Specific Molecular Detection of Anaplasma sp. Closely Related to Anaplasma phagocytophilum in Ixodid Ticks and Cattle in a Pastureland in Hokkaido,Japan

Abstract

Recent molecular analyses of the Anaplasma sp. closely related to Anaplasma phagocytophilum (previously believed to be A. phagocytophilum) in Japan have clarified its distinct phylogenetic position. PCR methods relying on 16S rRNA- and P44/MSP2-based primers designed to detect this species have low sensitivity and specificity. In this study, a highly sensitive and specific nested PCR method using newly designed primers based on heat-shock operon gene (groEL) was developed to detect this species. The method was later used in an epidemiological study testing DNA samples from 85 Ixodid ticks (collected by flagging) and 50 cattle from the same pastureland in Nakaosobetsu, Hokkaido, Japan. Results revealed prevalence rates of 2.4% (2 of 85) in ticks and 2% (1 of 50) in cattle. The present study also reported the first molecular detection of the Anaplasma sp. closely related to A. phagocytophilum in Japan in H. douglasii, and established a new reliable PCR method that detects this Anaplasma sp. closely related to A. phagocytophilum in Japan.

Introduction

T he phylogenetic position of Anaplasma sp. closely related to A. phagocytophilum in Japan has been established as distinct from A. phagocytophilum (Ybañez et al. 2012). Many research studies in Japan have previously considered this species as A. phagocytophilum and have used 16S rRNA-based PCR (Ohashi et al. 2005; Kawahara et al. 2006; Jilintai et al. 2009; Yoshimoto et al. 2010; Masuzawa et al. 2011) and P44/MSP2-based PCR (Ohashi et al. 2005; Wuritu et al. 2009; Murase et al. 2011) for its detection.

16S rRNA based-primers used in previous studies have low specificity that can detect any of the 2 organisms (Jilintai et al. 2009; Yoshimoto et al. 2010). Designing specific primers based on the 16S rRNA gene can be difficult due to a very close homology with A. phagocytophilum (Ybañez et al. 2012). On the other hand, P44/MSP2-based primers may also have low sensitivity because those 16S rRNA-based PCR-positive samples have negative results in the PCR assay using the former gene (Masuzawa et al. 2011). P44/MSP2-based PCR may also yield varied nucleotide product lengths due to a hypervariable region found within the gene (Wuritu et al. 2009); hence, relying on visual confirmation after gel electrophoresis of product amplicons maybe questionable without further sequencing. Blood smear examination may also be unreliable. So far, animals found to be PCR positive with this Anaplasma sp. were negative in the blood smears (Jilintai et al. 2009; Murase et al. 2011). Thus, molecular detection can be considered the most reliable detection method for this species.

In this study, a heminested PCR method using newly designed primers based on groEL was developed to detect Anaplasma sp. closely related to A. phagocytophilum in Japan. The method was tested in previously tested 16S rRNA-positive samples and in several other Anaplasma and Ehrlichia species to evaluate its sensitivity and specificity. The method was later used in DNA samples from ticks and cattle.

Materials and Methods

DNA Samples

Initially, DNA from 20 Anaplasma sp. closely related to A. phagocytophilum-positive samples that were determined by using 16S rRNA-based analysis was used to evaluate the sensitivity of the new PCR method. This included 10 Sika deer blood samples (Cervus nippon yesoensis) from Shizunai, Hokkaido, Japan (Jilintai et al. 2009) and 10 Ixodes persulcatus field samples from Sikaoi, Hokkaido, Japan. DNA from the following species were also used to evaluate the specificity of the new PCR method: Ehrlichia canis (supplied by Dr. Simonne Harrus, Israel), Ehrlichia muris (Tamamoto et al. 2007), Ehrlichia sp. from I. ovatus (supplied by Dr. H. Fujita, Japan), A. bovis (Jilintai et al. 2009), A. marginale (Ooshiro et al. 2009), A. centrale (Inokuma et al. 2001), A. platys (Inokuma et al. 2002), A. phagocytophilum from human (formerly human granulocytic ehrlichia, supplied by Dr. P. Brouqui, France), horse (formerly Ehrlichia equi, supplied by Dr. P. Brouqui, France), and cattle (supplied by Dr. G. Jouncour, France).

Additionally, ticks and cattle blood were collected from pastureland in Nakaosobetsu, Shibecha, Hokkaido, Japan, in May, 2011. A total of 85 Ixodid ticks, including 35 Haemaphysalis douglasii, 37 I. persulcatus, and 13 I. ovatus collected by flagging and 50 EDTA blood samples from cattle, were used. DNA was extracted using QIAamp DNA Mini Kit (QIAGEN, Valencia, CA), eluted with 200 μL of TE buffer, and stored at −30° until further use.

Primer design, DNA amplification, and purification methods

Primers were designed based on the groEL nucleotide sequences of Anaplasma sp. closely related to A. phagocytophilum in Japan (JN055359, JN055358). The sequences of the designed primers used in this study are indicated in Table 1. In the first phase of the heminested PCR, a final volume of 10 μL was used. It is composed of 4.5 μL of distilled water, 1 μL of 2 mM dNTP,1 μL of 10× PCR buffer, 0.4 μL MgCl₂ (50 mM), 0.5 μL of 10 μM of each primer, 0.1 μL Taq DNA polymerase (5 U/μL), and 1 μL of DNA template. The step-down cycling conditions were the following: Initial denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 72°C (with a 2° incremental decrease until reaching final annealing temperature at 65°C) for 30 sec and 72°C for 1.5 min, and final extension at 72°C for 5 min. In the second phase of the heminested PCR, a final volume of 25 μL was set. It was composed of 15.35 μL of distilled water, 2.5 μL of 2 mM deoxyribonucleotide triphosphates (dNTP), 2.5 μL 10×PCR buffer, 1 μL of MgCl₂, 1.25 μL of 10 μM of each primer, 0.1 μL of 5 units Taq polymerase, and 1 μL of the first PCR amplicon. The same cycling conditions as the first PCR were used. The negative and positive controls used were distilled water and Anaplasma sp. closely related to A. phagocytophilum from Sika deer in Japan (Ybañez et al. 2012), respectively. Amplification products were visualized using 1.5% agarose gel after migration, and were purified using either QIAquick PCR purification kit (QIAGEN, USA) or QIAquick Gel Extraction Kit (QIAGEN, USA).

Table 1.

Oligonucleotide Sequences of Primers Used

Primer Name	Oligonucleotide (5’(3’)	Reference
groEL
APJgR-324-F1	TGGGTCTGACATTGTAAGTATTCGG	This study
APJGr-364F2	AGCAAAAGAGGCGGTACTATCATCTCTG	This study
AnagroE712R	CCGCGATCAAACTGCATACC	Ybanez et al.,in press
16S rRNA
EC12A	TGATCCTGGCTCAGAACGAACG	Kawahara et al. 2006
EC9	TACCTTGTTACGACTT	Kawahara et al. 2006
SSAP2f	GCTGAATGTGGGGATAATTTAT	Kawahara et al. 2006
SSAP2r	ATGGCTGCTTCCTTTCGGTTA	Kawahara et al. 2006

Sensitivity and specificity of the PCR method

To evaluate its sensitivity, the groEL-based PCR method was tested in 20 Anaplasma sp. closely related to A. phagocytophilum-positive samples (using 16S rRNA) from Sika deer (Cervus nippon yesoensis) (Jilintai et al. 2009) and Ixodid tick samples. Random sequencing of 2 amplicons was performed to confirm positivity. DNA from an infected deer (Ybañez et al. 2012) was serially diluted using double-distilled water until 1×10⁻⁸, and was used as template in the 16S rRNA-based standard PCR using the internal primers and in the groEL-based standard PCR using internal primer and first outer reverse primer. 16S rRNA-based nested PCR and groEL-based heminested PCR were also performed using the same template. To evaluate specificity, these methods were tested using DNA from 3 A. phagocytophilum strains. The groEL-based method was further tested in 7 other Ehrlichia and Anaplasma species.

Sequencing and analyses

A direct sequencing method was performed using the same PCR internal primers. In cases where the sequence result was short, the amplicons were cloned into a vector using TOPO TA cloning (Invitrogen, USA) and sequenced using the primers provided with the product. Nucleotide sequence results were initially checked using BLAST for comparison to other known sequences. Percent identities were computed using EMBOSS pairwise alignment (using the local method) hosted by the European Bioinformatics Institute (www.ebi.ac.uk/Tools/emboss/align/index.html). Gaps were not considered in the final computation of % identities. The multiple alignment analysis was performed using MUSCLE program (Edgar, 2004) using the default parameters (also hosted by the European Bioinformatics Institute Website). Phylogenetic analyses were performed using a neighbor-joining method- maximum composite likelihood substitution model and a maximum likelihood method using the MEGA software version 5.05 (Tamura et al, 2011). The tree stabilities were estimated by bootstrap analysis for 1000 replications. Separate analyses using translated amino acid sequence characters were performed for comparison.

Nucleotide accession numbers

The nucleotide accession numbers of sequences used for comparison are indicated beside the organism`s name (Fig. 1). groEL sequences of Anaplasma spp. obtained in this study were registered at GenBank with accession numbers JQ317186 (from H. douglasii) and JQ317185 (from Sika deer).

FIG. 1.

Phylogenetic relationship of Anaplasma sp. from Haemaphysalis douglasii from Nakaosobetsu, Hokkaido, Japan, and Sika deer from Shizunai, Japan, with other Anaplasmataceae organisms based on groEL. The tree was analyzed using nucleotide sequences by neighbor-joining method(pairwise deletion) and supported by 1000 bootstrap replications. Rickettsia conorii was used as an outgroup.

Results

All samples that were found to be positive using the 16S rRNA-based PCR (Kawahara et al. 2006) were also found to be positive with the newly developed heminested PCR method (based on groEL). Direct sequencing from 2 randomly selected amplicons from the positive samples resulted in the targeted 228-bp nucleotide. All sequences revealed 99.6% (1-bp difference) homology with JN055360 (Anaplasma sp. closely related to A. phagocytophilum from Sika deer in Japan). For the groEL-based PCR, serial dilution assays showed a sensitivity limit of 1×10⁻³ for the standard PCR, and at least up to 1×10⁻⁸ for the heminested protocol (all of which demonstrated strong bands). On the other hand, 16S rRNA-based PCR only had sensitivity limits of 1×10⁻² and 1×10⁻⁴ for the standard and nested PCR assay, respectively (Fig. 2).

FIG. 2.

Sensitivities of the groEL- and 16S rRNA-based PCR assay by 10-fold serial dilution of DNA in standard PCR using internal primers (A) and heminested and nested PCR (B). DNA was obtained from blood of an infected Sika deer (Ybañez et al, in press). Lanes 1–10, represent assays of the same template dilutions of 1, 1×10⁻¹, 1×10⁻², 1×10⁻³, 1×10⁻⁴, 1×10⁻⁴, 1×10⁻⁵, 1×10⁻⁶, 1×10⁻⁷, 1×10⁻⁸, 1−10⁻⁹ for each panel, respectively. L and N represent the DNA ladder and negative control (distilled water), respectively.

The groEL-based PCR method was only positive in the Anaplasma sp. closely related to A. phagocytophilum, whereas the 16S rRNA-based PCR was positive in all these strains (Fig. 3). Moreover, the groEL-based PCR method was also negative in all other species of Ehrlichia and Anaplasma species used in this study (data not shown).

FIG. 3.

Specificities of the groEL- and 16S rRNA-based PCR assay in standard PCR using internal primers (A) and heminested and nested PCR (B). Lanes 1–4, Anaplasma sp. closely related to A. phagocytophilum from infected deer, A. phagocytophilum (HGE strain), A. phagocytophilum from horse, and A. phagocytophilum from cattle, respectively. L and N represent the DNA ladder and negative control (distilled water), respectively.

Testing the DNA samples obtained from Nakaosobetsu, Hokkaido, Japan, revealed prevalence rates of 2.4% (2 of 85) and 2% (1 of 50) in Ixodid ticks and cattle, respectively. The positive tick samples were 1 adult male and 1 nymph identified as H. douglasii. Sequencing of the strongest positive amplicon (from H. douglasii adult male) after cloning showed 228-bp nucleotide results that were 99.1% (2-bp difference) similar with JN055360. Phylogenetic analyses also demonstrated that this sequence clustered with the Anaplasma sp. closely related to A. phagocytophilum in Japan (JN055359 and JN055360) and not with other Anaplasma species. The clade was also supported by a high bootstrap value (Fig. 1). Similar results were also obtained when deduced amino acid sequences and/or maximum likelihood method was employed (data not shown).

Discussion

The newly developed PCR method based on groEL appears to be highly sensitive and specific in detecting Anaplasma species closely related to A. phagocytophilum in Japan as compared to the 16S rRNA-based PCR. The new method detected 100% of all 16S rRNA-positive samples and had a higher detection limit in both the standard and heminested PCR protocol than the 16S rRNA-based PCR. Results indicate that compared with the 16S rRNA-based PCR, the groEL-based PCR in the present study is 10 times more sensitive using the standard PCR protocol and at least 1000 times more sensitive using the heminested PCR protocol. The increased sensitivity of the groEL-based PCR over the 16S rRNA method needs further investigation and may also be useful in designing groEL-based molecular detection methods in other species. Moreover, It was also found to be more specific than the 16S rRNA-based PCR because it excluded other Ehrlichia and Anaplasma species. The use of groEL in designing a PCR method appears to be more advantageous because it is highly conserved at the intraspecies level than the P44/MSP2 (Wuritu et al. 2009), and more divergent at the interspecies level than the 16S rRNA gene (Sumner et al. 1997). Several studies on Anaplasma have been conducted using this gene (Sumner et al. 1997; Chae et al. 2000; Inokuma et al. 2002a; Inokuma et al. 2002b). Ybañez et al. (2012) also used this gene for the amplification of the Anaplasma species closely related to A. phagocytophilum in Japan, but its specificity and sensitivity were not evaluated. Moreover, the previous method amplifies the complete groEL fragment, whereas the groEL-based PCR in the present study amplifies only a partial fragment.

The prevalence rate in cattle (2.0% or 1 of 50) from Nakaosobetsu, Hokkaido, Japan, was within previously reported range of 1.0–3.4% (Jilintai et al. 2009; Murase et al. 2011), while that in Ixodid ticks (2.2% or 2 of 89) was lower than the previous report (7.1% by Murase et al. 2011). Molecular detection of Anaplasma sp. closely related to A. phagocytophilum in H. douglasii is the first report in such species so far. This pathogen has been detected before in I. persulcatus, I. ovatus (Ohashi et al. 2005) and H. megaspinosa (Yoshimoto et al. 2010). This result provides additional evidence of distinction of this Anaplasma sp. in Japan from A. phagocytophilum due to a varied range of possible tick vectors.

The Anaplasma sp.–positive cattle in this study was asymptomatic, similar to the findings of Jilintai et al. (2009). This is also similar to A. phagocytophilum infection in horses, wherein the persistent infection of the pathogen is not associated with any detectable clinical or pathological abnormalities (Franzen et al. 2009). However, the absence of symptoms and negative blood smears in relation to the pathogenesis of the Anaplasma sp. closely related to A. phagocytophilum needs further study. In conclusion, this study established a new reliable PCR method to detect the Anaplasma sp. closely related to A. phagocytophilum in Japan.

Footnotes

Acknowledgments

This research was supported in part by grants H21-Shinkou-Ippan-014 for Research on Emerging and Re-Emerging Infectious Diseases from the Japanese Ministry of Health, Labor, and Welfare. The authors would also like to thank Mr. Jose Ma. M. Angeles, Dr. Hassan Hakimi, and Ms. Rochelle Haidee D. Ybañez from the National Research Center for Protozoan Diseases, Japan for their technical support, Dr. Kazutoshi Maeno and Dr. Shin-Ichi Matsui for the cattle blood samples, and the students and staff from the Laboratory of Internal Medicine of Obihiro University, Japan, for the tick and blood collection.

Author Disclosure Statement

No competing financial interests exist.

References

Chae

J-S

, Foley

, Dumler

, Madigan

. Comparison of the nucleotide sequence of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from northern California. J Clin Microbiol, 2000; 38:1364–1369.

Edgar

. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 2004; 5:113.

Franzen

, Aspan

, Egenvall

, Gunnarsson

et al. Molecular evidence for persistence of Anaplasma phagocytophilum in the absence of clinical abnormalities in horses after recovery from acute experimental Infection. J Vet Intern Med, 2009; 23:636–642.

Inokuma

, Terada

, Kamio

, Raoult

et al. Analysis of the 16S rRNA gene sequence of Anaplasma centrale and its phylogenetic relatedness to other Ehrlichia. Clin Diag Lab Immunol, 2001; 8:241–244.

Inokuma

, Fujii

, Okuda

, Onishi

et al. Determination of the nucleotide sequences of heat shock operon groESL and citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin Diag Lab Immunol, 2002a. 9:1132–1136.

Inokuma

, Fujii

, Matsumoto

, Okuda

et al. Demonstration of Anaplasma (Ehrlichia) platys inclusions in peripheral blood platelets of a dog in Japan. Vet Parasitol., 2002b. 110:145–152.

Jilintai

, Hayakawa

, Suzuki

, Hata

et al. Molecular survey for Anaplasma bovis and Anaplasma phagocytophilum infection in cattle in a pastureland where Sika deer appear in Hokkaido, Japan. Jpn J Infect Dis, 2009; 62:73–75.

Kawahara

, Rikihisa

, Lin

, Isogai

et al. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl Environ Microbiol, 2006; 72:1102–1109.

Masuzawa

, Uchishima

, Fukui

, Okamoto

et al. Detection of Anaplasma phagocytophilum from Wild Boars and Deer in Japan. Jpn J Infect Dis, 2011; 64:333–336.

10.

Murase

, Konnai

, Hidano

, Githaka

et al. Molecular detection of Anaplasma phagocytophilum in cattle and Ixodes persulcatus. Vet Microbiol, 2011; 149:504–507.

11.

Ohashi

, Inayoshi

, Kitamura

, Kawamori

et al. Anaplasma phagocytophilum-infected ticks, Japan. Emerg Infect Dis, 2005; 11:1780–1783.

12.

Ooshiro

, Zakimi

, Matsukawa

, Yafuso

et al. Anaplasma marginale infection in a Japanese Black cow 13 years after eradication of Rhipicephalus (Boophilus) microplus in Okinawa, Japan. Vet Parasitol, 2009; 160:351–355.

13.

Sumner

, Nicholson

, Massung

. PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species. J Clin Microbiol, 1997; 35:2087–2092.

14.

Tamamoto

, Seino

, Suzuki

, Kaji

et al. Detection of Ehrlichia muris DNA from Sika deer (Cervus nippon yesoensis) in Hokkaido, Japan. Vet Parasitol, 2007; 150:370–373.

15.

Tamura

, Peterson

, Stecher

et al. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011; 28:2731–2739.

16.

Wuritu Ozawa

, Gaowa Kawamori

et al. Structural analysis of a p44/msp2 expression site of Anaplasma phagocytophilum in naturally infected ticks in Japan. J Med Microbiol, 2009; 58:1638–1644.

17.

Ybañez

, Matsumoto

, Kishimoto

, Inokuma

. Molecular analyses of a potentially novel Anaplasma sp. closely related to Anaplasma phagocytophilum in Sika deer in Japan. Vet Microbiol, 2012; 157:232–236.

18.

Yoshimoto

, Matsuyama

, Matsuda

, Sakamoto

et al. Detection of Anaplasma bovis and Anaplasma phagocytophilum DNA from Haemaphysalis megaspinosa in Hokkaido, Japan. Vet Parasitol, 2010; 168:170–172.