Prevalence of Anaplasma phagocytophilum and Babesia microti in Ixodes scapularis from a Newly Established Lyme Disease Endemic Area,the Thousand Islands Region of Ontario,Canada

Abstract

Blacklegged ticks (Ixodes scapularis) are vectors for several important human diseases, including Lyme disease, human granulocytic anaplasmosis (HGA), and human babesiosis, caused by Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti, respectively. The continued northward range expansion of blacklegged ticks and associated pathogens is an increasing public health concern in Canada. The Thousand Islands region of eastern Ontario has recently been identified as a new endemic area for Lyme disease in Canada, but the occurrence of other pathogens in ticks in this area has not been fully described. Our objectives were to determine the prevalence of A. phagocytophilum and B. microti in small mammals and questing ticks in the Thousand Islands area and identify the strains of A. phagocytophilum circulating in ticks in the area. Serum and larval ticks were collected from trapped small mammals, and questing ticks were collected via drag sampling from up to 12 island and mainland sites in 2006, 2009, and 2010. A. phagocytophilum was identified by PCR in 3.4% (47/1388) ticks from eight of 12 sites; the prevalence ranged from 8.9% in 2006 to 3% in 2009. All 365 ticks tested for B. microti were negative. Antibodies to A. phagocytophilum were detected in 2.8% (17/611) of white-footed mice (Peromyscus leucopus) at two of 11 sites in 2006, 2009, or 2010. All 34 A. phagocytophilum–positive ticks submitted for strain identification using single-nucleotide polymorphism genotyping assays targeting the 16S rRNA gene were identified as a variant strain (Ap variant-1), which is not commonly associated with human disease. Our findings suggest that people are at low risk of contracting HGA or human babesiosis due to locally acquired tick bites in the Thousand Islands area. However, continued surveillance is warranted as these pathogens continue to expand their ranges in North America.

Introduction

Blacklegged ticks (Ixodes scapularis) are vectors for important human diseases, including Lyme disease, human granulocytic anaplasmosis (HGA), and human babesiosis, caused by Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti, respectively. Blacklegged ticks are establishing in an increasing number of areas in central and eastern Canada (Ogden et al. 2009), and the northward expansion of their range is an important public health concern in Canada. The Thousand Islands region has been identified as an emerging endemic area for I. scapularis and B. burgdorferi (Werden et al. 2014), but the occurrence of other pathogens in ticks in this region has not been fully described.

Krakowetz et al. (2014) reported that 1.3% of blacklegged ticks from across Canada were positive for A. phagocytophilum. Two strain types of A. phagocytophilum were identified, the human pathogenic strain (AP-ha), which is most often associated with clinical cases of HGA, and a variant strain (AP-variant 1); their relative prevalence appears to vary geographically (Krakowetz et al. 2014). B. microti has rarely been detected in ticks in Ontario; however, it occurs nearby in the northeastern United States, and the geographic range of human babesiosis is expanding (Diuk-Wasser et al. 2014). Information about the occurrence of tick-associated pathogens in different geographical areas is useful for informing physicians and public health practitioners about the disease risks associated with ticks in their area.

Our objectives were to determine the prevalence of A. phagocytophilum and B. microti in small mammals and questing ticks in the Thousand Islands area and identify the strain types of A. phagocytophilum circulating in ticks in the area.

Materials and Methods

The study area, small mammal trapping, tick collection and processing, and pathogen identification methods have been described previously (Werden 2012, Werden et al. 2014). Briefly, the study area was comprised of nine island and three mainland sites within Thousand Islands National Park in the Thousand Islands (44.45°N, 75.86°W). Three sites (Thwartway, Grenadier, and Hill islands) were surveyed for ticks by drag sampling in August, 2006, and all sites were surveyed in June, August, and October of 2009 and 2010 to correspond with peak activity levels of tick larvae, nymphs, and adults. Blood samples and larval ticks were collected from small mammals trapped at three island sites (Thwartway, Grenadier, and Hill islands) and two mainland sites (Landon Bay and Mallorytown Landing) in July and August, 2006, and at all 12 sites in June and August of 2009 and 2010.

Ticks identified as I. scapularis were tested for A. phagocytophilum and B. microti using PCR as described by Werden (2012). Briefly, DNA was obtained using DNeasy 96 tissue kits (Qiagen, Mississauga, ON, Canada). All DNA extracts were screened for A. phagocytophilum using a multiplex real-time PCR targeting the msp2 protein gene (Courtney et al. 2004). Positive samples were confirmed using primers (Ap16Sf, gctgcttttaatactgccaga; Ap16Sr, tcagtaccggaaccagatagc) and probes (Ap 16S FAM-BBQ, ccactggtgttcctcctaatatctacga) targeting the 16S gene. The primers and probes used for screening samples for evidence of B. microti were the same as those described by Nakajima et al. (2009).

A. phagocytophilum strain types were identified using single-nucleotide polymorphism genotyping assays targeting the 16S rRNA gene as described by Krakowetz et al. (2014). Larval ticks from the same host animal were pooled for all testing and analysis; individual nymphs and adults collected by drag sampling were tested.

Sera from 611white-footed mice (Peromyscus leucopus), 69 chipmunks (Tamias striatus), 64 short-tailed shrews (Blarina brevicauda), and 68 meadow voles (Microtus pennsylvanicus) were screened for immunogloublin G (IgG) antibodies to A. phagocytophilum by immunofluorescent assay (IFA) using commercially prepared slides (Fuller Laboratories, Fullerton, CA). Samples that were positive at the screening dilution were confirmed by titration to end point by a commercial western blot kit (Anaplasma phagocytophilum Marblot Strip Test System, MarDx, Trinity Biotech, Inc., Carlsbad, CA) or IFA.

We used a chi-squared or Fisher exact test to determine if the prevalence of A. phagocytophilum differed between years. p values < 0.05 were considered statistically significant.

Results

Only one of 566 larval pools (2006, 52; 2009, 243; 2010, 271) tested positive for A. phagocytophilum. The positive pool was collected from a white-footed mouse on Thwartway Island in 2006 that tested positive for antibodies A. phagocytophilum.

A. phagocytophilum was detected in 8.9% (95% confidence interval [CI] 3.3–20.4), 3.0%, (95% CI 1.7–5.1), and 3.2% (95% CI 2.2–4.7) of nymphal and adult ticks collected in 2006, 2009, and 2010, respectively. Infected ticks were collected from eight of 12 study sites in 2010 (Table 1), and the proportion of positive sites was significantly higher in 2010 (8/12) compared to 2009 (1/12) (p = 0.009). On Thwartway Island, which was sampled in all 3 years, there was no significant year-to-year variation in A. phagocytophilum prevalence in ticks (p = 0.64). All A. phagocytophilum from 34 positive ticks that were submitted for further characterization were identified as Ap variant-1.

Table 1.

Prevalence of Infection with Anaplasma phagocytophilum in Nymphal and Adult Ixodes scapularis Collected by Drag Sampling and Prevalence of Antibodies to A. phagocytophilum in White-Footed Mice (Peromyscus leucopus) in 2006, 2009, and 2010 at Various Sites in the Thousand Islands Region

Site	2006 Prevalence in ticks %, (n)	Antibody prevalence in mice %, (n)	2009 Prevalence in ticks %, (n)	Antibody prevalence in mice %, (n)	2010 Prevalence in ticks %, (n)	Antibody prevalence in mice %, (n)
Aubrey Island	—	—	0% (8)	—	0% (15)	—
Camelot Island	—	—	0% (116)	0% (25)	0.7% (148)	0% (28)
Endymion Island	—	—	0% (82)	0% (1)	0.8% (249)	—
Grenadier Island	0% (3)	9.1% (11)	0% (27)	0% (35)	0% (30)	1.5% (66)
Hill I.	—	0% (14)	0% (5)	0% (59)	8.3% (83)	0% (22)
Jones Creek^a	—	—	0% (2)	0% (45)	5.6% (18)	0% (38)
Landon Bay^a	—	0% (8)	0% (2)	0% (9)	0% (9)	0% (8)
Lindsay Island	—	—	0% (16)	0% (5)	5% (20)	0% (7)
McDonald Island	—	—	0% (17)	0% (6)	2.6% (38)	0% (44)
Mermaid Island	—	—	0% (6)	—	4.8% (21)	0% (2)
Mallorytown^a	—	0% (10)	0% (1)	0% (44)	0% (6)	0% (13)
Thwartway Island	9.4% (53)	39.4% (33)	7.7% (183)	0% (55)	6% (230)	8.7% (23)
Overall	8.9% (56)	18.4% (76)	3% (465)	0% (284)	3.2% (867)	1.2% (251)

Mainland sites.

The overall prevalence of antibody to A. phagocytophilum in white-footed mice ranged from 0% in 2009 to 18.4% (95% CI 10.8–29.3) in 2006 (Table 1). Seropositive mice were found only on Thwartway and Grenadier islands. Seroprevalence was significantly lower in 2009 and 2010 (2/78) than in 2006 (13/33) on Thwartway island (p < 0.001), but not on Grenadier Island (2006, 1/11; 2009 and 2010, 1/101; p = 0.19). No A. phagocytophilum antibodies were detected in any of the chipmunks, short-tailed shrews, or meadow voles sampled. B. microti was not detected in 365 ticks tested (56 in 2006 and 309 in 2009).

Discussion

The prevalence of A. phagocytophilum in ticks from the Thousand Islands area (∼3–9% depending on year) was higher than reported previously in Ontario (0.3%; Nelder et al. 2014), but lower than reported in ticks collected from deer in southwestern Quebec (14.8%; Bouchard et al. 2013). Bouchard et al. (2013) did not detect B. microti in any of the ticks they tested in southwestern Quebec, a result that is consistent with the findings or our study.

Year-to-year prevalence did not differ at the one site where A. phagocytophilum was detected in nymphal and adult ticks in all 3 years of the study, but A. phagocytophilum was detected in ticks from two-thirds of the study sites in 2010, an increase from the previous year. This possibly represents a local expansion of the range of A. phagocytophilum within this area, which was recently identified as endemic for I. scapularis (Werden et al. 2014).

We detected antibodies to A. phagocytophilum in only a few mice in this study. This is not unexpected because the Ap-variant 1 is not considered to be infectious for mice, deer being suspected as an important reservoir for this strain type (Massung et al. 2003).

Since the Thousand Islands region was identified as an emerging risk area for Lyme disease (Werden et al. 2014), concerns have been raised about the occurrence of other vector-borne pathogens. We did not detect B. microti or AP-ha strains in any ticks, suggesting that humans are at low risk of becoming infected with these pathogens due to locally acquired tick bites. However, ongoing surveillance is warranted as these pathogens continue to expand their range in North America (Parkins et al. 2009, Bullard et al. 2014).

Footnotes

Acknowledgments

The authors thank A. Sharp, L. Bruce, J. Hall, S. Stevenson, B. Jefferson, K. Warnick, D. Cristo, C. Massey, L. Shirose, A. Dibernardo, M. Wilcox, T. Cote, D. McColl, H. Szeto, J. Leggo, S. Borcoman, M. Kelly, and M.B. Lynch for their contributions to data collection, laboratory analyses, and logistical support.

Author Disclosure Statement

No competing financial interests exist

References

Bouchard

, Leighton

, Beauchamp

, Nguon

, et al. Harvested white-tailed deer as sentinel hosts for early establishing Ixodes scapularis populations and risk from vector-borne zoonoses in southeastern Canada. J Med Entomol, 2013; 50:384–393.

Bullard

, Ahsanuddin

, Perry

, Lindsay

, et al. The first case of locally acquired tick-borne Babesia microti infection in Canada. Can J Infect Dis Med Microbiol, 2014; 25:e87–e89.

Courtney

, Kostelnik

, Zeidner

, Massung

. Multiplex realtime PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi . J Clin Microbiol, 2004; 42:3164–3168.

Diuk-Wasser

, Liu

, Steeves

, Folsom-O'Keefe

, et al. Monitoring human babesiosis emergence through vector surveillance New England, USA. Emerg Infect Dis, 2014; 20:225–231.

Krakowetz

, Dibernardo

, Lindsay

, Chilton

. Two Anaplasma phagocytophilum strains in Ixodes scapularis ticks, Canada. Emerg Infect Dis, 2014; 20:2064–2067.

Massung

, Priestley

, Miller

, Mather

, et al. Inability of a variant strain of Anaplasma phagocytophilum to infect mice. J Infect Dis, 2003; 188:1757–1763.

Nakajima

, Tsuji

, Oda

, Zamota-Niikura

, et al. Babesia microti-group parasites compared phylogenetically by complete sequencing of the CCTη gene in 36 isolates. J Vet Med Sci, 2009; 71:55–68.

Nelder

, Russell

, Lindsay

, Dhar

, et al. Population-based passive tick surveillance and detection of expanding foci of blacklegged ticks Ixodes scapularis and the Lyme disease agent Borrelia burgdorferi in Ontario, Canada. PLoS One, 2014; 9:e105358.

Ogden

, Lindsay

, Morshed

, Sockett

, et al. The emergence of Lyme disease in Canada. CMAJ, 2009; 180:1221–1224.

10.

Parkins

, Church

, Jiang

, Gregson

. Human granulocytic anaplasmosis: First reported case in Canada. Can J Infect Dis Med Microbiol, 2009; 20:e100–e102.

11.

Werden

. Factors affecting the abundance of blacklegged ticks (Ixodes scapularis) and the prevalence of Borrelia burgdorferi in ticks and small mammals in the Thousand Islands region. M.Sc. thesis. Guelph: University of Guelph, 2012. Available at http://hdl.handle.net/10214/3623/

12.

Werden

, Barker

, Bowman

, Gonzales

, et al. Geography, deer, and host biodiversity shape the pattern of Lyme disease emergence in the Thousand Islands Archipelago of Ontario, Canada. PLoS One, 2014; 9:e85640.