Analysis of an Outbreak of Human Rabies in 2009 in Hanzhong District,Shaanxi Province,China

Abstract

Between March and August 2009, there was an outbreak of rabies in both humans and dogs in Hanzhong District, Shaanxi province, China. About 7300 humans were bitten by dogs and 20 died of rabies due to failure to perform postexposure prophylaxis. The local authorities therefore conducted a dog slaughter campaign. From a random selection of brains of dogs culled in the campaign, 0/27 tested positive for rabies virus by immunofluorescence. Of two dogs known to have bitten humans, one was shown to contain live rabies virus by immunofluorescence and mouse intracerebral inoculation. Serological studies during the outbreak revealed that only 1/27 dog was antibody positive: after a mass vaccination campaign, 20.8% seroconverted. Lack of canine vaccination was clearly the main reason for dog rabies spread and human infection. Phylogenetic analysis of a virus isolate showed that its genomic sequence was closely related to the clade 1 rabies strains widely circulating in China. The highest homology was found with the isolate circulating in Sichuan province, a neighboring province south of Shaanxi, indicating the spread of rabies from the south to the north.

Introduction

R abies is recognized as one of the oldest human diseases, and the outcome of infection is almost invariably fatal (Dietzschold et al. 1996). Rabies virus is neurotropic and is usually transmitted by the bite of a rabid carnivore (Constantine 1962, World Health Organization Expert Consultation on Rabies 2004). Rabies virus spreads widely among unvaccinated dogs in the developing countries of Africa and Asia, and dogs are the main vector for human rabies in these countries (World Health Organization Expert Consultation on Rabies 2004). When the vaccination coverage in dogs exceeds 70%, the spread of the virus in dog populations is impeded sufficiently for prevention of major outbreaks of rabies (Coleman and Dye 1996). With <70% coverage, however, the spread of rabies in dogs becomes difficult to control and spillover to humans becomes highly possible.

From March to August 2009, there was an outbreak of rabies in the human population of Hanzhong District, Shaanxi province, China. Hanzhong district (HZ) (Fig. 1) has a human population of 3.78 millions, with 0.30 millions living in urban area and 3.48 millions in rural areas. From February to the end of August 2009, about 7300 people were bitten by dogs, which was two to three times higher than the normal, and 20 died of rabies. These were distributed as follows: two in Hantai (Hanzhong city); two in Nanzheng county, close to Hantai; five in Chenggu county; six in Yangxian county; and five in Xixiang county, the last three counties being further from Hantai and all in rural areas. The exposure rate and the incidence among the exposurers over these 5 months were on average 193/100,000 and 0.26%, respectively. This outbreak triggered slaughter of dogs in a city-run campaign, conducted by dog-beating squads killing any dog spotted on the street, whether owned or stray. The number of dogs in Hanzhong District, Shaanxi province, was estimated to be 408,000, according to the official statistics and on-spot investigation, with a dog:human ratio of 1.079:10. Stray dogs accounted for about 10%, and up to 90% of the owned dogs were not leashed. To the end of June 2009, about 41,000 stray dogs, including some unleashed and roaming dogs, were culled due to the epizootic of rabies, which led to an outcry from animal welfare groups and the local public (www.netnewspublisher.com/36000-dogs-culled-in-hanzhong-city-china/, www.animalsasia.org/index.php?UID=7T86V8MF1A8, www.lizardmarsh.net/2009/06/hanzhong-china-dog-massacre-30000-dead.html, www.wspa-international.org/latestnews/2009/update_hanzhong_dog_cull_ends.aspx). However, the number of cases of animal rabies is not clear since a surveillance system on dog rabies does not exist at either national level or local level. In Hanzhong, human rabies last occurred between 1985 and 1992. At that time it was reported that a rabid dog from Guangyuan (GY, Fig. 1), Sichuan province, entered into Ningqiang county of Hanzhong district in 1985, and bit local dogs, leading to an outbreak during which 50 humans died of rabies. Local government responses resulted in 274,639 dogs being vaccinated and 77,709 stray dogs being culled. More than 10,000 individuals received postexposure treatment. There were no further reports of human cases until the present outbreak.

FIG. 1.

Hanzhong rabies outbreak against the background of rabies epidemic status in different provinces or areas in mainland China in 2008. The black shade indicates the most recent outbreak of human and animal rabies in Hanzhong district, Shaanxi province. The shades from pink to red indicate the epidemic extent of rabies in different provinces. HZ, Hangzhong district; GY, Guangyuan district in Sichuan province; BZ, Bazhong district in Sichuan province.

Hanzhong district is situated in a basin surrounded by mountains and hills. Its south borders Sichuan province, the only province neighboring Hanzhong with enzootic rabies. In 2008, 12 human rabies cases in Bazhong district (BZ, Fig. 1), Sichuan province, were reported to Centers for Disease Control (CDCs), among which 7 occurred in Tongjiang county, the closest to Xixiang county, Hanzhong, Shaanxi province.

Here, to further understand this outbreak of rabies, we collected and assayed the dog samples, and analyzed the causes of this outbreak of human rabies as well as the origin of the virus.

Materials and Methods

Sample collection

Dog brain specimens, including the medulla oblongata, the base of the cerebellum, the hippocampus, and the cerebral cortex, were taken, according to the standard techniques (Dean et al. 1996), from 27 stray animals (randomly captured on street and fields) toward the end of the cull period. Brains of two other dogs that had bitten humans, according to reports to the local Centers for Animal Disease Control and Prevention (Animal CDC), were also collected. All dogs were unowned and from rural areas where mass vaccination concerned only owned. Serum samples were also collected from these stray dogs before they were euthanized. After mass vaccination campaign, serum samples of dogs in a randomly selected community were collected.

Direct fluorescence assay and virus isolation by mouse intracerebral test

Brain specimens were smeared onto glass slides and tested by direct fluorescence assay (DFA), as described elsewhere (Barrat 1996). The fluorescein isothiocyanate (FITC) conjugate was made in our laboratory by labeling antinucleoprotein monoclonal antibodies (produced in our laboratory) with FITC.

Positive brain specimens were homogenized in 10 volumes of phosphate-buffered saline, and 30 μL aliquots were injected intracerebrally into each of ten 1-day-old suckling mice, that is, the mouse intracerebral test. The mice were observed between days 5 and 28 for symptoms indicative of rabies infection. After death, the brains were examined by DFA as above.

Measurement of neutralizing antibody

Dog serum samples were assayed for rabies virus-neutralizing antibody by the fluorescent antibody virus neutralization test as described by Cliquet et al. (1998). Briefly, three-fold serial dilutions of both the serum samples and the controls were prepared in microplates. Each serum dilution was tested in quadruplicate. Fifty microliters (100 TCID₅₀) of challenge rabies virus CVS-11 was also added to each well. After 1 h of incubation at 37°C in a 5% CO₂ humidified incubator, 50 μL of BHK-21 cell suspension, containing 4 × 10⁵ cells/mL (routinely maintained in our laboratory) in Dulbecco's minimum essential medium supplemented with 2% newborn calf serum and 100 IU/mL biantibiotics, was added to each well and the plates were incubated for 48 h at 37°C. After fixing the cells in 80% cold acetone for 30 min at room temperature, the plates were stained by adding FITC-conjugated anti-rabies monoclonal antibody to each well, incubating at 37°C for 30 min and then washing with phosphate-buffered saline–Tween 20. The plates were examined by fluorescence microscope (Olympus). Presence or absence of fluorescent foci in the cells was recorded. Endpoints were calculated as the inverse of the highest dilution showing no fluorescence, using the Spearman–Kärber formula (World Health Organization, 1996). A standard anti-rabies serum (AFSSA, France) was included as a positive control in all assays, and data were calculated as IU/mL of rabies virus-neutralizing antibodies.

Phylogenetic analysis

The nucleoprotein (N) or glycoprotein (G) gene was amplified from brain specimens by RT-PCR according to standard techniques (Heaton et al. 1999) with the following primers:

RV-N-F: 5′ ACGCTTAACAACAAAACCATAGAAG 3′

RV-N-R: 5′ CGGATTGACGAAGATCTTGCTCAT 3′

RV-G-F: 5′ CATCCCTCAAAAGACTTAAGGAAAG 3′

RV-G-R: 5′ CCGAGGAGATGAGGTCTTCGGGAC 3′

Amplicons were sequenced by the TaKaRa. The Maximum Composite Likelihood model of MEGA 4 (MegAlign, DNASTAR Software Suite, Version 7.1.0 (44); Dnastar, Inc.) was used for phylogenetic analysis. This method is a character-based method that analyzes individual substitutions to determine the tree construction possible for the data and then compare the trees for optimality. Bootstrap values were calculated from 1000 repeats.

Results

Assay of dog brain specimens and isolation of rabies virus by mouse intracerebral test

By DFA, none of the 27 brain samples from the culled dogs was positive for rabies virus infection, but the brain of 1 of the 2 dogs that had bitten humans was found to be infected. After intracerebral inoculation of 30 μL aliquots of the DFA-positive brain specimen, all suckling mice showed initial symptoms of rabies on day 11 postinoculation and all died within 8 days. The dead mice were further shown to be rabies positive by DFA. This isolate was designated Shaanxi-HZ-6.

Antibody assay of dog serum samples

Serum samples taken before the outbreak were unavailable. Twenty-seven serum samples were collected from stray dogs during the outbreak. Only 1 of the 27 serum samples had a positive neutralizing antibody titer (0.38 IU/mL). To the end of June, about 33,6000 dogs were vaccinated using a live vaccine domestically produced from the Flury-LEP strain. The vaccination coverage in dog populations reached to 91.5%. Fifty-three serum samples were randomly collected in a community 3 weeks after the mass vaccination. Eleven of the 53 serum samples tested positive, with titers ranging from 0.11 to 2.97 IU/mL; that is, 20.8% of dogs had seroconverted.

Molecular epidemiology of rabies virus isolate

The virus from the infected dog (Shaanxi-HZ-6) was subjected to molecular epidemiological analysis. Results are shown in Figures 2 and 3 and in Table 1. The virus showed 99.68% homology in its glycoprotein gene (GenBank accession no. GU591789) and 99.7% homology in its nucleoprotein gene (GenBank accession no. GU591790) with an isolate (GenBank accession nos. GU591791 and GU591792) from Sichuan province obtained in early 2009 (designated SC-GY). Glycoprotein and nucleoprotein amino acid sequences of Shaanxi-HZ-6 and SC-GY were identical. This indicated that the epizootic in Hanzhong district is closely related to the rabies epizootic in Sichuan province, with a spread from south to north. The isolated virus also shared high homology with distant isolates such as from Baoding, Hebei province, Guangning, Guangdong province, and Muding, Yunnan province, indicating that it is a highly prevalent and wide-spread strain in China.

FIG. 2.

The nucleoprotein gene phylogenetic tree of the rabies virus isolate from Hanzhong, Shaanxi province, and other isolates. The black branches stand for dog isolates or vaccine strains outside our laboratory. The blue branches stand for dog isolates kept in our laboratory. The pink branches represent ferret badger isolates kept in our laboratory. The red indicates the isolate of this study, that is, the dog isolate from Hanzhong.

FIG. 3.

The glycoprotein gene phylogenetic tree of the rabies virus isolate from Hanzhong, Shaanxi province, and other isolates. The black branches stand for dog isolates or vaccine strains outside our laboratory. The blue branches stand for dog isolates kept in our laboratory. The pink branches represent ferret badger isolates kept in our laboratory. The red indicates the isolate of this study, that is, the dog isolate from Hanzhong.

Table 1.

The Origin and Background of Rabies Virus Isolates and Strains Used for Phylogenetic Analysis in This Study

Isolates	Original places	Host	Isolation date	GenBank accession no.	Used for N or G analysis
D01	Zhejiang	Dog	2008	FJ712193	N/G
D02	Zhejiang	Dog	2008	FJ712194	N/G
ZJ-QZ	Zhejiang	Dog	2008	FJ719760/FJ719758	N/G
ZJ-Huzhou	Zhejiang	Dog	2009	NA	N/G
Zhejiang Wz0(H)	Zhejiang	Human	2007	EF556197/EF556198	N/G
Zhejiang Wz1(H)	Zhejiang	Human	2007	EF700030	G
BD06	Hebei	Dog	2006	EU549783	N/G
Jiangsu_Wx1	Jiangsu	Dog	2004	EU267773	G
Yunnan_Md06	Yunnan	Dog	2007	EU095330/EU253477	N/G
Hebei0(H)	Hebei	Human	2007	EU267777/EU267752	N/G
GC07	Hebei	Dog	2007	EU828655/EU828656	N/G
BeijingHu1	Beijing	Human	2008	EU700029	G
SC-GY	Sichuan	Dog	2009	NA	N/G
Shanxi-HZ-6	Shanxi	Dog	2009	NA	N/G
9811CHI	NA	Dog	1998	EU086173/EU086135	N/G
Jiangsu_Yc37	Jiangsu	Dog	2004	EU267775	G
05005CHI	NA	Dog	2005	EU086186/EU086146	N/G
GXBS	Guangxi	Dog	2006	DQ866118	N
GX304	Guangxi	Dog	2006	DQ866117	N
02035CHI	NA	Dog	2002	EU086174/EU086136	N/G
Yunnan_Qj07	Yunnan	Dog	2007	EU275245/EU275240	N/G
Guangxi_Yl66	Guangxi	Dog	2004	DQ666287/EU267744	N/G
Guizhou_Qx1	Guizhou	Dog	2004	DQ666294/EU267749	N/G
Hunan Xx33-04	Hunan	Dog	2004	DQ666317/EU267769	N/G
Hunan Xx35-04	Hunan	Dog	2004	DQ666319	N
hubei070308	Hubei	Buffalo brain	2007	EF611081/EU643518	N/G
HUBEI-G	Hubei	Dog	2009	NA	G
HuNDN16	Hunan	Dog	2007	EF555109	N
Hunan_DK13	Hunan	Dog	2004	DQ666307/EU267762	N/G
Guizhou_A148	Guizhou	Dog	2004	DQ666291/EU267748	N/G
Hunan_Wg12	Hunan	Dog	2008	DQ666308	N
Hunan_Wg432	Hunan	Dog	2008	DQ666316	N
QC	Hubei	Human	2006	DQ849063	G
HNDB11	Hunan	Dog	2007	NA	G
Jiangsu Wx32	Jiangsu	Dog	2009	EU267774	G
Jiangsu_Wx1	Jiangsu	Dog	2004	DQ666321	N
Henan_Sq35	Henan	Dog	2004	DQ666304/EU267758	N/G
Henan_Sq59	Henan	Dog	2004	DQ666306	N
02041CHI	NA	Dog	2002	EU086177/EU086140	N/G
FEIDONG	Anhui	Dog	1989	DQ849073	G
Guangxi Cx14	Guangxi	Dog	NA	EU267742	G
Henan Sq9	Henan	Dog	NA	EU267755	G
FY1 04	Anhui	Dog	2004	DQ849044	G
Yunnan_Zt07	Yunnan	Dog	2007	EU275241	G
02044CHI	NA	Dog	2002	EU086180	N
F02	Zhejiang	Chinese ferret badger	2008	FJ712195	N
HNDB33	Hunan	Dog		EU008928	G
N11	Guangxi	Dog	1997	DQ849069	G
CNX8601	Ningxia	Human	1986	AY009098	G
CQ92	Chongqing	Dog	1992	DQ849072	G
CTN-7	Vaccine Strains	NA	NA	DQ787139/DQ767890	N/G
CTN181	Vaccine Strains	NA	NA	EF564174/EF564174	N/G
JX08-45	Jiangxi	Chinese ferret badger	2008	NA	N/G
JX08-48	Jiangxi	Chinese ferret badger	2008	FJ719753/FJ719752	N/G
JX08-47	Jiangxi	Chinese Ferret badger	2008	FJ719751/FJ719749	N/G
ZJ-LA	Jiangxi	Chinese ferret badger	2008	FJ598135/FJ719756	N/G
GX01	Guangxi	Dog	2004	DQ866105	N
HuNPN01	Hunan	Swine	2006	DQ496219	N
02046CHI	NA	Dog	1994	EU086144	G
GX4	Guangxi	Dog	1994	DQ849071	G
Guizhou_A101	Guizhou	Dog	2004	DQ666289/EU267746	N/G
Guizhou_A103	Guizhou	Dog	2006	DQ666290/EU267747	N/G
GX014	Guangxi	Dog	2003	DQ866106	N
GXSL	Guangxi	Dog	2004	DQ866120	N
GN07	Guangdong	Dog	2007	EU828653/EU828654	N/G
FJ001	Fujian	Dog	2008	FJ561726	N
GXN119	Guangxi	Dog	2004	DQ866111	N
Yunnan_Tc06	Yunnan	Dog	2006	EU275243/EU275242	N/G
MN1025B	Inner Mongolia	Raccoon dog	2007	EU652445/EU284097	N/G
MRV	Henan	Mouse		DQ875050	N/G
PG	NA	NA	NA	AY009097	G
DRV	Jilin	Deer	1986	DQ875051	N/G
Henan_Sq30	Henan	Dog	2004	DQ666303	N
Henan_sq48	Henan	Dog	2004	DQ666305	N
Guizhou_A10	Guizhou	Human	2004	DQ666288/EU267745	N/G
Jiangsu_Wx0(H)	Jiangsu	Human	2004	DQ666320/EU267772	N/G

G, glycoprotein; N, nucleoprotein; NA, not available.

Discussion

Until the recent outbreak there had been no human rabies in Shaanxi province since 1992. Mandatory vaccination of dogs had not been implemented, and inadequate consideration was given to the possible consequences. Lack of rabies prevention education resulted in a low voluntary vaccination coverage in the dog population. Our tests showed that only 1/27 dogs before the vaccination campaign during outbreak contained rabies virus-neutralizing antibody. This inadequate figure is probably the reason that rabies virus was allowed to enter the local dog population and to spread rapidly. After the mass vaccination, only 20.8% (11/53) seroconverted, which is still low compared with the requirements of 70% immunization coverage to stop the spread of rabies (www.netnewspublisher.com/36000-dogs-culled-in-hanzhong-city-china/). The reason to this low figure might be that (1) the sample was randomly drawn in a community, which might not fully be covered by the mass vaccination campaign or (2) the quality of the vaccine (i.e., Flury-LEP) was not good enough, possibly resulted from the inappropriate quality control method. Both reasons remain addressed. Currently, however, owned dogs are leashed, by requirement of the local government, and most stray dogs have been eliminated, so the spread of rabies among the dog population is temporarily inhibited.

Rabies is widely known as a disease of the poor (Sudarshan et al. 2006). This can be further understood by the high number of human deaths who all lived in rural areas except two, and by the canine vaccination campaign after the outbreak. For example, a live rabies vaccination costs 30 Ren Min Bi (RMB), equivalent to about 4.3 U.S. dollars, of which the government undertook to pay half. Even so, some dog owners were unwilling to pay the remainder, preferring to abandon their dogs. Since the local peasants live only by planting crops and have no extra income from sources such as industry or tourism, 15 RMB was too large a sum to pay for their animals.

Compared with the occurrence of rabies in some districts in south China, the number of human rabies cases in this region is not particularly high. However, the outbreak drew public attention due to the large-scale dog slaughter. That this was probably unnecessary is seen by the results on the 27 brain samples of the stray dogs, all being rabies negative. However, dogs that bite people do have the potential of being infected with rabies: consequently, their elimination and testing for rabies was appropriate. The slaughter action was undertaken in response to the rapid outbreak of human deaths since a survey had found that on average 18.3% (13/71) of dogs from all eleven counties of Hanzhong district contained rabies virus in their saliva, as demonstrated by ELISA. It was even shown that saliva samples of 40%, 30%, and 36.4% of dogs from Chenggu, Yangxian, and Mianxian counties of Hanzhong district, respectively, were rabies virus positive, according to government-run tests (http://news.sohu.com/20090615/n264543339.shtml). However, in a study of 153 domestic dogs in another rabies enzootic region (Anlong county, Guizhou province) in which 15 were initially found by ELISA to have rabies virus antigen in their saliva, Zhang et al. (2008) showed definitively that all these positive specimens were false-positives, probably due to the reason that the existence of unknown peroxidases in dog saliva interfered in coloring in the ELISA.

The number of dogs in Hanzhong district was 408,000, with a dog:human ration of 1.079:10, which is at a middle level, compared with the figure of 0.6–1.5:10 reported previously (Tang et al. 2005). However, all the 10% stray dogs and the 90% of the owned but unleashed dogs had not been vaccinated, and this made the dogs at risk of exposing rabies before this time of vaccination campaign. According to the official data, 367,000 dogs (accounting for 74.1% of the total owned dogs) had been vaccinated in this district from the beginning of the human rabies outbreak to the end of June 2009 (www.sxtvs.com/content/2009-08/14/content_736351.htm). The postoutbreak mass vaccination campaign and measures such as leashing or caging the dogs will exert a certain role in controlling the transmission. However, the preventive measure of vaccination of dogs at this stage has not produced an effective level of immunization coverage. Our surveillance result has shown that the neutralizing antibody in dogs ranged from 0.11 to 2.97 IU/mL with only 20.8% of the vaccinated dogs seroconverting, which poses questions as to vaccine quality and the efficacy of the campaign.

The isolated viral strain is highly homologous with the isolate from Sichuan province in both the nucleoprotein and the glycoprotein genes, and belongs to clade 1 (Zhang et al. 2009). Sichuan is a province where rabies has been historically moderately enzootic, with the situation only becoming serious in recent years. For example, human rabies cases in Sichuan have increased from 16 in 2004 to 49 in 2005, 190 in 2006, and 372 in 2007. As the local government has taken measures to vaccinate dogs and to provide more extensive postexposure prophylaxis in humans, the numbers are starting to decrease, with 172 human cases in 2008, and 47 cases in the first half of 2009, according to the information provided by China CDCs. As Gansu and Sichuan provinces are neighboring on Hanzhong district, and since Sichuan is the only neighbor province on Hanzhong in which rabies is enzootic, this virus strain appears to have originated in Sichuan before being transmitted to Hanzhong. However, the isolate also possesses high homology with other strains from epizootics in China, including those from provinces in the south and north—for example, from Baoding, Hebei province, Guangning, Guangdong province, and Muding, Yunnan province (Figs. 2 and 3)—indicating that this virus strain is prevalent in China and has a high transmissibility in dog populations without sufficient level of neutralizing antibody in their sera. Although nucleotide mutations of the glycoprotein in some sites outside the main antigenic regions (Flamand et al. 1980, Lafon et al. 1984, Dietzschold et al. 1988, Prehaud et al. 1988) occurred in this isolate, the key amino acids among antigenic sites remained stable (Fig. 4). Why the strain in clade 1 maintains its prevalence in dogs in China requires further biological and epidemiological study.

FIG. 4.

Alignment of glycoprotein amino acids of 11 rabies virus isolates (clade 1) from different provinces of China. Boxes with continuous green lines indicate key antigenic sites: antigenic site II (34–42 and 198–200), antigenic site I (231), VI (264), III (330–338), and “a” (342). All the amino acids of the glycoproteins between #Shanxi-HZ-6-G and #SC-GY-G are completely the same.

Conclusions

The major causes of human rabies outbreak in Hanzhong District, Shaanxi province of China, include the high number of stray dogs and failure to vaccinate the dogs, with resulting low vaccination coverage. The virus isolated in this epizootic is highly homologous to that from a neighboring province, Sichuan, which is one of the most prevalent strains of clade 1 widely distributed in China.

Footnotes

Acknowledgments

This investigation was funded by the Key Project of National Science Foundation of China (30630049) and the China National “973” Program (2005CB52300).

Disclosure Statement

No competing financial interests exist.

References

Barrat

. Simple technique for the collection and shipment of brain specimens for rabies diagnosis. Laboratory Techniques in Rabies. Meslin

F-X

, Kaplan

, Koprowski

. Geneva: World Health Organization, 1996; 425–432.

Cliquet

, Aubert

, Sagne

. Development of a fluorescent antibody virus neutralization test (FAVN test) for the quantitation of rabies-neutralizing antibody. J Immunol Methods, 1998; 212:79–87.

Coleman

, Dye

. Immunization coverage required to prevent outbreaks of dog rabies. Vaccine, 1996; 14:185–186.

Constantine

. Rabies transmission by non-bite route. Public Health Reports, 1962; 77:287–289.

Dean

, Abelseth

, Atanasiu

. The fluorescent antibody test. Meslin

F-X

, Kaplan

, Koprowoski

. Laboratory Techniques in Rabies. Geneva: World Health Organization, 1996; 88–91.

Dietzschold

, Rupprecht

, Fu

, Koprowski

. Rhabdoviruses. Fields

, Knipe

, Howley

et al. Field's Virology, third. Philadelphia, PA: Raven Press, 1996; 1137–1159.

Dietzschold

, Rupprecht

, Tollis

. Antigenic diversity of the glycoprotein and nucleoproteins of rabies and rabies-related viruses: implications for epidemiology and control of rabies. Rev Infect Dis, 1988; 10:S758–S798.

Flamand

, Wiktor

, Koprowski

. Use of hybridoma monoclonoal antibodies in the detection of antigenic differences between rabies and rabies-related virus proteins. II. The glycoprotein. J Gen Virol, 1980; 48:105–109.

Heaton

, McElhinney

, Lowings

. Detection and identification of rabies and rabies-related viruses using rapid-cycle PCR. J Virol Methods, 1999; 81:63–69.

10.

Lafon

, Ideler

, Wunner

. Investigation of antigenic structure of rabies virus glycoprotein by monoclonal antibodies. Dev Biol Stand, 1984; 57:219–225.

11.

Prehaud

, Coulon

, Lafay

, Thiers

, Flamand

. Antigenic site II of the rabies virus glycoprotein: structure and role in viral virulence. J Virol, 1988; 62:1–7.

12.

Sudarshan

, Mahendra

, Madhusudana

, Ashwoath Narayana

et al. An epidemiological study of animal bites in India: results of a WHO sponsored national multi-centric rabies survey. J Commun Dis, 2006; 38:32–39.

13.

Tang

, Luo

, Zhang

, Fooks

et al. Pivotal role of dogs in rabies transmission, China. Emerg Infect Dis, 2005; 11:1970–1972.

14.

Meslin

F-X

, Kaplan

, Koprowski

. Laboratory Techniques in Rabies, fourth. Geneva, Switzerland: World Health Organization, 1996; 181–191.

15.

World Health Organization Expert Consultation on Rabies. WHO expert consultation on rabies first report. WHO Technical Report Series. Geneva: World Health Organization, 2004; 931:1–121.

16.

Zhang

, Fu

, Wang

, Zhou

et al. Investigation of the role of healthy dogs as potential carriers of rabies virus. Vector Borne Zoonot Dis, 2008; 8:313–319.

17.

Zhang

, Xiong

, Lin

, Zhou

et al. Genetic diversity of Chinese rabies viruses: evidence for the presence of two distinct clades in China. Infect Genet Evol, 2009; 9:87–96.