Real-Time RT-PCR Assays for Detection and Genotyping of West Nile Virus Lineages Circulating in Africa

Abstract

West Nile virus (WNV) is an emerging arbovirus, circulating worldwide between birds and mosquitoes, which impacts human and animal health. Since the mid-1990s, WNV outbreaks have emerged in Europe and America and represent currently the primary cause of encephalitis in the United States. WNV exhibits a great genetic diversity with at least eight different lineages circulating in the world, and four (1, 2, Koutango, and putative new) are present in Africa. These different WNV lineages are not readily differentiated by serology, and thus, rapid molecular tools are required for diagnostic. We developed here real-time RT-PCR assays for detection and genotyping of African WNV lineages. The specificity of the assays was tested using other flaviviruses circulating in Africa. The sensitivity was determined by testing serial 10-fold dilutions of viruses and RNA standards. The assays provided good specificity and sensitivity and the analytical detection limit was 10 copies/reaction. The RT-PCR assays allowed the detection and genotyping of all WNV isolates in culture medium, human serum, and vertebrate tissues, as well as in field and experimental mosquito samples. Comparing the ratios of genome copy number/infectious virion (plaque-forming units), our study finally revealed new insight on the replication of these different WNV lineages in mosquito cells. Our RT-PCR assays are the first ones allowing the genotyping of all WNV African variants, and this may have important applications in surveillance and epidemiology in Africa and also for monitoring of their emergence in Europe and other continents.

Introduction

West Nile virus (WNV) is a mosquito-borne virus belonging to the Japanese encephalitis complex of the Flaviviridae family, including Usutu virus (USUV), Japanese encephalitis virus, Saint Louis encephalitis virus, and Murray Valley Fever virus (Gubler 2007). WNV was first isolated and identified in the West Nile region of Uganda in 1937 from a febrile female adult patient (Smithburn et al. 1940). WNV is transmitted by the bite of infected mosquitoes, particularly Culex spp. mosquitoes. Birds are considered as a main reservoir host, and migratory birds can play an important role in long distance viral spread (Hubalek and Halouzka 1999, Hayes et al. 2005, Ergunay et al. 2015). West Nile fever outbreaks concern essentially humans and horses as dead-end hosts (Hubalek and Halouzka 1999, Kulasekera et al. 2001, Hayes et al. 2005, Murray et al. 2010). Clinical symptoms range from asymptomatic or mild influenza-like illness to severe neurological disease, which can be characterized by acute flaccid paralysis, encephalitis, and meningoencephalitis (Hayes et al. 2005, De Filette et al. 2012). Since the mid-1990s, WNV outbreaks have emerged in Europe and America, and WNV is now recognized as one of the most widespread flaviviruses worldwide (DeGroote et al. 2014, Hernández-Triana et al. 2014, Vilibic-Cavlek et al. 2014, Cox et al. 2015) and not restricted to tropical regions.

WNV exhibits a great genetic diversity with at least eight different lineages circulating in the world, without known specific biological properties (Mackenzie and Williams 2009, Fall et al. 2014). Among them, four (i.e., 1, 2, Koutango, and a putative new lineage) are present in Africa, particularly in Senegal. Lineage 1 is the only one found worldwide and associated with all major human outbreaks (Murray et al. 2010, Anukumar et al. 2014, Hernández-Triana et al. 2014). Lineage 2 was exclusively present in Africa, but since 2004, this lineage has been reported circulating in Europe with severe cases in humans and birds (Bakonyi et al. 2006, Hernández-Triana et al. 2014). Viruses with high and low neuro-invasiveness phenotype exist in both lineages 1 and 2. Koutango and the putative new lineage are local African lineages, never isolated in humans, birds, or horses (Fall et al. 2014, www.pasteur.fr/recherche/banques/CRORA). Recently, the putative new lineage was experimentally shown to be transmitted by Culex neavei, which suggests a possible transmission particularly to birds and horses (Fall et al. 2014). The Koutango lineage was reported to be more neurovirulent in mice than WNV NY99, a known virulent lineage 1 strain (Prow et al. 2014). These findings provided new insights into transmission and pathogenesis of these African local WNV lineages.

The report of lineage 2 in Europe, which was a local African lineage, suggests ongoing exchanges between Africa and Europe, and migratory birds that overwintered in Africa may have introduced lineage 2 into Europe (Bakonyi et al. 2006, Hernández-Triana et al. 2014). A similar migration event has been also observed for USUV (Nikolay et al. 2013).

Interestingly, Senegal is an important stopover point for bird migration between Africa and Europe in the area of the ornithological park Djoudj on the Senegal River. All these observations suggest the potential of the African local lineages (Koutango and the putative new lineage) to spread beyond their expected geographical areas into Europe.

These different WNV lineages are not readily differentiated by serology; therefore, rapid molecular methods are required for detection and genotyping of WNV in suspect cases and potential vectors. This may have important applications not only in surveillance and epidemiology of African WNV lineages in Africa but also for surveillance of their emergence in Europe and other continents. Molecular tools are available for WNV detection (Linke et al. 2007, Zaayman et al. 2009, Faggioni et al. 2014), but the genetic diversity of all African WNV variants has never been taken into account. In this study, we developed rapid molecular tools for a consensus detection of all WNV lineages (WNV consensus assay) and genotyping of the different WNV lineages reported in Africa (lineage-specific assays).

Materials and Methods

Virus

Fifteen WNV and seven other flavivirus isolates were used in this study and are described in Table 1. The virus stocks were prepared by inoculating Aedes pseudoscutellaris (AP61) continuous cell lines for 4 days, and immunofluorescence assay as previously described (Digoutte et al. 1992) was performed to assess the cell infection with WNV. Virus stocks were titrated as previously described, using porcine stable cells (porcine kidney stable cell line, American Type Culture Collection, Manassas, VA) (De Madrid and Porterfield 1969). The cell culture media were used as viral stocks for RNA extraction and RT-PCR.

Table 1.

List of Strains Used in This Study

Strains	Virus	Origin	Year of isolation	Source	Acc. no. or reference
Eg 101	WNV lineage 1	Egypt	1951	Human	AF260968.1
ArD120040	WNV lineage 1	Senegal	1996	Culex neavei	CRORA database
ArD76986	WNV lineage 1	Senegal	1990	Culex poicilipes	KJ131500
B956	WNV lineage 2	Uganda	1937	Human	AY532665.1
ArD166362	WNV lineage 2	Senegal	2002	Aedes vexans	CRORA database
ArD172162	WNV lineage 2	Senegal	2003	Culex antennatus	KJ131504
ArD134613	WNV lineage 2	Senegal	1998	Mansonia uniformis	CRORA database
ArD96655	WNV Koutango	Senegal	1993	Rhipicephalus guihoni	KJ131501
AnD95153	WNV Koutango	Senegal	1993	Mastomys erythroleucus	KJ131503
ArD94343	WNV new lineage	Senegal	1992	Culex perfuscus	KJ131502
New Guinea C	DENV2	New Guinea	1974	Human	AF038403.1
H-241	DENV4	Philippines	1956	Human	U18433.1
ArAAMT/7	Yellow fever	Ivory Coast	1973	Aedes africanus	CRORA database
MR 766	Zika	Uganda	1947	Rhesus monkey	AY632535.2
SAAR1776	Usutu	South Africa	1959	Culex neavei	AY453412.1
ArB1803	Usutu subtype	CAR	1969	Culex perfuscus	KC754958.1
ArD138018	Bagaza	Senegal	2000	Culex poicilipes	CRORA database

The years of isolation, origins, sources, and accession numbers or references are mentioned. DENV2 and DENV4 correspond to Dengue virus serotype 2 and 4.

CAR, Central African Republic; WNV, West Nile virus.

Primer and probe design for WNV consensus assay

To develop a locked nucleic acid probe-based real-time RT-PCR, target regions described previously, envelope gene (E-gene) (Lanciotti et al. 2000) and 3′ untranslated region (3′UTR) (Jiménez-Clavero et al. 2006), were considered. The envelope gene target was dismissed as it had been chosen for detection of American WNV type 1 sequences only. Using 78 sequences available from GenBank at the time of design, an amplicon was designed for the 3′UTR target region. Because of too high divergence, the sequences “Rabensburg” (AY765264) and “LEIV-Krnd88-190” (AY277251) were not included in the alignments. These primers were synthesized (TIB Mol-Biol, Berlin, Germany) and tested to identify a pair, which would not amplify any of the other flaviviruses tested (Table 2).

Table 2.

List of Primers and Probes

Name	Sequence (5′ to 3′)	T_m (°C)	Region
WNV FP	GAAGYATTGAYACATGYGCCA	59.2	Envelope
WNV1 P^a	TCYACCAAGGCAACAGGAAGAACCAT	68.2	Envelope
WNV1 RP	CACAGTGGTTGGTCCATGGAC	59.7	Envelope
WNVK P^a	TCAACACAAGCCGTGGGGAAGATCAT	69.2	Envelope
WNVK RP	CAGAGTAGTTGGGCCATGCAC	59.2	Envelope
WNVN FP	GCAGCATTGACACATGCGCGA	67.3	Envelope
WNVN P^a	ACAACCAAAGCCATTGGAAGAACCAT	65.3	Envelope
WNVN RP	ACATTGGTTGGGCCATGAAC	59.1	Envelope
WNV2 FP	GGGAGCATTGACACATGTGC	58.5	Envelope
WNV2 P^a	CAACCAAAGCAACTGGATGGATCATCC	67.9	Envelope
WNV2 RP	GCCATGAGATTCAACGGTCGT	60.8	Envelope
WNVUTR FP	GTRGAYGGTGCKGCCTGC	61.8	3′UTR
WNVUTR P^a	CAGGAGGACT+G+G+GT+GA	70	3′UTR
WNVUTR RP	GACGGTTCTGAGGGCTTACRTGG	58	3′UTR

All probes were tagged 6FAM at the 5′ and BBQ at the 3′ end. + preceding a nucleotide indicates LNA nucleotide.

FP, forward primer; LNA, locked nucleic acid; P, probe; RP, reverse primer; T_m, melting temperature; UTR, untranslated region.

Primer and probe design for WNV lineage-specific assays

To develop lineage-specific-real-time RT-PCR assays, the E-gene sequences of strains belonging to each lineage (1, 2, Koutango, and the putative new lineage) were considered. The different primers and probes designed (Table 2) were synthesized (TIB Mol-Biol) and tested.

RNA standard

For the consensus assay, a 1047 nucleotide fragment of the 3′UTR region was amplified using WNVUTR UP 5′-TGCTTCTGTACTTCCACAGAAGAG-3′ and WNVUTR DP 5′-AGATCCTGTGTTCTCGCACC-3′. For the lineage-specific assays, 727-bp fragments of the E-gene were amplified with the primers WNV E-F (5′-CAACTGCCTAGGAATGAGYAACAG-3′) and WNV E-R (5′-GGCATGAGGTTCTTCAAACTC CA-3′). The obtained PCR products were ligated into pCRII (3′UTR) and pCR2.1 (E-gene) (Life Technologies, GmbH, Darmstadt, Germany) and used for in vitro transcription of an RNA standard with T7 RNA-polymerase (Roche, Mannheim, Germany) as described previously (Nikolay et al. 2014).

Determination of specificity

The specificity of the different assays was determined by testing 10 WNV strains belonging to the 4 lineages circulating in Africa (i.e., 3 lineage-1, 4 lineage-2, 2 Koutango, and the unique strain of the putative new lineage) in comparison to other flavivirus isolates of Dengue virus, USUV, Yellow fever virus, Zika virus, and Bagaza. Before WNV RT-PCR assays, all these isolates were tested using Pan-Flavi assay (Patel et al. 2013) and existing specific assays for Dengue virus (Wagner et al. 2004), Yellow fever virus (Weidmann et al. 2010), and Zika (Faye et al. 2013) as described previously for amplification control.

Determination of sensitivity

Dilutions (10-fold) of each in vitro RNA standard with known initial copy number were quantified in triplicate using the different assays. Regression curves were obtained representing the RNA copy number/reaction versus the threshold cycle (Ct) value. The lowest RNA copy number with RT-PCR detection was considered as the analytical detection limit.

The sensitivity of viral RNA detection was also evaluated by serial 10-fold dilutions of viral stocks with known titer of each WNV type in L-15 medium (Gibco BRL, GrandIsland, NY) and in human serum (Sigma-Aldrich, Saint-Louis, MO). To verify for the number of genome copies per plaque-forming units (pfu), all supernatants were quantified using the respective WNV real-time RT-PCR assays. The WNV reference strain Eg101 was used for lineage 1-specific and consensus RT-PCR assays. The WNV reference strains B956, ArD96655, and ArD94343 were used, respectively, for lineage 2, Koutango, and new lineage-specific assays. The assays were performed in triplicate. For the 10-fold dilutions, regression curves were obtained representing the pfu/reaction versus the Ct value. The lowest titer with RT-PCR detection was considered as the analytical detection limit.

Processing of field samples and experimentally infected mosquitoes

Field mosquito pools, rodents, and experimentally infected mosquitoes (Fall et al. 2014) were used to test the performance of the assays. Experimentally infected mosquitoes were homogenized as previously described (Fall et al. 2014), and mosquito pools collected in the field were homogenized in 3 mL of L-15 supplemented with 20% of fetal bovine serum (FBS). Rodent tissues were homogenized in 3 to 4 mL of L-15 containing 5% FBS. Viral RNA was extracted from the homogenates and analyzed by real-time RT-PCR assays (see RNA extraction and RT-PCR section).

RNA extraction and RT-PCR

RNA was extracted from 100 μL of each viral stock, mosquito or rodent homogenates, and 10-fold dilution of WNV lineage stocks in L-15 medium or human serum using the QIAamp viral RNA extraction kit (Qiagen, Heiden, Germany) according to the manufacturer's instructions.

The real-time RT-PCR assay was performed using an ABI 7500 cycler (Applied Biosystems, Foster City, CA) and the QuantiTect Probe RT-PCR kit (Qiagen). Reactions were performed in 25 μL reaction volume containing 1 μL diluted RNA, 0.5 μM forward and reverse primer, 0.2 μM of probe, 12.5 μL of 2× QuantiTect Probe RT-PCR Master Mix, and 0.25 μL of QuantiTect RT Mix. The RT-PCR conditions were as follows: 15 min 50°C, 10 min 95°C, 40 cycles of 15 s 95°C, and 1 min 60°C.

Determination of intra-assay, interassay reproducibility and efficiency

Samples were extracted and amplified 10 times in the same run to evaluate intra-assay variability and in 10 different runs to evaluate interassay variability. The amplification efficiency of the primers was calculated from the slope of the standard regression lines (E = 10^1/slope − 1).

Results

Analytical specificity and analytical sensitivity

RNAs from the 10 WNV and other flavivirus isolates were tested using Pan-Flavi, WNV consensus, and WNV lineage-specific real-time RT-PCR assays developed herein. The Pan-Flavi assay detected all the isolates tested. The WNV consensus assay detected all the 10 WNV strains, but initially also detected RNAs from USUV strains (data not shown). Using the amplification refractory mutation system (ARMS) principle (Newton et al. 1989, Weidmann et al. 2003), the reverse primer was adapted to an insertion in the USUV sequences matching the second position of a newly designed WNV reverse primer (Fig. 1). The new WNV consensus assay (Table 2) now did not show any more cross detection of RNAs from USUV strains.

FIG. 1.

Sequence alignment of 3′UTR sequences of WNV and USUV as indicated by accession numbers with WNV consensus assay primers and LNA probe. Nucleotide positions refer to the sequence of reference strain Eg101 from Egypt (AF260968). AF196835 represents sequences from the United States. AY277252 represents sequences from Russia. Degenerated positions are in bold. LNA, locked nucleic acid; USUV, Usutu virus; UTR, untranslated region; WNV, West Nile virus.

To boost differentiation and therefore specificity of the individual WNV lineage-specific assays, primers were also designed using the ARMS principle with specific matches at the 2 to 3 position of the 3′-end of the primers, mismatching to as many of the other strains as possible (Fig. 2). These lineage-specific assays detected and correctly genotyped the respective WNV strains tested in each lineage, but neither detected other flaviviruses tested nor cross-reacted within other WNV lineages tested (Table 3).

FIG. 2.

Sequence alignment of WNV E-gene sequences from Africa, Senegal, Egypt, Uganda, Europe, and America as indicated by strain designations with WNV lineage-specific primers and probes. The forward primer WNV FP is common to lineages 1, Koutango, and the European WNV2 isolates. Nucleotide positions refer to the sequence of reference strain Eg101 from Egypt (AF260968). Probe mismatches are highlighted in bold in reference to probe WNV1 P for the detection of WNV lineage 1. Mismatches were introduced to the 3′ ends of the primers according to the ARMS principle to enhance differentiation. ARMS, amplification refractory mutation system; FP, forward primer; P, probe; RP, reverse primer.

Table 3.

Analytical Specificity

		Threshold cycle (Ct)
		Pan-Flavi		WNV consensus		WNV lineage 1		WNV lineage 2		WNV Koutango		WNV new lineage
Strains	Virus	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2
Eg 101	WNV1	19.08	18.91	19.06	20.23	18.56	18.92	—	—	—	—	—	—
ArD120040	WNV1	23.78	24.36	15.52	16.45	18.92	18.50	—	—	–	—	—	—
ArD76986	WNV1	25.95	23.09	17.47	17.03	20.52	20.37	—	—	—	—	—	—
B956	WNV2	16.63	16.56	22.68	21.55	—	—	16.79	16.26	—	—	—	—
ArD166362	WNV2	22.57	22.39	14.64	15.53	—	—	24.47	26.20	—	—	—	—
ArD172162	WNV2	20.35	18.64	30.35	29.72	—	—	21.07	20.74	—	—	—	—
ArD134613	WNV2	23.40	23.21	15.84	16.92	—	—	23.4	22.90	—	—	—	—
ArD96655	WNVK	23.38	23.18	21.44	22.51	—	—	—	—	17.83	17.89	—	—
AnD95153	WNVK	21.10	23.53	19.00	20.09	—	—	—	—	19.09	19.08	—	—
ArD94343	WNV N	19.30	19.49	17.19	18.20	—	—	—	—	—	—	19.14	19.06
New Guinea C	Dengue 2	23.00	22.99	—	—	—	—	—	—	—	—	—	—
H-241	Dengue 4	25.64	25.67	—	—	—	—	—	—	—	—	—	—
ArAAMT/7	YF	24.85	24.7	—	—	—	—	—	—	—	—	—	—
MR 766	Zika	27.82	27.98	—	—	—	—	—	—	—	—	—	—
SAAR1776	Usutu	31.81	28.61	—	—	—	—	—	—	—	—	—	—
ArB1803	Usutu	19.76	20.48	—	—	—	—	—	—	—	—	—	—
ArD138018	Bagaza	28.56	27.65	—	—	—	—	—	—	—	—	—	—

Samples were tested by real-time RT-PCR using Pan-Flavi, lineage-specific, and consensus assays in two independent experiments (assay 1 and 2). The Ct (threshold cycle) values are represented.

—, negative amplification.

The performance of the assays was tested by using 10-fold dilutions of in vitro RNA standards. Five independent runs were done using the RNA standards of the consensus and each of the lineage-specific assays (Fig. 3). The analytical detection limit was 10 copies/reaction for all the RT-PCR assays (Fig. 3). The linear regression showed that the different curves were linear with correlation coefficients ≥0.998 in all cases. Efficiencies ranged from 99% to 141%, with lower efficiencies for Koutango (103%) and putative new lineage (99%) assays and higher efficiency for the consensus assay (141%). The lineage 1 and 2 assays were intermediate with 129% and 121%, respectively (Table 4).

FIG. 3.

Serial 10-fold dilutions of in vitro RNA standard have been tested in the corresponding real-time RT-PCR assay. Tested dilutions ranged from 1 × 10⁸ to 0.1 copies/reaction for the RNA standard of lineages 1, 2, Koutango, and new lineage-specific assays and consensus assay.

Table 4.

Quantitative Determination of Virus Titers and RT-PCR Efficiencies

Viral stock	Titer (pfu/mL)	RT-PCR assay	Copy no./mL	Ratio copy no./pfu	PCR assay efficiency (%)
Eg101	7.75 × 10⁸	Consensus	4.34 × 10¹⁰	56.08	141
Eg101	7.75 × 10⁸	Lineage 1	2.66 × 10¹⁰	34.34	129
B956	3 × 10⁷	Lineage 2	1.82 × 10¹⁰	606.77	121
ArD96655	2.69 × 10⁸	Koutango	4.63 × 10⁹	17.23	103
ArD94343	5.5 × 10⁸	New lineage	4.01 × 10⁹	7.29	99

The WNV stocks were quantified using plaque titration and real-time RT-PCR assays. The ratios copy number/pfu and RT-PCR efficiencies were calculated.

pfu, plaque-forming units.

Viral RNA quantification

The determined titers of Eg101, B956, ArD96655, and ArD94343 (corresponding, respectively, to lineages 1, 2, Koutango, and new lineage viral stocks) are presented in Table 4. The RT-PCR analyses on these viral stocks were done using lineage-specific assays, and the copy number and ratio copy number/pfu are presented in Table 4.

Dilutions (10-fold) of Eg101, B956, ArD96655, and ArD94343 prepared in L-15 medium and human serum were analyzed by RT-PCR with the lineage-specific assays. The consensus assay was tested only on strain Eg101 (lineage 1) and yielded a detection limit of 0.13 pfu/reaction (Fig. 4A). The lineage-specific reactions yielded a detection limit of 1.3, 5, 4.49, and 9.16 pfu/reaction, respectively, for the detection of lineage 1, lineage 2, Koutango, and the putative new lineage (Fig. 4B–E).

FIG. 4.

Serial 10-fold dilutions of virus in L-15 medium and human serum have been tested for consensus (A), lineage 1 (B), lineage 2 (C), Koutango (D), and new lineage (E) in the corresponding real-time RT-PCR assay.

The curves obtained were comparable between L-15 and human serum and linear with correlation coefficients ≥0.998. Efficiencies ranged from 74% to 158% for dilutions in L-15, and 82% to 138% for dilutions in human serum, with higher efficiencies for the consensus assay and lower efficiencies for lineage 2-specific assay in both L-15 and human serum.

Processing of field samples and experimentally infected mosquitoes

To assess the performance of our assays, a panel of samples from experimentally infected mosquitoes, wild-caught mosquito pools, and rodent tissues were used. For each experimental sample, the corresponding virus used to infect the mosquitoes was correctly detected and genotyped (Table 5). The field samples naturally infected with WNV lineage 1 or Koutango, as previously assessed by classical RT-PCR and sequencing (data not shown), were correctly detected and genotyped with the lineage-specific assays in the mosquito pools or rodent tissues, including brain homogenates (Table 5).

Table 5.

Performance with Field and Experimental Samples

			WNV lineage 1		WNV lineage 2		WNV Koutango		WNV new lineage
Species	Type of sample	Virus	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2	Assay 1	Assay 2
Field samples
Culex quinquefasciatus	Mosquito pool	ArD240964	24.07	24.19	—	—	—	—	—	—
Culex perfuscus	Mosquito pool	ArD241164	22.82	23.26	—	—	—	—	—	—
Culex neavei	Mosquito pool	ArD253097	28.31	28.97	—	—	—	—	—	—
Culex neavei	Mosquito pool	ArD253218	25.26	26.57	—	—	—	—	—	—
Mastomys erythroleucus	Rodent brain	AnD235024	—	—	—	—	26.51	26.65	—	—
Experimental samples
Culex quinquefasciatus	Mosquito body	ArD76986	27.12	27.5	—	—	—	—	—	—
	Mosquito legs/wings	ArD76986	29.00	28.85	—	—	—	—	—	—
	Mosquito saliva	ArD76986	32.92	31.98	—	—	—	—	—	—
	Mosquito body	ArD96655	—	—	—	—	29.93	29.58	—	—
	Mosquito body	B956	—	—	26.78	25.95	—	—	—	—
Culex neavei	Mosquito body	ArD94343	—	—	—	—	—	—	29.12	30.22
	Mosquito legs/wings	ArD94343	—	—	—	—	—	—	31.23	31.92
	Mosquito saliva	ArD94343	—	—	—	—	—	—	33.83	32.92
	Mosquito body	ArD76986	21.45	22.03	—	—	—	—	—	—

The Ct (threshold cycle) values are represented.

Field viruses were isolated in 2012 and 2013 in Senegal, and experimental viruses are presented in Table 1. Samples were tested by real-time RT-PCR using lineage-specific assays in two independent experiments (assays 1 and 2).

—, negative amplification.

Variability intra- and interassay

The intra-assay coefficients of variation (CV) ranged from 1.31% to 1.75% and the interassay CV ranged from 2.66% to 4.62% for all assays.

Discussion

Molecular techniques are faster, more accurate, and sensitive for virus detection compared to culture methods. In this study, we established molecular tools for a consensus detection of all WNV lineages and genotyping of the lineages reported in Africa. The good sensitivity of the assays allows the detection and genotyping of all WNV isolates in culture medium, human serum, as well as in field and experimental samples. After the development of the lineage-specific assays, new WNV lineage 2 sequences described in Europe became available (Barzon et al. 2013). Since they introduce a mismatch at position 3 from the 3′-end of the lineage 2-specific forward primer, we suggest using the lineage 1-specific upstream primer, which is also used for Koutango for highly sensitive detection of these strains (Fig. 2). However, we were not able to test these strains in the frame of this study.

Our assays allowed the quantification of WNV RNA by using quantitative RNA standards, yielding viral loads in mosquito and vertebrate samples.

Using the RNA standard, the different assays were very sensitive and able to detect 10 RNA molecules. Our RT-PCR assays therefore exhibit analytical sensitivity similar to others using WNV lineages 1 and 2 (Jiménez-Clavero et al. 2006, Barros et al. 2013, Del Amo et al. 2013).

Using viral RNA, the consensus and lineage 1-specific assay were more sensitive and were able to detect less than 2 pfu of virus. Using the same strain for the consensus and lineage 1-specific assays showed that the consensus assay is more sensitive for detection of low viral loads. This is reflected by the different ratios copy number/pfu obtained for Eg101 (56.08 with the consensus assay and 34.34 with the lineage 1-specific assay) and can be correlated with the higher efficiencies of the consensus RT-PCR assay.

Our results also showed that the different WNV lineages can be detected in human serum with slightly higher efficiencies, compared to culture medium, and in vertebrate tissues, enabling the early and efficient diagnosis of these different WNV lineages from clinical samples. Finally, our study revealed a new insight on the replication of these particular WNV strains in AP61 mosquito cells. The ratios genome copy number/infectious virion (pfu) showed that the new lineage strain and Koutango replication were very efficient with few genomes per pfu indicating apparently a high rate of infectious particles produced, while lineage 2 appeared to overproduce genomes indicating less efficient packaging and possibly more defective particles during its replication (Weidmann et al. 2011).

Conclusions

To our knowledge, the RT-PCR assays described in this article are the first ones that allow the detection and genotyping of all reported African WNV variants.

Surveillance programs now can target all WNV variants, and our tools can be used to monitor the prevalence of WNV virus lineages in mosquito vectors and vertebrates and may be applied in diagnosis as well as in epidemiology and surveillance programs. This is particularly relevant for the surveillance of WNV lineages emerging in geographic regions where they have not previously been identified. The consensus assay is the most sensitive in all tested materials and does not cross detect any of the tested flaviviruses and therefore is an ideal diagnostic assay covering the breadth of WNV strains worldwide.

Therefore, our tools are efficient for rapid detection of African WNV lineages, however, they cannot replace conventional techniques (serology, virus isolation, or molecular sequencing), which are still needed for in-depth characterization of the virus.

Footnotes

Acknowledgments

The authors thank Moussa Dia, Mireille Mondo, Arame Ba, and Khardiata Mbaye for their excellent technical assistance. This work has been financially supported by Institut Pasteur de Dakar and funded by EU grant HEALTH.2010.2.3.3-3-261391 EuroWestNile.

Author Disclosure Statement

No competing financial interests exist.

References

Anukumar

, Sapkal

, Tandale

, Balasubramanian

, et al. West Nile encephalitis outbreak in Kerala, India, 2011. J Clin Virol, 2014; 61:152–155.

Bakonyi

, Ivanics

, Erdélyi

, Ursu

, et al. Lineage 1 and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis, 2006; 12:618–623.

Barros

, Ramos

, Zé-Zé

, Alves

, et al. Simultaneous detection of West Nile and Japanese encephalitis virus RNA by duplex TaqMan RT-PCR. J Virol Methods, 2013; 193:554–557.

Barzon

, Pacenti

, Franchin

, Lavezzo

, et al. Whole genome sequencing and phylogenetic analysis of West Nile virus lineage 1 and lineage 2 from human cases of infection, Italy, August 2013. Euro Surveill, 2013; 18:20597.

Cox

, Campbell

, Nemeth

. Outbreaks of West Nile virus in captive waterfowl in Ontario, Canada. Avian Pathol, 2015; 30:1–27.

De Filette

, Ulbert

, Diamond

, Sanders

. Recent progress in West Nile virus diagnosis and vaccination. Vet Res, 2012; 43:16.

DeGroote

, Sugumaran

, Ecker

. Landscape, demographic and climatic associations with human West Nile virus occurrence regionally in 2012 in the United States of America. Geospat Health, 2014; 9:153–168.

Del Amo

, Sotelo

, Fernández-Pinero

, Gallardo

, et al. A novel quantitative multiplex real-time RT-PCR for the simultaneous detection and differentiation of West Nile virus lineages 1 and 2, and of Usutu virus. J Virol Methods, 2013; 189:321–327.

De Madrid

, Porterfield

. A simple micro-culture method for the study of group B arboviruses. Bull World Health Organ, 1969; 40:113–121.

10.

Digoutte

, Calvo-Wilson

, Mondo

, Traore-Lamizana

, et al. Continuous cell lines and immune ascitic fluid pools in arbovirus detection. Res Virol, 1992; 143:417–422.

11.

Ergunay

, Bakonyi

, Nowotny

, Ozkul

. Close relationship between West Nile virus from Turkey and lineage 1 strain from Central African Republic. Emerg Infect Dis, 2015; 21:352–355.

12.

Faggioni

, De Santis

, Pomponi

, Fantini

, et al. Rapid molecular detection and genotyping of West Nile virus lineages 1 and 2 by real time PCR and melting curve analysis. J Virol Methods, 2014; 207:54–59.

13.

Fall

, Diallo

, Loucoubar

, Faye

, et al. Vector competence of Culex neavei and Culex quinquefasciatus (Diptera: Culicidae) for lineages 1, 2, Koutango and a putative new lineage of West Nile Virus from Africa. Am J Trop Med, 2014; 90:747–754.

14.

Faye

, Faye

, Diallo

, et al. Quantitative real-time PCR detection of Zika virus and evaluation with field-caught mosquitoes. Virol J, 2013; 10:311.

15.

Gubler

. The continuing spread of West Nile virus in the western hemisphere. Clin Infect Dis, 2007; 45:1039–1046.

16.

Hayes

, Sejvar

, Zaki

, Lanciotti

, et al. Virology, pathology, and clinical manifestations of West Nile virus disease. Emerg Infect Dis, 2005; 11:1174–1179.

17.

Hernández-Triana

, Jeffries

, Mansfield

, Carnell

, et al. Emergence of West Nile virus lineage 2 in Europe: A review on the introduction and spread of a mosquito-borne disease. Front Public Health, 2014; 2:271.

18.

Hubalek

, Halouzka

. West Nile fever a reemerging mosquito-borne viral disease in Europe. Emerg Infect Dis, 1999; 5:643–650.

19.

Jiménez-Clavero

, Agüero

, Rojo

, Gómez-Tejedor

. A new fluorogenic real-time RT-PCR assay for detection of lineage 1 and lineage 2 West Nile viruses. J Vet Diagn Invest, 2006; 18:459–462.

20.

Kulasekera

, Kramer

, Nasci

, Mostashari

, et al. West Nile virus infection in mosquitoes, birds, horses, and humans, Staten Island, New York, 2000. Emerg Infect Dis, 2001; 7:722–725.

21.

Lanciotti

, Kerst

, Nasci

, Godsey

, et al. Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol, 2000; 38:4066–4071.

22.

Linke

, Ellerbrok

, Niedrig

, Nitsche

, et al. Detection of West Nile virus lineages 1 and 2 by real-time PCR. J Virol Methods, 2007; 146:355–358.

23.

Mackenzie

, Williams

. The zoonotic flaviviruses of southern, south-eastern and eastern Asia, and Australasia: The potential for emergent viruses. Zoonoses Public Health, 2009; 56:338–356.

24.

Murray

, Mertens

, Despres

. West Nile virus and its emergence in the United States of America. Vet Res, 2010; 41:67.

25.

Newton

, Graham

, Heptinstall

, Powell

, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res, 1989; 17:2503–2516.

26.

Nikolay

, Dupressoir

, Firth

, Faye

, et al. Comparative full length genome sequence analysis of Usutu virus isolates from Africa. Virol J, 2013; 10:217.

27.

Nikolay

, Weidmann

, Dupressoir

, Faye

, et al. Development of a Usutu virus specific real-time reverse transcription PCR assay based on sequenced strains from Africa and Europe. J Virol Methods, 2014; 197:51–54.

28.

Patel

, Landt

, Kaiser

, Faye

, et al. Development of one-step quantitative reverse transcription PCR for the rapid detection of flaviviruses. Virol J, 2013; 10:58.

29.

Prow

, Setoh

, Biron

, Sester

, et al. The West Nile virus-like flavivirus Koutango is highly virulent in mice due to delayed viral clearance and the induction of a poor neutralizing antibody response. J Virol, 2014; 88:9947–9962.

30.

Smithburn

, Hughs

, Burke

, Paul

. A neurotropic virus isolated from the blood of a native of Uganda. Am J Trop Med, 1940; 20:471–492.

31.

Vilibic-Cavlek

, Kaic

, Barbic

, Pem-Novosel

, et al. First evidence of simultaneous occurrence of West Nile virus and Usutu virus neuroinvasive disease in humans in Croatia during the 2013 outbreak. Infection, 2014; 42:689–695.

32.

Wagner

, de With

, Huzly

, Hufert

, et al. Nosocomial acquisition of dengue. Emerg Infect Dis, 2004; 10:1872–1873.

33.

Weidmann

, Faye

, Kranaster

, et al. Improved LNA probe-based assay for the detection of African and South American yellow fever virus strains. J Clin Virol, 2010; 48:187–192.

34.

Weidmann

, Rudaz

, Nunes

, Vasconcelos

, et al. Rapid detection of human pathogenic orthobunyaviruses. J Clin Microbiol, 2003; 41:3299–3305.

35.

Weidmann

, Sall

, Manuguerra

, Koivogui

, et al. Quantitative analysis of particles, genomes and infectious particles in supernatants of haemorrhagic fever virus cell cultures. Virol J, 2011; 8:81.

36.

Zaayman

, Human

, Venter

. A highly sensitive method for the detection and genotyping of West Nile virus by real-time PCR. J Virol Methods, 2009; 157:155–160.