Genotypic Characterization of Cutaneous Leishmaniasis at al Baha and Al Qasim Provinces (Saudi Arabia)

Abstract

Fifty samples of skin ulcers were collected from the western region of Saudi Arabia Kingdom (Al Baha and Al Qasim) to study genotypic characterization of Cutaneous Leishmaniasis in this area. Thirty-six samples were recorded as Leishmania isolates. The same isolates were subsequently tested with fingerprinting with single arbitrary primers. The primers used derived from the core sequence of the phage M13, and the repeat sequences (GTG)5 and (GACA)4. The 36 isolates were all identified as Leishmania major (n = 25 isolates) or Leishmania tropica (n = 11 isolates). All produced polymorphic patterns, which were grouped depending on the species they belonged to, next to the relevant well-characterized strains of the same species. Within the L. major and L. tropica group the subgroupings formed were mainly related to the geographical origin of the strains. A nested polymerase chain reaction-based schizodeme method for identifying Leishmania kinetoplast minicircle classes was used as a diagnostic tool for L. major and L. tropica.

Introduction

T he leishmaniases are considered as a group of globally widespread parasitic diseases caused by different species of Leishmania of the subgenus Viannia and Leishmania, which infect a wide variety of mammals. Currently, 22 species of Leishmania are pathogenic to humans, who are accidentally infected when exposed to the natural transmission cycle (Silveira et al. 2002). Leishmania currently infects about 12 million people in 88 countries, with 1,500,000 new clinical cases reported annually with 350 million at risk (WHO 2007).

Cutaneous leishmaniasis (CL) is common in the human population in different localities in Saudi Arabia such as provinces of Al Baha and Qassim. CL is also known to occur throughout the Kingdom (Bienzle et al. 1978, Al-Zahrani et al. 1979, Buttiker et al. 1982, Al-Gindan et al. 1984, Peters et al. 1985, Dye et al. 1989, Peters and Al-Zahrani 1987, Al-Zahrani et al. 1989, Morsy et al. 1991, Al-Shammari et al. 1992, Al-Tawfiq and Abukhamsin 2004). This is due to Leishmania major zymodeme LON-4, causing zoonotic cutaneous leishmaniasis (Peters et al. 1985), and Leishmania tropica zymodeme LON-34, (Al-Zahrani et al. 1979) causing oriental sore. Morsy et al. (1993) characterized Leishmania isolates from El Nour specialized hospital Makkah Al Mukarramah. They reported that the studied isolates were two Leishmania donovani zymodeme LON-41 (VL Indian patient) and LON-46 (VL Sudanese patient); three L. tropica zymodeme LON-71 (2 CL Yemenis patients) and LON-22 (CL Egyptian patient); and two L. major zymodeme LON-4 (2 CL Saudi patients). In a recent epidemiological study performed in neighboring Iran of vectors and reservoirs of CL in rural regions, it has been reported that 8.4% of rodents collected were found to be infected with L. major (Rassi et al. 2007). No similar studies have been done in Saudi Arabia; however, rodents were recorded by several authors to be the reservoir hosts (Peters and Al-Zahrani 1987, Al-Zahrani et al. 1989, Morsy et al. 1991).

The development of the polymerase chain reaction (PCR) (Saiki et al. 1988) has led to the introduction of procedures for the detection and genetic characterization of Leishmania (Degrave et al. 1994). PCR has been widely used to diagnose human and animal leishmaniasis because of its high sensitivity and specificity (Bensoussan et al. 2006, Botilde et al. 2006, Cortes et al. 2006, Reithinger and Dujardin 2007).

Bensoussan et al. (2006) suggested that a PCR using kDNA should be used for the diagnosis of CL and that an internal transcribed spacers 1 PCR could be reliably used for the diagnosis of CL when rapid species identification is needed. Botilde et al. (2006) compared the resolving power of four molecular methods at the zymodeme level: PCR-restriction fragment length polymorphism (RFLP) analysis of kDNA minicircles (kDNAPCR-RFLP) and antigen genes (cysteine proteinase b and major surface protease, cpb- and gp63PCR-RFLP), multilocus microsatellite typing, and random amplification of polymorphic DNA (RAPD) were applied to samples of 25 Leishmania infantum. Cortes et al. (2006) applied kDNA as a molecular marker to analyze L. infantum diversity in Portugal. Also, Aziz et al. (2010) used PCR-based technique to detection of L. major kDNA within naturally infected Phlebotomus papatasi in southern Iran. Recently, Fraga et al. (2010) studied phylogeny of Leishmania species based on the heat-shock protein 70 gene. High-resolution melt analysis PCR for diagnosis of Old World Leishmania was developed using the 7SL RNA gene (Nasereddin and Jaffe 2010). In addition, PCR can be used to investigate the phylogenetic relationships among Leishmania strains and species (Andresen et al. 1996, Cupolillo et al. 2003, Rotureau et al. 2006). Noyes et al. (1996) evaluated 28 different RAPD primers. Thirteen of them yielded patterns of taxonomic value when DNA was amplified from 4 different, closely related Leishmania of the Viannia group. When kDNA was amplified with RAPD primers, it was possible to differentiate the cutaneous species, and when genomic DNA was used as template, different L. donovani isolates could be distinguished (Bhattacharyya et al. 1993). Nested PCR was sufficiently sensitive for the detection of DNA in an amount equivalent to a single Leishmania parasite or less. Noyes et al. (1998) used a nested PCR to amplify the variable region of the kinetoplast minicircles of all Leishmania species, which infect mammals. The study demonstrated that the nested PCR achieved high sensitivity and is therefore a potentially useful method for diagnosis.

So, this study aimed to characterize the causal agents of leishmaniasis in the western region of Saudi Arabia through molecular characterization of Leishmania species using arbitrary primed PCR (AP-PCR); studying the genetic diversity among Saudi strains; and run nested PCR test to check the sensitivity of this method for discriminating between the different species of collected Leishmania and to confirm of the AP-PCR typing.

Materials and Methods

Study samples

In the winter season of 2008, samples were obtained from human with skin ulcers from different localities at Al Baha and Al Qasim provinces in 2009 (Table 1 and Fig. 1). Lesions consistent with CL were cleaned with soap and water and swabbed with ethanol. Samples were taken by using a sterile scalpel to make an incision in the border of the lesion. A small amount of material was scraped out from the incision. The sample was divided into two portions, one to make a thin smear on a microscope slide and one in an Eppendorf tube containing 500 mL of 4 M guanidine thiocyanate (GuSCN)–0.25 M EDTA. Microscope slides were stained with Giemsa stain for direct detection of parasites; GuSCN lysates were stored at 4°C for PCR analysis.

FIG. 1.

Saudi Arabian province map. Number 1 showing Al Baha province and number 5 showing Al Qasim province, where the samples were collected.

Table 1.

The List of the Collected Samples

Sample no.	ID no.	Province	Hospital name	Leishmania species ^a	Notes (hospital results) ^b
1	CL/AQ/1	Al Qasim	Al-Barakah Polyclinic	Leishmania major	+ve
2	CL/AQ/2	Al Qasim	Al-Barakah Polyclinic	L. major	+ve
3	CL/AQ/3	Al Qaseem	Al-Barakah Polyclinic	Leishmania Tropica	+ve
4	CL/AQ/4	Al Qasim	Al-Barakah Polyclinic	L. major	+ve
5	CL/AQ/5	Al Qasim	Al-Barakah Polyclinic	L. major	+ve
6	CL/AQ/6	Al Qasim	Al-Barakah Polyclinic	L. major	+ve
7	CL/AQ/7	Al Qasim	Al-Barakah Polyclinic	L. major	+ve
8	CL/AQ/8	Al Qasim	Al-Barakah Polyclinic	L. tropica	+ve
9	CL/AQ/9	Al Qasim	Al-Barakah Polyclinic	L. tropica	+ve
10	CL/AQ/10	Al Qaseem	Al-Barakah Polyclinic	L. major	+ve
11	CL/AQ/11	Al Qasim	Al-Salama Clinic	L. tropica	+ve
12	CL/AQ/12	Al Qasim	Al-Salama Clinic	L. major	+ve
13	CL/AQ/13	Al Qasim	Al-Salama Clinic	L. major	+ve
14	CL/AQ/14	Al Qasim	Al-Salama Clinic	L. tropica	+ve
15	CL/AQ/15	Al Qasim	Al-Salama Clinic	L. major	+ve
16	CL/AQ/16	Al Qasim	Al-Salama Clinic	L. major	+ve
17	CL/AQ/17	Al Qaseem	Al-Amin Clinic	L. major	+ve
18	CL/AQ/18	Al Qasim	Al-Amin Clinic	–	−ve
19	CL/AQ/19	Al Qasim	Al-Amin Clinic	L. major	+ve
20	CL/AQ/20	Al Qasim	Al-Amin Clinic	L. major	+ve
21	CL/AQ/21	Al Qasim	Al-Amin Clinic	–	−ve
22	CL/AQ/22	Al Qasim	Al-Nozhah Clinic	L. major	+ve
23	CL/AQ/23	Al Qasim	Al-Nozhah Clinic	–	−ve
24	CL/AQ/24	Al Qaseem	Al-Nozhah Clinic	L. major	+ve
25	CL/AQ/25	Al Qasim	Al-Nozhah Clinic	L. tropica	+ve
26	CL/AQ/26	Al Qasim	Al-Nozhah Clinic	–	−ve
27	CL/AQ/27	Al Qasim	Al-Amin Clinic	–	−ve
28	CL/AQ/28	Al Qasim	Al-Amin Clinic	–	−ve
29	CL/AQ/29	Al Qasim	Al-Amin Clinic	L. major	+ve
30	CL/AQ/30	Al Qasim	Al-Amin Clinic	L. major	+ve
31	CL/AQ/31	Al Qaseem	Al-Nozhah Clinic	–	−ve
32	CL/AQ/32	Al Qasim	Al-Nozhah Clinic	–	−ve
33	CL/AQ/33	Al Qasim	Al-Nozhah Clinic	L. tropica	+ve
34	CL/AQ/34	Al Qasim	Al-Nozhah Clinic	–	−ve
35	CL/AQ/35	Al Qasim	Al-Nozhah Clinic	–	−ve
36	CL/AQ/36	Al Qasim	Al-Amin Clinic	L. tropica	+ve
37	CL/AB/1	Al Baha	Ibn-Sina Clinic	L. major	+ve
38	CL/AB/2	Al Baha	Ibn-Sina Clinic	L. major	+ve
39	CL/AB/3	Al Baha	Ibn-Sina Clinic	L. tropica	+ve
40	CL/AB/4	Al Baha	Ibn-Sina Clinic	L. major	+ve
41	CL/AB/5	Al Baha	Al-Mokhtar Clinic	L. tropica	+ve
42	CL/AB/6	Al Baha	Al-Mokhtar Clinic	L. major	+ve
43	CL/AB/7	Al Baha	Al-Mokhtar Clinic	L. major	+ve
44	CL/AB/8	Al Baha	Al-Mokhtar Clinic	–	−ve
45	CL/AB/9	Al Baha	Ibn-Sina Clinic	–	−ve
46	CL/AB/10	Al Baha	Ibn-Sina Clinic	–	−ve
47	CL/AB/11	Al Baha	Ibn-Sina Clinic	L. tropica	+ve
48	CL/AB/12	Al Baha	Ibn-Sina Clinic	L. major	+ve
49	CL/AB/13	Al Baha	Al-Mokhtar Clinic	–	−ve
50	CL/AB/14	Al Baha	Al-Mokhtar Clinic	L. major	+ve

Based on polymerase chain reaction.

Based on microscopic examination.

Parasite culture

The isolates were cultured in RPMI-1640 medium (Sigma No. R 6504 with L-glutamine). Two grams per liter of sodium bicarbonate or 26.7 mL/L of sodium bicarbonate solution (7.5% w/v) was added to the prepared medium. Finally, the medium was supplemented with 15% fetal calf serum (Seromed) and according to Howard et al. (1991), 5% human urine from a volunteer and incubated at 26°C after inoculation with parasites. For a rapid and reproducible growth in culture, a ratio of no more than 1 volume of inoculums to 4 volumes of the fresh medium was required. Most rapid growth in the new medium was observed when sluggish or largely immotile promastigotes was cultured. The cultures were harvested at an approximate density of 2 × 10⁶ parasites/mL. They were washed twice in phosphate-buffered saline and processed for the DNA extraction.

Preparation of DNA samples

Template DNA was extracted from aliquots of 50, 250, and 100 mL of the GuSCN lysate. Briefly, the sample was bounded to diatomaceous earth (Sigma) in the presence of 6M GuSCN, washed with ethanol and acetone, and eluted with 50 mL of 10 mM Tris-HCl (pH 8.4) (Boom et al. 1990).

PCR fingerprinting with single arbitrary primers

The following oligonucleotides were used as single primers in the PCR experiments: the simple repeat sequences (GTG)5-(5′-GTG GTG GTG GTG GTG), (GTGG)4-(5′-GTGG TGGT GGTG GTG), and (GACA)4-(5′-GACA GACA GACA GACA), (5′-GACA GACA GACA GACA) (Ali et al. 1986), and the core sequence of phage M13 (5′-GAGG GTGG CGGT TCT) (Huey and Hall 1989). Amplification reactions were performed in volumes of 50 μL containing 10–50 ng template DNA, 20 mM Tris/HCl, pH 8.0, 50 mM KCl₂, 4.5 mM Mg⁺⁺, 200 mM each of dATP, dCTP, dGTP, and dTTP, and 1.5U Taq DNA polymerase. The primers (GACA)4 and M13 core were added at a final concentration of 25 pmol per assay and the (GTG)5 was added at concentrations of 10 and 5 pmol per assay, respectively. Samples were overlaid with sterile, light mineral oil and amplified as follows: initial denaturation, 2 min at 95°C; denaturation, 20 s at 95°C; annealing, 30 s at 50°C for the (GTG)5 primer, 60 s at 50°C for the (GACA)4 primer, 60 s at 50°C for the M13 core primer, 32 s; extension, 80 s at 72°C for the (GTG)5 and 20 s at 72°C for the (GACA)4 and M13 core primers; a total of 32 cycles will be run for the (GTG)4 primer, whereas 35and 27 cycles were run for the (GACA)4 and M13 core the primers, respectively. A final extension for 6 min at 72°C followed and the reaction tubes were held at 4°C before analysis. The samples were concentrated in a Speed Vac to an approximate volume of 20 μL and were subjected to electrophoresis in 1.2% agarose gels for 5 h at 3 V/cm in 0.5× TBE buffer. The amplification products were observed under UV light after staining the gels with ethidium bromide.

Computer-assisted data analysis

After staining the gels were photographed, and the DNA fragments were sized and compared with the use of UV gel documentation system and computer software Phoretex 1D Software (version 5.2). The similarity indices representing the ratio of shared bands over total bands within two lanes being compared during the matching operation were estimated for the different Leishmania species tested as well as for isolates belonging to the same species. Distance matrices based on N (N −1)/2 pair wise comparisons between N data sets were calculated and evolutionary trees were constructed by unweighted pair group method using arithmetic averages, which is a cluster-based analysis (Sneath and Sokal 1973, Saitou and Nei 1987, Swofford 2002) using the Treecon program (Van De Peer and Wachter 1994).

Nested PCR

To confirm the AP-PCR typing, the nested PCR was conducted. Two pair of primers were used as external primers, CSB2XF (C/GA/GTA/GCAGAAAC/TCCCGTTCA) and CSB1XR (ATTTTTCG/CGA/TTTT/CGCAGAACG), and the internal primers, 13Z (ACTGGGGGTTGGTGTAAAATAG) (Rodgers et al. 1990) and LiR (TCGCAGAACGCCCCT) (Noyes et al. 1997). CSB2XF and CSB1XR primers were designed by identifying suitable regions around conserved sequence blocks 1 and 2 in an alignment of kDNA sequences from Leishmania guyanensis, Leishmania peruviana, Leishmania braziliensis, L. infantum, and L. tropica (Noyes et al. 1998). Primer 13Z is homologous to conserved sequence block 3, and primer LiR is complementary to conserved sequence block 1. The conserved sequence block 1 is too small for two independent primers; consequently, the 10 3′ bases of CSB1XR are the same as the 10 5′ bases of LiR. The first-round PCR mixtures contained 2.0 mM MgCl₂, 200 mM deoxynucleoside triphosphates, 20 mM (NH4)2SO₄, 75 mM Tris-HCl (pH 9.0), 0.01% Tween, 0.4 U of Red Hot Taq, and 40 ng each of primers CSB2XF and CSB1XR in a final volume of 20 mL. The cycling conditions were 94°C for 300 s, followed by 30 cycles of 94°C for 30 s, 55°C for 60 s, and 72°C for 90 s. One microliter of a 9:1 dilution in water of the first-round product was used as template for the second round in a total volume of 30 mL under the same conditions as those for the first round, except with primers LiR and 13Z. Three microliters of the second-round PCR product was loaded onto a 1% agarose gel to confirm amplification. Positive samples were digested by the addition of 1 U of restriction enzyme HaeIII, 1.5 mL of restriction enzyme buffer, and 1.4 mL of water to 12.5 mL of PCR product and incubation for 16 h. The restriction digests were separated on a 1.5% 1:1 Nusieve-normal agarose gel to observe the patterns.

Results

From 50 samples of skin ulcers collected during this study, 36 samples were positive for the presence of Leishmania species. Among the positive samples, 25 were L. major and 11 were L. tropica. Also, no mixed infection (L. major and L. tropica) was reported in one human sample.

PCR fingerprinting with single arbitrary primers

Fifty samples were collected from different hospitals at Al Baha and Al Qasim provinces. Thirty-six samples were identified as Leishmania infection. So, the percentage of positive samples was 72% of the collected samples. All the 36 human isolates were processed through fingerprinting PCR, using all primers [M13, (GACA)4 and (GACA)5]. All Leishmania isolates were repeatedly tested. The polymorphic fragment patterns were reproducible with slight variations in the intensity and occasionally in the banding pattern. Distinctive sets of amplification products were observed for each taxon and for every sample depending on the taxon it belonged to.

The used primers showed similar results with all L. major samples. The combined results of the used primer in the presence of L. infantum as out group were used to construct a dendrogram showing the relationships among all L. major strains used in this study (Fig. 2). This dendrogram showed that Al Baha region strains (CL/AB/1, CL/AB/2, CL/AB/4, CL/AB/6, CL/AB/7, CL/AB/12, and CL/AB/14) clustered together in one cluster (RAPD I). Also, All Al Qaseem region strains clustered together (RAPD II). This dendrogram supported the relationship between DNA amplification patterns and the geographical origin of the strains.

FIG. 2.

Dendrogram showing evolutionary tree from some Leishmania major strains produced by the combined results of the fingerprinting PCR with three single arbitrary primers: M13, (GACA)4, and (GTG)5. PCR, polymerase chain reaction.

L. tropica dendrogram produced after PCR with the three different primers is supported very well by the species identification (Fig. 3). L. tropica dendrogram produced after combination of the matrices produced through the used primers showed that the Al Bah strains (CL/AB/11, CL/AB/5, and CL/AB/3) clustered together in one cluster (RAPDI). Also, Al Qasim strains clustered together in RAPD II cluster as shown in Figure 3.

FIG. 3.

Dendrogram showing evolutionary tree from some Leishmania tropica strains produced by the combined results of the fingerprinting PCR with three single arbitrary primers: M13, (GACA)4, and (GTG)5.

L. major and L. tropica dendrogram produced after PCR with the primer M13 showed the relationships among different strains of L. major and L. tropica on the same gel (Fig. 4). The used strains splited into two cluster according to the species. So, this dendrogram showed that L. major and L. tropica are clearly separable form each other using this primer. Also, Al Baha strains of L. major clustered together in this species cluster and the same region strains of L. tropica constitute distinct cluster in the L. tropica cluster.

FIG. 4.

Dendrogram showing evolutionary tree from some L. major and L. tropica strains produced by the results of the fingerprinting PCR with the single arbitrary primer M13.

Nested PCR

The nested primer set was tested on DNA from different L. major and L. tropica strains and was found to generate a single major product from representatives of all tested strains (Fig. 5). No product was detected from DNA of Trypanosoma cruzi or from Schistosoma mansoni parasite. L. tropica generated the largest Leishmania species PCR product (750 bp) and could be distinguished more easily from L. major (560 bp). It was therefore possible to identify the Old World human-infective Leishmania (L. major and L. tropica) in Saudi Arabia on the basis of size alone.

FIG. 5.

Agarose (1.5%) gel of products of the nested PCR on various species of Leishmania (lanes 1 to 6). Cl/AB/3, Cl/AB/5, and Cl/AQ/9 are L. tropica strains; Cl/AQ/2, Cl/AQ/7, and Cl/AB/1 are L. major strains. Numbers at left indicate size in base pairs.

Discussion

Leishmaniases is a spectrum of diseases caused by infection with different species of the protozoan parasite Leishmania. Concerning identification of leishmanial parasites in Saudi Arabia very little is known although the disease is endemic there (Bienzle et al. 1978, Al-Zahrani et al. 1979, Buttiker et al. 1982, Al-Gindan et al. 1984, Peters et al. 1985, Al-Zahrani et al. 1989, Dye et al. 1989, Morsy et al. 1991, Al-Shammari et al. 1992, Al-Tawfiq and Abukhamsin 2004). Most of previous studies concerned with identification of the parasite using classical methods. The diagnostic PCR in our study proved to be a reliable test. It gave a positive result to all the isolates that had been previously identified as L. major and all the L. tropica characterized strains from Table 1. In the dendrograms produced from the results of the fingerprinting with RAPD primers isolates of the same species do cluster together. Concerning species identification, the results of each primer are confirmed by the results of the others. It has been suggested that polymorphic DNA markers amplified with single nonspecific primers may be very accurate indicators of genetic distances because this PCR randomly samples sequence polymorphisms distributed in the genome (Welsh et al. 1992). In most cases, these polymorphisms may be caused by single base changes in genomic DNA, deletions and insertions that change the size of the DNA fragment, deletions of a priming site, or insertions that render the priming sites too distant to support amplification. Since amplification parameters influence strongly the resulting patterns, it is necessary that the protocols used are well optimized, especially concerning the primer/template ratios, annealing temperature, and Mg2⁺ ions. Our results indicate that distinctive and reproducible sets of amplified DNA fragments were obtained for all Leishmania isolates tested. The PCR profiles within L. major strains are clustering together. Also, Al Baha region strains clustered in distinct cluster away from the cluster of Al Qasim region strain cluster. So, this dendrogram supported the relationship between DNA amplification patterns and the geographical origin of the strains. This result is in agreement with that of Elfari et al. (2005), who reported that variation discerned among the strains of L. major correlated with their geographical origin, which is determined by the geographical distribution of their natural animal reservoir hosts. The PCR profile within L. tropica strains showed two clades. The first clade included Al Baha region strains and the second included Al Qasim region strains. It seems that the clustering system here also followed the geographical origin of strains as in case of L. major strains. This finding supported the results of Schönian et al. (2001). Their study investigated which strains of L. tropica from different geographical and human clinical sources possess genetic differences coinciding with geographical and human clinical origins. Dendrogram constructed from RAPD results for different strains of L. major and L. tropica using M13 primer indicated that each species cluster in distinct clade and again the subgroupings of isolates correlate with the geographical distribution. So, this technique is reliable to discriminate between the two different species, since each species gives unique DNA patterns. RAPD analysis revealed species-specific profiles and differences between L. major and L. tropica. Cuervo et al. (2004) reported that RAPD analysis revealed species-specific profiles and differences between cutaneous and mucosal isolates. This technique has shown to be useful to discriminate different Leishmania species, as well as to evaluate differences among strains within the same species by several researchers (Tibayrenc et al. 1993, Pogue et al. 1995, Schönian et al. 1996). Nested primers showed that the studied species (L. major and L. tropica) generated different size (base pairs) of PCR product. L. tropica generated the largest Leishmania species PCR product (750 bp) and L. major (560 bp). So, they could be distinguished more easily from each other. Our results supported the findings of Noyes et al. (1998). They used a nested PCR to amplify the variable region of the kinetoplast minicircles of all Leishmania species, which infect mammals. Their study demonstrated that the nested PCR achieved high sensitivity and is therefore a potentially useful method for diagnosis. Also, a nested PCR was developed by Parvizi et al. (2005) to amplify a fragment containing the internal transcribed spacers of the ribosomal RNA genes with a sequence diagnostic for L. major isolated from Iran. To understand Leishmania pathogenesis and to develop means of disease prevention and treatment, functional analysis of new genes is required.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Al-Gindan

, Abdulaziz

, Kubba

. Cutaneous leishmaniasis in Al-Hassa, Saudi Arabia. Int J Dermatol, 1984; 23:194–197.

Ali

, Müller

, Epplen

. DNA fingerprinting by oligonucleotide probes specific for simple repeats. Hum Genet, 1986; 74:239–243.

Al-Shammari

, Khoja

, Fehr

. Cutaneous leishmaniasis in Riyadh region: four year study of the epidemiological and clinical features. Int J Dermatol, 1992; 31:365–367.

Al-Tawfiq

, Abukhamsin

. Cutaneous leishmaniasis: a 46-year study of the epidemiology and clinical features in Saudi Arabia (1956–2002) Int J Infect Dis, 2004; 8:244–250.

Al-Zahrani

, Peters

, Evans

. Leishmania infecting man and wild animals in Saudi Arabia. 6. Cutaneous leishmaniasis of man in the south-west. Trans R Soc Trop Med Hyg, 1979; 83:503–510.

Al-Zahrani

, Peters

, Evans

, Smith

, Ching

. Leishmania infecting man and wild animals in Saudi Arabia. 6. Cutaneous leishmaniasis of man in the south-west. Trans R Soc Trop Med Hyg, 1989; 83:621–628.

Andresen

, Ibrahim

, Theander

, Kharazmi

. Random amplified polymorphic DNA for the differentiation of Leishmania donovani isolates from Sudan. Int J Parasitol, 1996; 35:245–252.

Aziz

, Rassi

, Djaefar

. PCR-based detection of Leishmania major kDNA within naturally infected Phlebotomus papatasi in southern Iran. Trans R Soc Trop Med Hyg, 2010; 104:440–442.

Bensoussan

, Nasereddin

, Jonas

, Schnur

, Jaffe

. Comparison of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol, 2006; 44:1435–1439.

10.

Bhattacharyya

, Singh

, Hazra

, Majumder

. Application of polymerase chain reaction with specific and arbitrary primers to identification and differentiation of Leishmania parasites. FEMS Microbiol Lett, 1993; 114:99–104.

11.

Bienzle

, Ebert

, Dietrich

. Cutaneous leishmaniasis in Eastern Saudi Arabia. Epidemiological and clinical features in a nonimmune population living in an endemicarea. Trop Med Parasitol, 1978; 29:188–193.

12.

Boom

, Sol

CJA

, Salimans

MMM

, Jansen

et al. Rapid and simple method for purification of nucleic acids. J Clin Microbiol, 1990; 28:495–503.

13.

Botilde

, Laurent

, Tintaya

, Chicharro

et al. Comparison of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol, 2006; 6:440–446.

14.

Buttiker

, Al-Ayed

, Al-Rabil

. Medical and applied zoology in Saudi Arabia. A preliminary study on leishmaniasis in two areas of the Asir Region. Fauna Saudi Arabia, 1982; 4:509–519.

15.

Cortes

, Mauricio

, Almeida

, Cristovao

et al. Application of kDNA as a molecular marker to analyse Leishmania infantum diversity in Portugal. Parasitol Int, 2006; 55:277–283.

16.

Cuervo

, Cupolillo

, Nehme

, Hernandez

et al. Leishmania (Viannia): genetic analysis of cutaneous and mucosal strains isolated from the same patient. Exp Parasitol, 2004; 108:59–66.

17.

Cupolillo

, Brahim

, Toaldo

, Oliveira-Neto

et al. Genetic polymorphism and molecular epidemiology of Leishmania (Viannia) braziliensis from different hosts and geographic areas in Brazil. J Clin Microbiol, 2003; 41:3126–3132.

18.

Degrave

, Fernandes

, Campbell

, Bozza

, Lopes

. Use of molecular probes and PCR for detection and typing of Leishmania—a mini review. Mem Inst Oswaldo Cruz, 1994; 89:463–469.

19.

Dye

, Killick-Kendrick

, Ben Ismail

, Al-Gindany

. Zoonotic cutaneous leishmaniasis in Saudi Arabia: results of a preliminary epidemiological survey in Al-Hasa Oasis. Trans R Soc Med, 1989; 83:493–498.

20.

Elfari

, Schnur

, Strelkova

, Eisenberger

et al. Genetic and biological diversity among populations of Leishmania major from Central Asia, the Middle East and Africa. Microbes Infect, 2005; 7:93–103.

21.

Fraga

, Montalvo

, De Doncker

, Dujardin

J-C

, Van der Auwera

. Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infect Genet Evol, 2010; 10:238–245.

22.

Howard

, Kelly

, Lane

, Miles

. A sensitive repetitive DNA probe that is specific to the Leishmania donovani complex and its use as an epidemiological and diagnostic reagent. Mol Biochem Parasitol, 1991; 44:63–72.

23.

Huey

, Hall

. Hypervariable DNA fingerprinting in Escherichia coli: minisatellite probe from bacteriophage M13. J Bacteriol, 1989; 171:2528–2532.

24.

Morsy

, Al Gahtani

, Faris

. Two abnormal cases of anthroponotic cutaneous leishmaniasis in Al Baha, Saudi Arabia. J Egypt Soc Parasitol, 1991; 21:675–678.

25.

Morsy

, Sarwat

, Al Shaiby

, Fawzy

, Arafa

. Isoenzyme characterization of Leishmania isolates from patients in El Nour Specialized Hospital, Saudi Arabia. J Egypt Soc Parasitol, 1993; 23:871–876.

26.

Nasereddin

, Jaffe

. Rapid diagnosis of old world leishmaniasis by high-resolution melting analysis of the 7SL RNA gene. J Clin Microbiol, 2010; 48:2240–2242.

27.

Noyes

, Chance

, Ponce

, Maingon

. Leishmania chagasi: genotypically similar parasites from Honduras cause both visceral and cutaneous leishmaniasis in humans. Exp Parasitol, 1997; 85:264–273.

28.

Noyes

, Camps

, Chance

. Leishmania herreri (Kinetoplastida; Trypanosomatidae) is more closely related to Endotrypanum (Kinetoplastida; Trypanosomatidae) than to Leishmania. Mol Biochem Parasitol, 1996; 80:119–123.

29.

Noyes

, Reyburn

, Wendy

, Smith

. A nested-PCR based Schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of Leishmania tropica in Pakistan. J Clin Microbiol, 1998; 36:2877–2881.

30.

Parvizi

, Mauricio

, Aransay

, Miles

, Ready

. First detection of Leishmania major in peridomestic Iranian sandflies: comparison of nested PCR of nuclear ITS ribosomal DNA and semi-nested PCR of minicircle kinetoplast DNA. Acta Trop, 2005; 93:75–83.

31.

Peters

, Al-Zahrani

. The leishmaniases–a public health problem in Saudi Arabia. Saudi Med J, 1987; 8:333–343.

32.

Peters

, El-Bihari

, Liu

. Leishmania infecting man and wild animals in Saudi Arabia 1. General survey. Trans R Soc Trop Med Hyg, 1985; 79:831–839.

33.

Pogue

, Koul

, Lee

, Dwyer

, Nakhasi

. Identification of intra- and interspecific Leishmania genetic polymorphisms by arbitrary primed polymerase chain reactions and use of polymorphic DNA to identify differentially regulated genes. Parasitol Res, 1995; 81:282–290.

34.

Rassi

, Gassami

, Javadian

, Rafizadeh

et al. Vectors and reservoirs of cutaneous leishmaniasis in Marvdasht district, Southern Islamic Republic of Iran. La Revue de Sante de la Mediterranee orientale., 2007; 13:686–693.

35.

Reithinger

, Dujardin

J-C

. Molecular diagnosis of leishmaniasis: current status and future applications. J Clin Microbiol, 2007; 45:21–25.

36.

Rodgers

, Popper

, Wirth

. Amplification of kinetoplast DNA as a tool in the detection and diagnosis of Leishmania. Exp Parasitol, 1990; 71:267–275.

37.

Rotureau

, Ravel

, Nacher

, Couppié

et al. Molecular epidemiology of Leishmania (Viannia) guyanensis in French Guiana. J Clin Microbiol, 2006; 44:468–473.

38.

Saiki

, Gelfand

, Stoffel

, Scharf

et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 1988; 239:487–491.

39.

Saitou

, Nei

. The neighbour joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol, 1987; 4:406–425.

40.

Schönian

, Schweynoch

, Zlateva

, Oskam

et al. Identification and determination of the relationships of species and strains within the genus Leishmania using single primers in the polymerase chain reaction. Mol Biochem Parasitol, 1996; 77:19–22.

41.

Schönian

, Schn

, El Fari

, Oskam

et al. Genetic heterogeneity in the species Leishmania tropica revealed by different PCR-based methods. Trans R Soc Trop Med Hyg, 2001; 95:217–224.

42.

Silveira

, Ishikawa

EAY

, De Souza

AAA

, Lainson

. An outbreak of cutaneous leishmaniasis among soldiers in Bele'm, Para’ State, Brazil, caused by Leishmania (Viannia) lindenbergi n. sp. A new leishmanial parasite of man in the Amazon region. Parasite, 2002; 9:43–50.

43.

Sneath

PHA

, Sokal

. Numerical Taxonomy. San Francisco: W. H. Freeman, 1973.

44.

Swofford

. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods) Version 4.0. Sunderland, MA: Sinauer Associates, 2002.

45.

Tibayrenc

, Neubauer

, Barnabe

, Guerrini

et al. Genetic characterization of six parasitic protozoa: parity between random-primer DNA typing and multilocus enzyme electrophoresis. Proc Natl Acad Sci USA, 1993; 90:1335–1339.

46.

Van De Peer

, De Wachter

. TREECON: a software package for the construction and drawing of evolutionary trees. Comput Appl Biosci, 1994; 9:177–182.

47.

Welsh

, Pretzman

, Postic

, Saint Girons

et al. Genomic fingerprinting by arbitrarily primed polymerase chain reaction resolves Borrelia burgdoferi into three distinct phyletic groups. Int J Syst Bacteriol, 1992; 42:370–377.

48.

WHO. Cutaneous leishmaniasis: Why are you neglecting me? WHO/CDS/NTD/IDM/2007.3. 2007. http://whglibdoc.who.int/hg/2007/WHO_CDS_NTD_IDM_2007.3.eng.pdf