Werner

. 1977. Modification of the classification of the eye changes of Graves' disease. Am J Ophthalmol, 83:725–727.

20.

Frecker

, Stenszky

, Balazs

, Kozma

, Kraszits

, Farid

. 1986. Genetic factors in Graves' ophthalmopathy. Clinical Endocrinol, 25:479–485.

21.

Sole

, Guino

, Valls

, Iniesta

, Moreno

. 2006. SNPStats: a web tool for the analysis of association studies. Bioinformatics, 22:1928–1929.

22.

Inoue

, Watanabe

, Yamada

, Takemura

, Hayashi

, Yamakawa

, Akahane

, Shimizuishi

, Hidaka

, Iwatani

. 2012. Associations between autoimmune thyroid disease prognosis and functional polymorphisms of susceptibility genes, CTLA4, PTPN22, CD40, FCRL3, and ZFAT, previously revealed in genome-wide association studies. J Clin Immunol, 32:1243–1252.

23.

Chu

, Pan

, Zhao

, Liang

, Gao

, Zhang

, Yuan

, Li

, Xue

, Shen

, Liu

, Xie

, Yang

, Wang

, Shi

, Sun

, Du

, Zuo

, Shi

, Liu

, Guo

, Zhan

, Gu

, Zhang

, Sun

, Wang

, Song

, Zou

, Sun

, Guo

, Cao

, Ma

, Han

, Li

, Jiang

, Huang

, Liang

, Liu

, Chen

, Su

, Peng

, Zhao

, Ning

, Chen

, Huang

, Song

. 2011. A genome-wide association study identifies two new risk loci for Graves' disease. Nat Genet, 43:897–901.

24.

Zhao

, Xue

, Liu

, Gu

, Pan

, Yang

, Zhan

, Wang

, Liang

, Gao

, Zhang

, Yuan

, Li

, Du

, Liu

, Chen

, Su

, Peng

, Zhao

, Ning

, Huang

, Liang

, Qi

, Chen

, Song

. 2013. Robust evidence for five new Graves' disease risk loci from a staged genome-wide association analysis. Hum Mol Genet, 22:3347–3362.

25.

Cho

, Jung

, Park

, Baek

, Choi

, Kim

, Suh

. 2012. Association of MICA alleles with autoimmune thyroid disease in Korean children. Int J Endocrinol, 2012:235680.

26.

Cho

, Rhee

, Lee

, Kim

, Lee

, Koh

, Min

, Lee

. 1987. HLA and Graves' disease in Koreans. Tissue Antigens, 30:119–121.

27.

Mayerle

, den Hoed

, Schurmann

, Stolk

, Homuth

, Peters

, Capelle

, Zimmermann

, Rivadeneira

, Gruska

, Völzke

, de Vries

, Völker

, Teumer

, van Meurs

JBJ

, Steinmetz

, Nauck

, Ernst

, Weiss

F-U

, Hofman

, Zenker

, Kroemer

, Prokisch

, Uitterlinden

, Lerch

, Kuipers

. 2013. Identification of genetic loci associated with Helicobacter pylori serologic status. JAMA, 309:1912–1920.

28.

Jiang

, Liang

, Fan

, Yu

, Chen

, Luo

, Prestwich

, Mascarenhas

, Garg

, Quinn

, Homer

, Goldstein

, Bucala

, Lee

, Medzhitov

, Noble

. 2005. Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nat Med, 11:1173–1179.

29.

Kormann

, Depner

, Hartl

, Klopp

, Illig

, Adamski

, Vogelberg

, Weiland

, von Mutius

, Kabesch

. 2008. Toll-like receptor heterodimer variants protect from childhood asthma. J Allergy Clin Immunol, 122:86–92, 92 e81–88.

30.

Mummert

. 2005. Immunologic roles of hyaluronan. Immunol Res, 31:189–206.

31.

Gianoukakis

, Jennings

, King

, Sheehan

, Hoa

, Heldin

, Smith

. 2007. Hyaluronan accumulation in thyroid tissue: evidence for contributions from epithelial cells and fibroblasts. Endocrinology, 148:54–62.

32.

Kim

, Park

, Hong

, Chung

, Eun

. 2013. A missense polymorphism (rs11466653, Met326Thr) of toll-like receptor 10 (TLR10) is associated with tumor size of papillary thyroid carcinoma in the Korean population. Endocrine, 43:161–169.

33.

Kim

, Park

, Kim

, Park

, Eun

, Kwon

, Kim

. 2012. Association of Toll-like receptor 2 polymorphisms with papillary thyroid cancer and clinicopathologic features in a Korean population. J Korean Med Sci, 27:1333–1338.

34.

Roses

, Xu

, Koski

, Czerniecki

. 2008. Radiation therapy and Toll-like receptor signaling: implications for the treatment of cancer. Oncogene, 27:200–207.

35.

Repplinger

, Bargren

, Zhang

, Adler

, Haymart

, Chen

. 2008. Is Hashimoto's thyroiditis a risk factor for papillary thyroid cancer?. J Surg Res, 150:49–52.

36.

Ahn

, Heo

, Park

, Kim

, Sohn

, Park

. 2011. Clinical relationship between Hashimoto's thyroiditis and papillary thyroid cancer. Acta Oncol, 50:1228–1234.