Isolation of Yellow Fever Virus from Mosquitoes in Misiones Province,Argentina

Abstract

Yellow fever (YF) is a viral hemorrhagic fever endemic to tropical regions of South America and Africa. From 2007 to 2009 an important epidemic/epizootic of YF was detected in different populations of howler monkeys (Alouatta species) in Misiones, a northeastern Argentinian province. Yellow fever virus (YFV) infection was researched and documented by laboratory tests in humans and in dead Alouatta carayá. The objective of that research was to investigate the circulation of YFV in mosquitoes, which could be implicated in the sylvatic transmission of YF in Argentina. The above-mentioned mosquitoes were captured in the same geographical region where the epizootic took place. A YFV strain was isolated in cell culture from pools of Sabethes albiprivus. This study is not only the first isolation of YFV from mosquitoes in Argentina, but it is also the first YFV isolation reported in the species Sabethes albiprivus, suggesting that this species might be playing a key role in sylvatic YF in Argentina.

Introduction

Y ellow fever (YF) is an important re-emerging arboviral disease and a cause of severe illness and death in South America and Africa. The agent of the disease is yellow fever virus (YFV), the prototype member of the family Flaviviridae. It is characterized by a single-stranded positive-sense RNA genome of approximately 11 kb in length, which is arranged into a short 5′ non-coding region (5′NCR), a single long open-reading frame encoding the structural proteins capsid (C), premembrane (prM), envelope (E), seven non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS5) and a 3′ non-coding region (3′NCR). Both, 5′NCR and 3′NCR are essential to virus replication (Wang et al. 1996).

It is considered that this virus originated in Africa and was introduced into the New World in slave ships bearing active cases of YF by infected Aedes aegypti mosquitoes (Bryant et al. 2007). The enzootic transmission cycle involves two components: the mosquitoes and the nonhuman primates. In Africa the vector involved in this enzootic cycle is a mosquito from the genus Aedes, whereas in South America the vectors associated with the transmission cycle are mosquitoes from the genera Haemagogus and Sabethes (Monath 1999; Vasconcelos 2003; Camargo-Neves et al. 2005).

Currently, nucleotide sequencing studies of structural gene regions and 3′NCR delineated seven genotypes of YFV worldwide: five genotypes in Africa, and two in South America. In this context, the Brazilian and Peruvian YFVs represent the two major South American YFV genotypes I and II, respectively (Bryant et al. 2003b). Specifically in Argentina, the last YFV outbreak was detected in Corrientes and Misiones provinces in 1966, in which a total of 53 human cases were notified: 41 in Misiones province and 12 in Corrientes province. However, only five cases were confirmed by means of virological and/or histopathological studies. At that time, the mosquitoes collected in the field yielded negative results (Sabattini et al. 1998). More recently, a YFV outbreak was seen in the same provinces from November 2007 to February 2009 (Holzmann et al. 2010), involving the illness and death of humans and howler monkey populations. In this outbreak, YFV was confirmed by laboratory tests in 9 human cases and 16 dead howler monkeys (unpublished data). Nevertheless, the role of mosquitoes as potential vectors in the transmission cycle of this epizootic is still unknown. Therefore, the main goal of this study was to investigate mosquito species that could play a role in the sylvatic transmission of YFV in Argentina.

Materials and Methods

Study areas, collection methods, and identification of exemplars

Mosquito captures were carried out in Misiones province, Argentina (Fig. 1) from January 7 to January 14, 2009. The sampling localities were selected based on the places where YFV was confirmed in dead howler monkeys. One of the sampling sites was Garupá, which is a rural area 16 km away from Posadas city (27° 29’65” S/55° 52’52” W), with a population of around 70,000 inhabitants. The second site was Tres Capones (28° 01’00” S/55° 37’22” W), a rural area 60 km away from Posadas city with 1234 inhabitants. Both sites have similar climatic conditions, characterized by a mean annual temperature of 21.5°C (range 15–35°C), high humidity (74%), and annual rainfall averages 2000 mm. Forests in this region are classified as deciduous stationary forest because of the low temperatures during the winter season. The landscape is dominated by plantations of yerba mate (Ilex paraguariensis) and ranching, which demonstrates the extensive human influence on the environment. The sites are characterized by a mosaic of vegetation surrounded by areas dedicated to cattle breeding and forest in galleries along rivers. Monkey populations live in the gallery forests where they can find water and food.

FIG. 1.

Location of the capture area.

Capture of adult mosquitoes was carried out with CDC traps. The traps operated for 24 continuous hours in each site, in periods from 8 am to 5 pm and from 5 pm to 8 am. They were set at 1.6 m above ground. The attractive element in this type of trap was carbon dioxide (CO₂-baited), supplied by dry ice. A total of 25 traps were distributed in the study sites; 10 traps were used in Tres Capones and 15 traps in Garupá.

In addition, manual capture was performed at ground level and at the forest canopy level at an elevation of approximately 10–15 m, depending on the local trees and vegetation, by using entomologic net and bottle-type manual vacuums. The collections took place from 9 am to 5 pm in places where monkey death had occurred. Only one collector was placed at canopy level, whereas seven collectors were placed on the ground.

Insects collected in the field were placed in labeled tubes, frozen in liquid nitrogen, and shipped to the Instituto Nacional de Enfermedades Virales Humanas (INEVH) laboratory. Upon arrival at the laboratory, the specimens were sorted under a stereoscopic microscope on a chilled table by species, capture method, location, and date of collection. Due to the damage suffered during the collection and shipping, many specimens were only identified to the genus level, and when possible, they were also identified to the level of species. Morphological identification of all species was done by means of the key from Darsie (1985). In addition, a molecular characterization of the specimens was performed using the mitochondrial gene cytochrome I (COI) as genetic marker. DNA was extracted from two legs of each individual using a standard phenol-chloroform method. A 445-bp segment was amplified by standard PCR procedures, using the universal insect primer CI-J-1718 (forward). and a reverse primer designed as the complementary sequence of the CI-J-2183 (Simon et al. 1994). Sequences were obtained using ABI PRISM 3100 DNA Analyzer equipment. The COI sequences of virus-positive mosquitoes were deposited in the GenBank database under accession numbers GU992947, GU992948, GU992949, GU992950, and GU992951.

Virus isolation

Pools of mosquitoes were triturated in sterile grinders containing 1 mL of phosphate-buffered saline solution with 0.75% bovine albumin, penicillin (100 units/mL), and streptomycin (100 μg/mL). The homogenate was centrifuged at 14,000 rpm for 10 min. A 0.2-mL aliquot of each original suspension of mosquitoes from the genus Sabethes or Haemagogus was inoculated into a mammalian cell line derived from monkey Vero C/76 cells, and in a cell line derived from Aedes albopictus C6/36 in order to isolate the YFV. Cell cultures were observed daily for cythopatic effect for 14 days. Virus isolates were identified by inmunofluorescence using specific monoclonal antibodies against YFV (Mab FA 2D12).

The minimum infection rate (MIR) of the mosquitoes was calculated as the ratio of the total number of YFV-positive pools to the total number of mosquitoes processed of that species×100 (Walter et al. 1980; Katholi and Unnasch 2006).

Reverse-transcription PCR and sequencing

RNA was extracted using TRI Reagent^™ (Sigma-Aldrich, St. Louis, MO) from original suspensions of mosquitoes and from cell culture supernatants of the original isolations. After that, a reverse-transcription polymerase chain reaction (reverse-transcription PCR) was performed to amplify YFV-specific nucleic acid by using primers previously described in Sánchez-Seco and associates (2006). The amplicons of the expected size (505 bp) were cut from the agarose gel, purified by a QIAquick kit (Qiagen, Valencia, CA) according to the manufacturer's protocol, and finally sequenced directly from both strands for verification using ABI PRISM 3100 DNA Analyzer equipment.

In order to analyze the YFV genotype, sequence data were obtained from fragments of two genomic regions, one spanning the terminal portion of NS5 and the proximal region of the 3′NCR using primers EMF (5′TGGATGACKGARGAYAT) and VD8 (5′GGGTCTCCTCTAACCTCTAG; Vasconcelos et al. 2004), and a second fragment from the genomic region comprising the premembrane (prM) and envelope (E) glycoprotein genes, using the genomic-sense primer (5′CTGTCCCAATCTCAGTCC), and the genomic-complementary primer (5′AATGCTTCCTTTCCCAAAT; Bryant et al. 2003a). The amplicons of the expected size (595 bp and 670 bp, respectively) were cut from the agarose gel, purified using a QIAquick kit, according to the manufacturer's protocol, and sequenced directly from both strands of each reverse-transcription PCR product for verification using ABI PRISM 3100 DNA Analyzer equipment.

Phylogenetic analysis

A fragment of 670 bp corresponding to the prM/E region and other fragment of 595 bp corresponding to the NS5/3′NC region were sequenced and deposited in the GenBank nucleotide sequence under accession numbers HQ123568; HQ123569; HQ123570; HQ123571 (preM/E); HQ123572; HQ123573; HQ123574; HQ123575 (NS5/3′NCR).

The sources, geographic origins, and GenBank accession numbers of the prM/E junction and the NS5/3′NCR sequences of YFV used in the phylogenetic analysis are listed in Table 1.

Table 1.

prM/E Junction and NS5/3′NCR Sequences Used in the Analysis

	GenBank accession number
	Origin/year of isolation	Abbreviation	Source^a	State^a	prM/E	NS5/3′NCR
PP123	Argentina/2009	Arg_09	Sabethes albiprivus	Misiones	HQ123571	HQ123575
PA5343	Argentina/2008	Arg_08A	Alouatta carayá	Misiones	HQ123570	HQ123574
PA5342	Argentina/2008	Arg_08B	Alouatta carayá	Misiones	HQ123569	HQ123573
PH71191	Argentina/2008	Arg_08C	Human	Misiones	HQ123568	HQ123572
SPH188002	Brazil/2000B	Brz_00B	Human	SP	FJ875515	FJ875521
SPAn288183	Brazil/2008E	Brz_08E	Monkey	SP	FJ875518	FJ875528
SPAn288184	Brazil/2008F	Brz_08F	Monkey	SP	FJ875519	FJ875529
SPAn289568	Brazil/2008H	Brz_08H	Monkey	SP	FJ875520	FJ875531
BeAn23536	Brazil/60	Brz_60	Cebus spp.	ND	AY540441	AY541338
BeAr233436	Brazil/73A	Brz_73A	Haemagogus spp.	ND	AY540452	AY541347
BeH379501	Brazil/80	Brz_80	Human	ND	AY540456	AY541358
BeH413820	Brazil/83	Brz_83	Human	ND	AY540457	AY566273
V528A	Colombia/79	Col_79	Human	ND	AY540475	AY541403
CAREC788379	Trinidad/79	Trin_79	Haemagogus spp	ND	DQ872412
1345	Ecuador/81	Ecu_81	Human	ND	AY540477	AY541405
OBS 5041	Ecuador/97	Ecu_97	Human	ND	AY540478	AY541406
614819	Panama/74	Pan_74	Human	ND	AY540479	AY541412
ARV0548	Peru/95M	Peru_95M	Human	S. Martín	AY161946	AY541430
03-5350-98	Peru/98B	Peru_98B	Human	Cusco	AY161948	AY541432
OBS7687	Bolivia/99	Blv_99	Human	ND	AY540431	AY541326
35720	Venezuela/98A	Vnz_98A	Human	Amazonas	AY540489	AY541443
Asibi	Ghana/27	Ghana_27	Human	ND	AY640589	AY326411
A 709-4-A2	Uganda/48	Uga_48	Aedes africanus		AF369694	———–
Car77(883)	Central African Republic/77	Cen	Ae. africanus	ND	U52392	U52393
BeAr 46299	Brazil/62A	Brz_62A	Haemagogus sp.	ND	AY540442	AY541339
BeAr 142658	Brazil/68C	Brz_68C	Haemagogus sp.	ND	AY540447	AY541342
BeAn142028	Brazil/68A	Brz_68A	Monkey	PA	AY540445	AY541341
1362/77	Peru/77A	Peru_77A	Human	Ayacucho	AY161927	AY541413
287/78	Peru/78	Peru_78	Human	San Francisco	AY161930	AY541416
1899/81	Peru/81A	Peru_81A	Human	Cusco	AY161932	————-
OBS2243	Peru/95L	Peru_95L	Human	Huanuco	AY161945	————-
OBS7904	Peru/99	Peru_99	Human	S. Martín	AY161951	AY541435
BeH425381	Brazil/84A	Brz_84A	Human	AP	AY540458	AY541362
BeH203410	Brazil/71	Brz_71	Human	PA	AY540449	AY541344
BeAr350397	Brazil/78B	Brz_78B	Haemagogus sp.	PA	AY540454	AY541353
BeH385780	Brazil/80B	Brz_80B	Human	PA	AY540455	AY541357
OBS6530	Peru/98A	Peru_98A	Human	Cusco	AY161947	AY54143
BeAr424083	Brazil/84D	Brz_84D	Hg. albomaculatus	PA	AY540459	AY541365
BeH511843	Brazil/91B	Brz_91B	Human	RR	AY540461	AY541377
BeAn512943	Brazil/92A	Brz_92A	Hg. janthinomys	MS	AY540463	AY541379
BeAr513008	Brazil/92B	Brz_92B	Sabethes sp.	MS	AY540464	AY541380
BeH512772	Brazil/92C	Brz_92C	Human	MS	AY540465	AY541381
BeAr513060	Brazil/92D	Brz_92D	Haemagogus sp	MS	AY540466	AY541382
BeAr527785	Brazil/94A	Brz_94A	Sa. chloropterus	MG	AY540468	AY541386
BeAr527198	Brazil/94B	Brz_94B	Haemagogus sp	MG	AY540469	AY541387
BeAr527547	Brazil/94C	Brz_94C	Haemagogus sp	PA	AY540470	AY541388
BeAr544276	Brazil/96A	Brz_96A	Hg. janthinomys	RO	AY540472	AY541393
BeH613582	Brazil/99E	Brz_99E	Human	PA	HM582843	AY541401
BeAr628124	Brazil/2000A	Brz_00A	Hg. janthinomys	TO	AY540436	AY541328
BeH622205	Brazil/2000D	Brz_00D	Human	GO	HM582849	AY541331
BeAr631464	Brazil/2001B	Brz_01B	Sa. chloropterus	BA	HM582848	AY541333
INS347613	Colombia/85	Col_85	Human	ND	AY540476	AY541404
ARVO544	Peru/95A	Peru_95A	Human	S. Martín	AY161934	AY541419
HEB4224	Peru/95B	Peru_95B	Human	S. Martín	AY161935	AY541420
HEB4236	Peru/95C	Peru_95C	Human	Pasco	AY161936	AY541421
Cepa#2	Peru/95E	Peru_95E	Human	Puno	AY161938	AY541423
Cepa#1	Peru/95F	Peru_95F	Human	Puno	AY161939	AY541424
OBS2240	Peru/95G	Peru_95G	Human	Huanuco	AY161940	AY541425
OBS2250	Peru/95H	Peru_95H	Human	Huanuco	AY161941	AY541426
HEB4240	Peru/95I	Peru_95I	Human	Junin	AY161942	AY541427
HEB4246	Peru/95K	Peru_95K	Human	Junin	AY161944	AY541429
OBS6745	Peru/98C	Peru_98C	Human	Cusco	AY161949	AY541433
IQT5591	Peru/98D	Peru_98D	Human	Loreto	AY161950	AY541434
GML902621	Trinidad/54	Trin_54	Alouatta sp.	ND	DQ872411	AY541436
CAREC889920	Trinidad/88	Trin_88	Haemagogus sp.	S.E. Trin	AY540482	AY541437
CAREC890692	Trinidad/89A	Trin_89A	Sa. chloropterus	S.E. Trin	AY540483	AY541438
CAREC891957	Trinidad/89C	Trin_89C	Alouatta sp.	S.E. Trin	AY540485	AY541439
P128MC	Venezuela/59	Vnz_59	Monkey	ND	AY540487	AY541441
PHO42H	Venezuela/61	Vnz_61	Human	Tachira	AY540488	AY541442

AP, Amapa; BA, Bahia; GO, Goias; MG, Minas Gerais; MS, Mato Grosso do Sul; PA, Pará; RO, Rondônia; RR, Roraima; SP, Sao Paulo; TO, Tocantins; ND, no data.

Sequences were edited and aligned with the BioEdit program and the Clustal Wallis method (available from http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The program TREEVIEW was used to obtain the graphic output (Page 1996).

The phylogeny of the sequences was constructed using the Bayesian analysis, Neighbor Joining, and Parsimony methods. Bayesian analysis was performed using MR. BAYES 3.1.2 (Ronquist and Huelsenbeck 2003). The best model suggested by jModeltest 01.1 was TIM2 (Posada 2008). Because of limited availability of models in MR. BAYES, the selected parameters used were: number of substitutions (nst) 2, and rates inv gamma. The Markov Chain Monte Carlo was 5,000,000 generations long, sampling every 100 generations, for a total of 50,001 samples. Of these, the first 2500 were discarded as burn-in to assure reaching a plateau. Maximum parsimony analysis was performed using the TNT v1.0 program (Goloboff et al. 2000), and Jackknife support values were obtained using 1000 replicates. Neighbor Joining trees were constructed with MEGA 5 Software (Tamura et al. 2011). The nucleotide distance was calculated by using the Kimura-2+G method and bootstrap analyses with 1000 pseudoreplicates.

In all cases, to enable better rooting of the phylogenetic tree, the strains Car77, Asibi, and a strain of YFV from Uganda were added as outgroups.

Results

During the study period, a total of 495 mosquitoes were captured: 395 at Garupá and 100 at Tres Capones. They were sorted into 128 pools (98 pools from Garupá mosquitoes and 30 pools from Tres Capones mosquitoes).

The sample obtained in Garupá was larger than the one obtained in Tres Capones for both capture methods (Table 2). However, at both sampling sites, the great majority of mosquitoes were caught with CDC traps. In addition, the number of mosquitoes captured on the forest canopy level was lower than on the ground level. It is important to mention that the sampling effort was mainly focused on the ground.

Table 2.

Mosquito Species Collected Using Different Methods of Capture in Garupá and Tres Capones, Misiones Province, Argentina During January 2009

	Garupa^a			Tres Capones^a
Species collected	Ground	Canopy	CDC traps	Ground	Canopy	CDC traps	Total
Aedes (Ste.) aegypti			1 (1)				1(1)
Anopheles spp.			34 (7)			12 (8)	46 (15)
Coquillettidia (Rhy.) sp.			4 (1)			21 (1)	25 (2)
Culex spp.	40 (2)		150 (7)			28 (3)	218 (12)
Haemagogus (Con.) leucocelaenus	7 (5)	2 (1)	5 (4)				14 (10)^b
Mansonia (Man.) indubitans			1 (1)			4 (2)	5 (3)
Mansonia (Man.) spp.			10 (1)			4 (1)	14 (2)
Ochlerotatus albifasciatus			1 (1)				1 (1)
Ochlerotatus spp.	4 (2)		9 (2)	6 (1)		3 (2)	22 (7)
Psorophora (Jan.) albipes				1 (1)			1 (1)
Porophora (Jan.) cyanescens				1 (1)			1 (1)
Psorophora (Jan.) ferox				4 (3)			4 (3)
Psorophora (Jan.) sp.						2 (1)	2 (1)
Sabethes (Sab.) albiprivus	24 (8)	6 (2)	12 (6)	7 (3)	1 (1)		50 (20)^b
Sabethes (Pey.) aurescens	4 (3)		3 (1)				7 (4)^b
Sabethes (Sab.) belisarioi		1 (1)					1 (1)^b
Sabethes (Sbo.) chloropterus	23 (10)	1 (1)	8 (4)			1 (1)	33 (16)^b
Sabethes (Pey.) identicus	18 (6)		2 (2)				20 (8)^b
Sabethes (Sbn.) intermedius	6 (5)						6 (5)^b
Sabethes (Pey.) undosus	2 (2)		2 (1)				4 (3)^b
Sabethes (Sab.) sp.	5 (3)		4 (3)				9 (6)^b
Shannoniana fluviatilis			1 (1)				1 (1)
Uranotaenia (Ura.) sp.			3 (1)				3 (1)
Wyeomyia (Wyo.) oblita	1 (1)	1 (1)		5 (1)			7 (3)
Wyeomyia sp.			1 (1)				1 (1)
Total	134 (47)	11 (6)	250 (45)	24 (10)	1 (1)	75 (19)	495 (128)

Number mosquitoes captured (number of pools).

Pools tested for virus isolation attempt.

Culex mosquitoes were the most abundant genus, followed by Sabethes. The predominant species among the Sabethes genus were Sa. albiprivus and S. chloropterus. Manual capture was more successful than CDC traps for trapping Sabethes mosquitoes, including Sa. albiprivus. Specimens of genera Aedes, Shannoniana, and Wyeomyia were less representative.

All of the 128 pools were tested for flavivirus by reverse-transcription PCR. In addition, the 73 pools belonging to genera Haemagogus and Sabethes were also tested for virus isolation (Table 2).

The 50 captured specimens of Sa. albiprivus were sorted into 20 pools, and one of them was positive for YFV with the two techniques used. The YFV strain was isolated in Vero C/76 and C6/36 cell cultures. Both lines of cells showed cytopathic effect at day 6 after inoculation. This positive pool included seven individuals collected in Garupá. The calculated MIR was 2%. None of the remaining pools showed any positive results.

The Bayesian analysis of the nucleotide sequence of a 670-bp fragment of a genomic region prM/E (Fig. 2), and a 595-bp fragment of the NS5/3′NCR (data not shown), demonstrated that the YFV strain isolated from Sa. albiprivus is positioned together with other YFV strains isolated from Argentina and Brazil in 2008.

FIG. 2.

Bayesian analysis based on a 670-bp fragment from the yellow fever virus (YFV) genome structural region prM/E. This analysis used the TIM2 model, as suggested by jModeltest. Numbers above the nodes represent posterior probabilities of those branches. The sequences of YFV from Uganda, Ghana, and the Central African Republic were used as outgroup (Arg, Argentina; Brz, Brazil; Trin, Trinidad; Vnz, Venezuela; Col, Colombia; Pan, Panamá; Ecu, Ecuador, Blv, Bolivia; Cen, Central African Republic; Uga, Uganda).

Discussion

Between 2007 and 2009, sylvatic YF outbreaks were documented in northeastern Argentina. From December 2008 to February 2009, several deaths among howler monkeys (A. carayá) were reported in southern Misiones province. Naturally YFV acquired infections in the neotropical forest may result in disease and death in monkey population; indeed, the finding of dead howler monkeys (Alouatta sp.) has signaled the occurrence of a YF epizootic (Monath 1989).

Previous studies reported the isolation of YFV from human cases of a YF outbreak that occurred in 1966 in Corrientes and Misiones provinces, Argentina (Barrera Oro et al. 1966). Since then, no human or monkey cases have been reported, and thus our knowledge of sylvan vectors of YF in Argentina is scarce.

Haemagogus and Sabethes mosquitoes are distinctly diurnal biters, with peak activity seen during the afternoon, and previous studies about host preference clearly show that these genera are strongly attracted to humans (Monath 1989; Castro Gomez et al. 2010). Therefore, this behavior may explain the fact that manual capture was more successful than CDC traps for trapping Sabethes mosquitoes, including Sa. albiprivus.

All mosquitoes captured were studied for flavivirus detection using reverse-transcription PCR; however, Sabethes and Haemagogus genus mosquitoes were selectively tested for YFV because these genera have been associated with transmission of YFV in sylvatic areas in South America (Monath 1999; Vasconcelos 2003; Camargo-Neves et al. 2005). In 2001 and 2008 strains of YFV were isolated from Haemagogus leucocelaenus, and from Aedes serratus in Rio Grande do Sul State, Brazil (Vasconcelos et al. 2003; Cardoso et al. 2010). Contrary to this finding, our study did not find any Ae. serratus in the sampling sites, and the population of Hg. leucocelaenus was very small. Sabethes was the most abundant genus after Culex, and Sa. albiprivus was the most representative species of the Sabethes mosquitoes. In fact, the geographic distribution of Sa. albiprivus includes Bolivia, Brazil, Argentina, Colombia, French Guiana, Paraguay, and Suriname.

Vectorial capacity of mosquitoes involved in YF transmission is profoundly affected by rainfall and temperature, which in turn follow definite seasonal patterns depending on latitude. The 2008–2009 summer was dry in the area of the outbreak. Mosquitoes from Sabethes genus had been implicated in the transmission of YFV in areas subjected to a prolonged dry season during which Haemagogus activity subsides; it is worth mentioning that mosquitoes from this genus are drought-resistant and long-lived (Monath 1989).

In the Americas, Haemagogus janthinomys, Hg. leucocelaenus, Hg. lucifer, and Sabethes chloropterus are captured preferentially in tropical rain forest habitat. In undisturbed forests their activity is often highly restricted to the canopy. However, where the forest is disturbed or replaced by lower trees and more open conditions (as in grassland-gallery forest areas), the vertical distribution of these species may change, increasing their activity at ground level. Moreover, deciduous forests associated with a pronounced dry season, such as the sampling localities, show less vertical stratification of all vector species, and the activity at ground level increases (Monath 1989).This may be one of the reasons why so few individuals were captured at the canopy level.

Different studies about population dynamics done in Rio Grande do Sul Brazil show small populations of mosquitoes of the genera Haemagogus and Sabethes, probably because of environmental degradation (Paterno and Marcondes 2004; Castro Gomez et al. 2009, 2010; Reis et al. 2010).

From 2007–2009 epidemic and epizootic outbreaks of YF occurred in Argentina, and several YFV strains were isolated from humans and howler monkeys (unpublished data). The phylogenetic analyses were carried out by sequence data based on the nucleotide sequences of the prM/E region, and NS5/3′NCR (data not shown) from 70 YFV strains. They were analyzed with the use of algorithms for parsimony method, for distance method (data not shown), and for Bayesian analysis (Fig. 2). The phylogenetic trees generated by these analyses had the same topology.

The phylogenetic analysis showed that the strain of YFV isolated from Sa. albiprivus is positioned together with other Argentinean YFV strains isolated from humans and monkeys, forming a well-supported clade (Fig. 2). Remarkably, in the same period, several YF cases in humans and monkeys were also diagnosed in Brazil and Paraguay (Secretaria de Saúde do Governo do Estado do Säo Paulo, Brasil 2009; Pan American Health Organization 2008). Previous studies revealed that Brazilian and Peruvian YFV strains are significantly divergent virus lineages that can be differentiated on the basis of molecular markers in both the structural proteins and the 3′NCR. (Bryant et al. 2003b). Our results reveal that the YFV strain isolated from Sa. albiprivus from Argentina is placed with other strains from the last YF outbreak that occurred in Brazil in 2008, within the genotype I clade (Fig. 2). This genotype was first reported in Brazil, suggesting that the outbreak in Argentina may be a spillover from Brazil.

In summary, the isolation of a YFV strain from Sa. albiprivus from Argentina reported in this study is the first case of YFV isolation from mosquitoes in this country. Furthermore, it is the first time that a YFV strain has been isolated from Sa. albiprivus. In general, the entomologic vigilance is principally focused on mosquitoes from genus Haemagogus; our results indicate the necessity of studying the population of species from genus Sabethes, including Sa. albiprivus, during YF outbreaks. These findings indicate that Sa. albiprivus is a putative vector of sylvatic YF, at least in Argentina. It is possible that Sa. albiprivus plays an important role in the maintenance of YFV, although further studies are necessary to determine its effectiveness as a YFV vector in the study area.

Footnotes

Acknowledgments

The authors wish to thank the anonymous reviewer for critical suggestions and advice that helped to improve previous versions of this article. They also gratefully acknowledge the personal support of O'Duyer German, Paura Jose, and Polidoro Cesar, and all the INEVH staff, and particularly to Luppo Victoria for technical assistance, and Bonano Diego for technical support. They also thank the Ministerio de Salud de la Provincia de Misiones and Dr. Julio Estevez, the Department of Environmental Health of Posadas City, and Mr. Albarenga Luis.

Author Disclosure Statement

No competing financial interests exist.

References

Barrera Oro

, Coronado

, Gutman Frugone

et al. Aislamiento del virus de la Fiebre Amarilla en la Argentina. Etiología de la epidemia de Corrientes y Misiones. Medicina, 1966; 26:239–245.

Bryant JE Barrett

ADT

. Comparative phylogenies of yellow fever isolates from Peru and Brazil. FEMS Immunol Med Microbiol, 2003b. 39:103–118.

Bryant

, Holmes

, Barrett

ADT

. Out of Africa: a molecular perspective on the introduction of yellow fever virus into the Americas. PLoS Pathogens, 2007; 3:668–673.

Bryant

, Wang

, Cabezas

et al. Enzootic transmission of yellow fever virus in Peru. Emerg Infect Dis, 2003a. 9:926–933.

Camargo-Neves

, Poletto

, Rodas

et al. Entomological investigation of a sylvatic yellow fever area in Sao Paulo State, Brazil. Cad Saude Publica, 2005; 21:1278–1286.

Cardoso

, Almeida

MAB

, Santos

et al. Yellow FEVER VIRUS in Haemagogus leucocelaenus and Aedes serratus mosquitoes, Southern Brazil. Emerg Infect Dis, 2010; 16:1918–1924.

Castro Gomes

, Paula

, Vitor Neto

et al. Culicidae (Diptera) em Área de Barragem em Santa Catarina e Rio Grande do Sul. Neotrop Entomol, 2009; 38:553–555.

Castro Gomez

, Torres

MAN

, Paula

et al. Ecologia de Haemagogus e Sabethes (Diptera: Culicidae) em áreas epizoóticas do vírus da febre amarela, Rio Grande do Sul, Brasil. Epidemiol Serv Saúde, 2010; 19:101–113.

Darsie

. Mosquitoes of Argentina. Part I. Keys for identification of adult females and fourth stages larvae in English and Spanish (Díptera:Culicidae) Mosquito Systematics, 1985; 17:153–253.

10.

Goloboff

, Farris

, Nixon

. TNT (Tree analysis using New Technology) (BETA) version 1.0 Published by the authors 2000. Tucumán, Argentina.

11.

Holzmann

, Agostini

, Areta

et al. Impact of yellow fever outbreaks on two howler monkey species. Am J Primatol, 2010; 72:475–480.

12.

Katholi

, Unnasch

. Important experimental parameters for determining infection rates in arthropod vectors using pool screening approaches. Am J Trop Med Hyg, 2006; 74:779–785.

13.

Monath

. Yellow fever. The Arboviruses: Epidemiology and Ecology. 5 Monath

. Boca Raton, FL: CRC Press, 1989; 139–231.

14.

Monath

. Yellow fever. Vaccines, 3rd Plotkin

, Orenstein

. Philadelphia: W.B. Saunders, 1999; 815–879.

15.

Page

. Tree View: an application to display phylogenetic trees on personal computers. Comput Appl Biosci, 1996; 12:357–358.

16.

Pan American Health Organization 2008. http://new.paho.org/bulletins/index.php?option=com_content&task=view&id=168&Itemid=304

17.

Paterno

, Marcondes

. Mosquitos matutinos de atividade antropofílica em Mata Atlântica, Florianópolis, SC. Revista de Saúde Pública, 2004; 38:133–135.

18.

Posada

. jModelTest: Phylogenetic Model Averaging. Molec Biol Evolution, 2008; 25:1253–1256.

19.

Reis

, Muller

, Marcondes

. Inventário de mosquitos (Diptera: Culicidae) da Unidade de Conservação Ambiental Desterro, Ilha de Santa Catarina, Sul do Brasil. Biota Neotrop, 2010; 10:333–337.

20.

Ronquist

, Huelsenbeck

. Mrbayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 2003; 19:1572–1574.

21.

Sabattini

, Avilés

, Monath

. Historical, epidemiological and ecological aspects of arboviruses in Argentina: Flaviviridae, Bunyaviridae and Rhabdoviridae. An Overview of Arbovirology in Brazil and Neighboring Countries. Travassos da Rosa

APA

, Vasconcelos

PFC

, Travassos da Rosa

JFS

. Belem, Brazil: Instituto Evandro Chagas, 1998; 113–134.

22.

Sánchez-Seco

, Rosario

, Hernández

et al. Detection and subtyping of dengue 1-4 and yellow fever viruses by means of a multiplex RT-nested-PCR using degenerated primers. Trop Med Int Health, 2006; 11:1432–1441.

23.

Secretaria de Saúde do Governo do Estado do Säo Paulo Brasil. 2009. http://portal.saude.gov.br/portal/arquivos/pdf/Boletim_FARS_280409.pdf

24.

Simon

, Frati

, Beckenbach

et al. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entom Soc Am, 1994; 87:651–701.

25.

Tamura

, Peterson

et al. MEGA5: Molecular evolutionary genetics analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony methods. Molec Biol Evolution, 2011; 28:2731–2739.

26.

Vasconcelos

PFC

, Sperb

, Monteiro

HAO

et al. Isolations of yellow fever virus from Haemagogus leucocelaenus in Rio Grande do Sul State, Brazil. Trans R Soc Trop Med Hyg, 2003; 97:60–62.

27.

Vasconcelos

PFC

, Bryant

, Rosa

et al. Genetic divergence and dispersal of yellow fever virus in Brazil: Periodic expansions of the enzootic zone. Emerg Infect Dis, 2004; 10:1578–1584.

28.

Vasconcelos

. Yellow fever. Rev Soc Bras Med Trop, 2003; 36:275–293.

29.

Walter

, Hildreth

, Beaty

. Estimation of infection rates in populations of organisms using pools of variable size. Am J Epidemiol, 1980; 112:124–128.

30.

Wang

, Weaver

, Shope

et al. Genetic variation in yellow fever virus: duplication in the 3′noncoding region of strains from Africa. Virology, 1996; 225:274–281.