Abstract
To explore whether harbor seals (Phoca vitulina) are exposed to Bartonella spp., 35 seal lice (Echinophtirius horridus) were collected from seven seals, during their rehabilitation period in the Seal Rehabilitation and Research Center at Pieterburen, The Netherlands. Forty-eight spleen samples were collected during necropsies of other harbor seals that died during rehabilitation, or had stranded dead and were brought to the Seal Rehabilitation and Research Center for postmortem investigation. Lice were grouped into six pools, and DNA was extracted from each pool and from all the seals' spleen samples. One of the six lice pools and one spleen sample were found positive by high-resolution melt, real-time PCR amplifying partial loci of the rpoB gene, and the intergenic spacer (ITS) region. The Bartonella spp. identified in the spleen and lice were found to be identical to each other. One hundred percent sequence similarity with Bartonella henselae was found in the ITS, and 97% sequence similarity with Bartonella grahamii was detected in the rpoB gene. To the best of the authors' knowledge, this is the first report describing the detection of Bartonella spp. from a seal or any other pinniped, and from seal lice, E. horridus. The 100% sequence similarity in the ITS of the Bartonella sp. identified with the zoonotic B. henselae warrants further investigation and characterization of this organism, which may be found to be of public health importance.
Introduction
This study describes for the first time the detection of a Bartonella sp. in a harbor seal (Phoca vitulina), a marine mammal belonging to the pinnipedia superfamily, and in seal lice (Echynophtyrus horridus), sucking lice (Anoplura) that have been found on many pinniped species (Hopkins 1949, Kim et al. 1975).
Materials and Methods
Sample collection
Thirty-five lice were collected from seven harbor seals admitted to the Seal Rehabilitation and Research Center (SRRC), at Pieterburen, The Netherlands, for treatment and rehabilitation. Lice have undergone entomological classification and kept in 70% alcohol until further analyzed. Spleen samples were collected during necropsies of other 48 harbor seals that died during rehabilitation or had stranded dead. The spleen samples were kept frozen (−20°C) until further analyzed. Before delivery to the Israeli laboratory, the spleens were defrosted and soaked on a sterile filter paper; each sample was sealed in a separate zipped nylon bag until further DNA extraction.
DNA extraction
Lice were grouped in five pools of six lice and one pool of five lice. DNA was extracted separately from each pool. The lice were sliced to minute pieces by scalpel blade and DNA was extracted by DNA extraction kit (Illustra Tissue Mini Spin kit; GE Healthcare, Backinghamshire, United Kingdom) according to the manufacturer's instructions. DNA of spleen samples was extracted from the filter papers by the phenol chlorophorm method as previously described (Straubinger 2000).
High-resolution melt, real-time PCR analysis
Molecular diagnosis of Bartonella spp. was performed by high-resolution melt (HRM), real-time PCR analysis targeting two partial loci, the rpoB gene and the 16S–23S ribosomal RNA intergenic spacer (ITS) region: a 192 bp fragment of ITS using primers h493as (TGA ACC TCC GAC CTC ACG CTT ATC) and 321s (AGA TGA TGA TCC CAA GCC TTC TGG) (Maggi and Breitschwerdt 2005), and a 202 bp fragment of rpoB gene using primers 800r (CGA TTC GCA TCA TCA TTT TC) and 600f (CGTGCAACAGAAGATTTAGATC). Real-time PCR followed by HRM was carried out using the Rotor Gene 6000 (Corbett Research, Sydney, Australia) for 15 min at 95°C followed by 50 cycles of 5 s at 95°C, 30 s at 57°C (fluorescence acquisition on HRM channel), and 1 s at 76°C. The melting phase started at 60°C, each step rising by 1°C (fluorescence acquisition on the HRM channel), and finished at 95°C with hold of 90 s on the first step and 1 s in the next steps. Hybridization started on 90°C and fell to 50°C by 1°C each step. The HRM phase ramp ranged between 73°C and 90°C with 0.2°C increments. PCR reactions were performed in 20 μL reaction volume containing 2 μL of DNA, 2 μL of each primer, 0.6 μL cyto9, 3.4 μL DDW, and 10 μL of Thermo-Start PCR Master Mix (Thermo Scientific, Surrey, United Kingdom). Two control samples containing all the ingredients of the reaction except DNA were used for all trials. Positive amplicons were purified using PCR purification kit (ExoSAP- IT; USB, Cleveland, OH). DNA sequencing was carried out utilizing the BigDye Terminator cycle sequencing chemistry from Applied Biosystems (ABI), ABI 3700 DNA Analyzer, and the ABI's Data Collection and Sequence Analysis software. Further analysis was done using the Sequencher software, version 4.8, for Mac (Gene Codes, Ann Arbor, MI).
Results
All lice examined were classified as E. horridus. One pool of six lice and one spleen sample were found positive for Bartonella spp. by the HRM real-time PCR analysis in the two loci that were tested. The partial sequences of the ITS and rpoB gene were analyzed and deposited in GenBank (accession numbers: ITS, FJ605499; rpoB, FJ605498). Comparison of the two partial loci sequences indicated that the Bartonella found in the lice pool was identical to the Bartonella found in the spleen sample. Both had 100% sequence similarity to B. henselae (accession number DQ529247) in the ITS locus, and 97% sequence similarity to Bartonella grahamii (strain B12509; accession number AB426702) in the rpoB gene.
The medical record of the seal that was found positive for Bartonella DNA was examined. It was found to be an 8.3-kg, few-week-old male pup, which was found stranded on the beach. On arrival to the SRRC it was cachectic and dehydrated. After 11 days in the rehabilitation center the seal died and undergone necropsy. Gross pathology findings included consolidation of large portions of its lungs and presence of foam and fluids in its trachea and main bronchi; its thymus appeared to be small, and the adrenal cortex seemed to be narrow. Histopathological examination of the lungs revealed acute interstitial pneumonia, which was diagnosed as the cause of death. PCR for Herpes and Morbili viruses was performed on tissue samples from the lungs, liver, spleen, brain, kidney, and bladder, and the results were all negative.
Discussion
We report here the first detection of Bartonella sp. from the harbor seal (P. vitulina) and the same Bartonella sp. from seal lice (E. horridus). In two recent publications, Bartonella sp. DNA was detected in cetacean's blood: B. henselae sa2 in bottlenose dolphin (Tursiops truncatus), B. henselae h1 in Risso's dolphins (Grampus griseus), and B. henselae in two harbor porpoises (P. phocoena) (Maggi et al. 2005, Harms et al. 2008). In another recent article, two B. henselae strains were identified in beluga whales (Delphinapterus leucas) (Maggi et al. 2008). The clinical importance of Bartonella spp. in determining marine mammals' population health status and their zoonotic potential is yet to be fully elucidated. If they are found to be zoonotic, they will be added to other zoonotic agents found in marine mammals such as Brucella pinnipediae in pinnipeds (Godfroid et al. 2005) and Toxoplasma gondii, Neospora caninum, and Sarcocystis neurona in several marine mammal species (Dubey et al. 2003).
The seal louse is one of the few arthropods that successfully adjusted to the marine environment. Special adaptations must evolve in the louse to fit the diving habits of their host (Leidenberger et al. 2007). It is rarely found on healthy seals but is frequently found on weak young seals (Leidenberger et al. 2007), which probably spend less time in diving activity. The seal louse was suggested to serve as an intermediate host transmitting the heartworm Acanthocheilonema spirocauda (Leidenberger et al. 2007). Different stages of A. spirocauda larvae were found in dissected E. horridus lice (Geraci et al. 1981). In the current study we found Bartonella sp. DNA in seal lice that was identical to the Bartonella sp. found in a spleen of a seal. This finding suggests that E. horridus lice might play a role in transmitting a Bartonella sp. closely related to B. henselae and B. grahamii according to the sequence similarity of the partial loci amplified. No lice were detected on the seal that was found to be positive for the Bartonella sp. However, due to the minute size of the lice it has to be considered that a single louse or a few lice might have been overlooked.
In our study we targeted two partial loci: the ITS region and the rpoB gene. The two loci are suitable for discrimination between different Bartonella spp. (La ScoLa et al. 2003). For better characterization of this Bartonella sp., isolation and further molecular analyses are needed. The 100% sequence similarity of the Bartonella sp. identified with the pathogenic zoonotic B. henselae in the ITS region warrants further investigation and characterization of this organism, which may be found to be of public health and/or of marine mammals' clinical importance.
It is unclear whether Bartonella spp. infection played a role in the clinical and pathological manifestations that eventually caused the death of the Bartonella-positive seal. As no lice were found on this seal on its admission to the SRRC and due to its young age, intrauterine transmission of Bartonella from its mother cannot be ruled out. Bartonella spp. isolated from embryonic and neonatal rodents suggests that intrauterine transmission of this organism can occur in natural hosts (Kosoy et al. 1998).
In conclusion, this is the first report describing the detection of Bartonella spp. from a harbor seal (P. vitulina), or any other pinniped, and from seal lice (E. horridus), suggesting the role of the latter in the transmission of the Bartonella sp. identified. The findings of this study warrant further investigation and characterization of this organism to determine its importance for humans' and marine mammals' health.
Footnotes
Acknowledgments
The authors would like to thank Mrs. Lenie 't Hart and all the dedicated personnel in the SRRC for their admirable work in saving seals' lives.
Disclosure Statement
No competing financial interests exist.