Retrospective Diagnosis of West Nile Virus Infection in a Patient with Meningoencephalitis in Tuscany,Italy

W est Nile virus (WNV) belonging to the Flaviviridae family (Karabatsos 1985) is transmitted in natural cycles between birds and mosquitoes, but humans and horses are susceptible and represent dead-end hosts (Kulasekera et al. 2001). WNV has been detected in Africa, the Middle East, Asia, and North America, and, in the last 30 years, has been causing serious infections in humans in Europe and in the Mediterranean Basin (Hubalek and Halouzka 1999, Calistri et al. 2010). In Italy, the first cases of equine WNV infection were detected in 1998, whereas the first human cases were identified in 2008 (Autorino et al. 2002, Macini et al. 2008). To identify cases of WNV neuroinvasive disease occurring before the activation of the surveillance program in Italy, we retrospectively analyzed cerebrospinal fluid (CSF) samples referred to the Virology Laboratory during May–September 2007–2008, for the presence of WNV. CSF samples from 52 patients with suspected viral encephalitis or meningoencephalitis, but with negative viral test results (routine polymerase chain reaction [PCR] and serology tests for herpes simplex virus, varicella zoster virus, enteroviruses, tick-borne encephalitis virus, Toscana virus, and other neurotropic viruses), were selected for this study. Moreover, when it was possible, the respective patients' serum sample was tested for the presence of WNV-specific IgM antibodies. In this study, we report the first case of WNV infection in a 21-year-old woman admitted at the “Misericordia” Hospital of Grosseto, in Tuscany, in August 2007. The patient of Romanian nationality, living in Grosseto since 3 weeks, began to have clinical symptoms such as intense headache, nausea, rachialgia, and fever of 38°C. After 2 days, she was admitted to the hospital, with clinical symptoms such as nuchal rigidity, photophobia, nausea, and vomiting. A complete blood count showed leukocytosis (12.19×10⁹/L) and the remaining parameters in normal ranges. A computed axial tomography of the skull did not show significant pathological data. A sample of CSF, obtained at admission, showed 11 leukocytes/mm³ (reference range 0–5 leukocytes/mm³) and unaltered biochemical parameters. CSF was tested for the presence of viral, bacterial, and fungal pathogens. No infectious agent was detected by bacterial or fungal culture. The PCRs for the detection of adenovirus, herpes virus type 1–2, HHV-6, Epstein-Barr virus, Cytomegalovirus, enteroviruses, tick-borne encephalitis virus, and Toscana virus were negative. Serological analysis performed on serum sample toward the commonest viruses did not show an active viral infection. The clinical conditions of patient improved after 5 days and she was discharged from the hospital after 10 days.

In this retrospective study, CSF was later tested for the presence of WNV by reverse transcription–PCR and it resulted positive. Virus detection was confirmed by sequence analysis of the PCR product, a fragment of 200 bp, partly overlapping the nucleocapsid C gene (Accession No. HQ849483). The sample showed a higher homology (98%) with the equine strain isolated in Tuscany in 1998 (accession no. AF404757.1) than (96%) with the strain circulating in Romania (accession no. AF260969). Briefly, 10 μL of RNA (extracted from 200 μL of sample by using QIAamp Viral RNA mini kit; Qiagen) was amplified using the forward primer 5′ ATGTCTAAGAAACC 3′ (nt 97–116 of the complete genome) and the reverse primer 5′ TGCTTCATTGCTGTTTGTTT 3′ (nt 316–335), partly overlapping the nucleocapsid C gene. The product was then subjected to a semi-nested PCR by using the reverse primer and a new forward primer 5′ GTCAATATGCTAAAACGC 3′ (nt 136–153), giving a fragment of 200 bp. The cycling conditions were an initial step at 94°C for 5 min, a reverse transcription for 30 min at 37°C, followed by 40 cycles at 94°C for 30 s, 51°C for 25 s, and 72°C for 30 s. The same temperature parameters were used for the nested PCR. The serum sample, tested against WNV (Euroimmun) by immunofluorecence (IFA), was positive for specific IgM and IgG. Our study highlights the presence of a WNV neuroinvasive infection, dated 2007, a year before WNV outbreaks occurred in the Northeast Italy, during 2008–2009 (Rossini et al. 2008, Savini et al. 2008, Rizzo et al. 2009). Currently, government plans have established monitoring of virus circulation in the medical and veterinary field, in those areas where the presence of the virus has been demonstrated (Department of Prevention and Communication 2010). Moreover, because of the low prevalence of antibodies to WNV in the human population in Italy (Spataro et al. 2008, Rizzo et al. 2009), additional epidemic outbreaks of human disease from WNV can be expected in the future. Thus, the spatiotemporal distribution of WNV infections in humans and animals has important implications for the surveillance and management of public health threats from WNV.

These new data show that WNV was already present in Italy in 2007 and underscores the importance of maintaining a high level of epidemiological surveillance and health throughout the Italian territory.