Complete Genome Sequencing and Phylogenetic Analysis of a Getah Virus Strain (Genus Alphavirus,Family Togaviridae ) Isolated from Culex tritaeniorhynchus Mosquitoes in Nagasaki,Japan in 2012

Abstract

Getah virus (GETV; genus Alphavirus, family Togaviridae) is a mosquito-borne virus known to cause disease in horses and pigs. In 2014, for the first time in ∼30 years, a sudden GETV outbreak occurred among racehorses in Ibaraki, Japan. Two years before this outbreak, we obtained multiple GETV isolates from Culex tritaeniorhynchus mosquitoes collected in Nagasaki, Japan and determined the whole genome sequence of GETV isolate 12IH26. Our phylogenetic analysis of GETV strains revealed that the isolate 12IH26 forms a robust clade with the epidemic strains 14-I-605-C1 and 14-I-605-C2 isolated from horses in the 2014 outbreak in Ibaraki. Furthermore, the complete genomic sequence of the isolate 12IH26 was 99.9% identical to those of the 2014 epidemic strains in Ibaraki. Phylogenetic analysis also showed that the recent Japanese GETV strains, including the isolate 12IH26, are closely related to the Chinese and South Korean strains rather than the previous Japanese strains, suggesting that GETV strains may be transported from overseas into Japan through long-distance migration of the infected mosquitoes or migratory birds.

Introduction

The Alphavirus genus in the Togaviridae family is a group of single positive stranded RNA viruses, most of which are arthropod borne (arboviruses) (Powers et al. 2011). The alphavirus genomic RNA, which has a 5′ cap structure and a 3′ poly (A) tail, encodes two tandemly arranged open reading frames (ORFs). The four nonstructural proteins (nsP1–nsP4) are encoded by the ORF of the 5′ side, whereas the structural proteins, including the capsid (C), E3, E2, 6K, and E1 proteins, are tandemly encoded by the ORF of the 3′ side.

Getah virus (GETV) is a member of alphaviruses, which was first isolated from the mosquito Culex gelidus in Malaysia in 1955 (Berge 1975). Sagiyama virus (SAGV) was isolated from the mosquito Cx. tritaeniorhynchus at nearly the same time (Scherer et al. 1962), but SAGV is now considered to be a strain of GETV (Shirako and Yamaguchi 2000). The serological evidence of GETV infection has been confirmed in various mammals and birds, although GETV is not known to cause disease in numerous animals, including human (Doherty et al. 1966, Simpson et al. 1975, Li et al. 1992). In contrast, GETV infection often causes clinical symptoms, such as fever, urticarial rash, and leg edema in horses (Kamada et al. 1980), as well as fetal death and reproductive disorders in domestic pigs (Yago et al. 1987, Izumida et al. 1988). GETV is widely distributed in Asia, northern Australia, and Far East Russia, where it is maintained by transmission cycles between mosquitoes and domestic pigs (Mair and Timoney 2009). In previous studies, GETV was isolated from various species of mosquitoes, including the genera Culex, Aedes, Armigeres, Anopheles, and Mansonia (Simpson et al. 1975, Igarashi et al. 1982, Bryant et al. 2005). Among them, Cx. tritaeniorhynchus and Ae. vexans are the principal vectors of GETV in Japan and Korea (Kumanomido et al. 1986a, 1986b, Turell et al. 2003). Cx. tritaeniorhynchus is known as the most important vector of Japanese encephalitis virus (JEV; genus Flavivirus, family Flaviviridae) in East Asia, implying that GETV and JEV may cocirculate in a similar transmission cycle in the same habitat. In fact, these two phylogenetically unrelated viruses were isolated together from a single porcine serum sample collected in Kochi, Japan (Tajima et al. 2014).

Historically, GETV outbreaks were reported among racehorses in Japan in 1978, 1979, and 1983 (Kamada et al. 1980, Sugiura et al. 1981, Sentsui and Kono 1985). More recently, in 2014, a sudden GETV outbreak occurred among racehorses in Ibaraki prefecture for the first time in about 30 years (Nemoto et al. 2015, Bannai et al. 2015), and a sequential outbreak at the same site also occurred in the following year (Bannai et al. 2016). Before the outbreak in 2014, GETV appears to have been maintained locally in Japan as antibodies against GETV have been detected sporadically in racehorses at several sites in Japan in 1990s (Sugiura and Shimada 1999). However, the reason for the 2014 outbreak in Japan, which occurred after ∼30 years, is unclear.

During mosquito surveillance studies for JEV in Japan, we unexpectedly obtained multiple GETV isolates from Cx. tritaeniorhynchus mosquitoes collected in Nagasaki in 2012. We determined the whole genome sequence of a GETV isolate, 12IH26, and compared it with those of the previously reported GETV strains. In this study, we discuss the origin and spread of the recent Japanese GETV strains.

Materials and Methods

Mosquito collection and virus isolation

Cx. tritaeniorhynchus mosquitoes were collected in Isahaya city (N32°49′, E130°03′), Nagasaki, Japan, on September 3 and 4, 2012. Blood-fed mosquitoes were collected by an aspirator from 7 PM to 9 PM in pigpens and cowsheds. After digestion of the blood, the Cx. tritaeniorhynchus mosquitoes were sorted by morphological keys. Virus isolation from mosquitoes was performed as previously described (Hoshino et al. 2009).

Viral genome sequencing

To determine the viral genome sequence, we used following next-generation sequencing (NGS)-based techniques. A virus stock (pool No. ID 12IH26) was centrifuged at 1500 rpm for 15 min, and the supernatant was centrifuged again at 8000 rpm for 30 min to remove cellular debris. The fluid was concentrated using a Centriprep Centrifugal Filter Unit YM-50 (Merck Millipore, Billerica, MA) and replaced with SM buffer (100 mM NaCl, 8 mM MgSO₄, and 50 mM Tris·HCl). Four units of TURBO DNase (Life Technologies), 3 U of Baseline ZERO DNase (Epicentre, Madison, WI), 25 U of Benzonase nuclease (Merck Millipore), and 0.4 μg of RNase A (Wako Pure Chemical Industries, Osaka, Japan) were added to 390 μL of the concentrate. After incubation at 37°C for 1 h, total RNA was extracted using ISOGEN II (Nippon gene, Tokyo, Japan) and dissolved in 20 μL RNase-free water. The syntheses of the first and second strand cDNAs were performed using cDNA Synthesis Kit (TaKaRa, Shiga, Japan) and cDNA PCR Library Kit (TaKaRa). The PCR-amplified cDNAs were analyzed using the MiSeq system (Illumina, San Diego, CA). CLC genomics workbench software (CLC bio, Aarhus, Denmark) was used to trim adaptors from the sequencing reads and perform de novo assembly for forming the contigs. The contigs were analyzed using BLASTx searches.

The terminal sequences of the viral genome were determined using the rapid amplification of cDNA ends (RACE) techinque. The 5′ RACE was performed using the GeneRacer Kit (Life Technologies) with the gene-specific primer GETV-5RACE-1 (Table 1) for first-strand cDNA synthesis. The 3′ RACE was conducted using the RNA PCR Kit (AMV) Ver.3 (TaKaRa) with the gene-specific primer GETV-3RACE-1 (Table 1). The 5′ and 3′ RACE amplicons were subjected to agarose gel electrophoresis and extracted from the resulting gels. The resultant DNAs were sequenced using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) with the specific primers GETV-5RACE-2 and GETV-3RACE-2 (Table 1).

Table 1.

Primers Used in This Study

Primer name	Position ^a	Polarity	Sequence (5′-3′)
GETV-E2-FW	8407–8431	Forward	ATGAAAAACAACCAGAACAGACACT
GETV-E2-RV	9952–9976	Reverse	TCGTAAGATTTTACGACGGGAGTTC
GETV-E2-seq1	8982–9001	Forward	ACAACGTACCAGCTGACTAC
GETV-5RACE-1	158–180	Reverse	ATTCGGTGTGACCTGCTGTGATT
GETV-5RACE-2	119–141	Reverse	AAACGCCTTCTGAAGGGCCTTAA
GETV-3RACE-1	11252–11274	Forward	ACTTATACTGGTGACGTGTGTGA
GETV-3RACE-2	11285–11307	Forward	CTAACCGGGAGGCTTGACATAAT

Primer positions are based on the complete genome sequence of the GETV strain 12IH26.

Detection of GETV from the cell culture supernatants

RNA extraction from the virus stocks was performed using the QIAamp viral RNA Mini Kit (QIAGEN, Valencia, CA). Reverse transcription (RT)-PCR for GETV detection was performed using the PrimeScript One Step RT-PCR Kit Ver. 2 (TaKaRa) with a specific primer set for the E2 gene (GETV-E2-FW and GETV-E2-RV; Table 1). The thermal profile consisted of RT at 50°C for 30 min; termination of RT at 94°C for 2 min; and 35 cycles of PCR at 94°C for 30 s, 53°C for 30 s, and 72°C for 2 min. The amplified products were sequenced using the primers used in the RT-PCR and GETV-E2-seq1 (Table 1) as described above.

Analysis of viral genome sequence

The genome sequence of the 12IH26 strain was compared with those of the previously reported GETV strains (Table 2) using GENETYX ver.13 software (GENETYX Co., Tokyo, Japan).

Table 2.

GETV Strains Used for Phylogenetic Analysis

Strain name	Year of collection	Location		Source	GenBank accession no.	Reference
MM2021	1955	Malaysia		Culex gelidus	AF339484
Sagiyama	1956	Japan	Tokyo	Culex tritaeniorhynchus	AB032553	Shirako and Yamaguchi (2000)
Haruna	1960	Japan	Gunma	Swine		Wekesa et al. (2001)
M1	1964	China	Hainan	Culex sp.	EU015061	Zhai et al. (2008)
Kyoto 2078	1971	Japan	Kyoto	Culex tritaeniorhynchus		Wekesa et al. (2001)
Sakai 78	1978	Japan	Gunma	Horse		Wekesa et al. (2001)
MI-110-C1	1978	Japan	Ibaraki	Horse	LC079086	Nemoto et al. (2016)
MI-110-C2	1978	Japan	Ibaraki	Horse	LC079087	Nemoto et al. (2016)
Sakai 83	1983	Japan	Gunma	Horse		Wekesa et al. (2001)
Kanagawa 83	1983	Japan	Kanagawa	Horse		Wekesa et al. (2001)
Kanagawa 85	1985	Japan	Kanagawa	Swine		Wekesa et al. (2001)
QIAG9301	1993	South Korea		Swine	KR081238
QIAG9302	1993	South Korea		Swine	KR081239
QIAG9303	1993	South Korea		Swine	KR081240
LEIV 16275 Mag	2000	Russia		Aedes sp.	EF631998
LEIV 17741 MPR	2000	Mongolia		Culex sp.	EF631999
HB0215-3	2002	China	Hebei	Culex tritaeniorhynchus	EU015065, EF375821, EF375824	Zhai et al. (2008)
HB0234	2002	China	Hebei	Culex tritaeniorhynchus	EU015062	Zhai et al. (2008)
South Korea	2004	South Korea		Swine	AY702913
YN0540	2005	China	Yunnan	Armigeres subalbatus	EU015063	Zhai et al. (2008)
YN0542	2005	China	Yunnan	Armigeres subalbatus	EU015064, EU015071	Zhai et al. (2008)
SH05-6	2005	China	Shanghai	Culex tritaeniorhynchus	EU015066, EU015072	Zhai et al. (2008)
SH05-15	2005	China	Shanghai	Culex tritaeniorhynchus	EU015067, EU015073	Zhai et al. (2008)
SH05-16	2005	China	Shanghai	Culex tritaeniorhynchus	EU015068, EU015074	Zhai et al. (2008)
SH05-17	2005	China	Shanghai	Culex tritaeniorhynchus	EU015069, EU015075	Zhai et al. (2008)
Kochi/01/2005	2005	Japan	Kochi	Swine	AB859822	Tajima et al. (2014)
GS10-2	2006	China	Gansu	Armigeres subalbatus	EU015070, EU015076	Zhai et al. (2008)
B1	2008	China		Culex tritaeniorhynchus	FJ897149
YN08	2008	China		Aedes albopictus	JN578104, JN578105
Z12	2008	China		Culex tritaeniorhynchus	FJ897150
Z18	2008	China		Culex tritaeniorhynchus	FJ897151
Z39	2008	China		Culex tritaeniorhynchus	FJ897152
X0901	2009	China		Culex tritaeniorhynchus	JN582180
X0904	2009	China		Culex tritaeniorhynchus	JN582181
A87-09	2009	China		Mosquito	KP900945
A123-09	2009	China		Mosquito	KP900941
A132-09	2009	China		Mosquito	KP900942
A134-09	2009	China		Mosquito	KP900943
KorL915	2010	South Korea		Aedes vexans nipponii	JN410944
KorS1010	2010	South Korea		Aedes vexans nipponii	JN410945
A137-09	2009	China		Mosquito	KP900944
SC1210	2012	China	Sichuan	Armigeres subalbatus	LC107870	Wei et al. (2016)
12IH26	2012	Japan	Nagasaki	Culex tritaeniorhynchus	LC152056	This study
14-I-605-C1	2014	Japan	Ibaraki	Horse	LC079088	Nemoto et al. (2016)
14-I-605-C2	2014	Japan	Ibaraki	Horse	LC079089	Nemoto et al. (2016)

The strain marked by bold is isolated in this study.

Phylogenetic analysis

Molecular phylogenetic analyses were performed based on the nucleotide sequences of the whole genome, E2 gene, partial C gene, and partial nsP1 gene. Multiple alignments of selected viral sequences from GETV strains (Table 2) were conducted using the ClustalW program. Phylogenetic analyses were performed with a maximum-likelihood method using MEGA ver. 7 (Kumar et al. 2015).

Results

Isolation and identification of viruses from Culex tritaeniorhynchus mosquitoes collected in Nagasaki in 2012

A total of 900 female Cx. tritaeniorhynchus mosquitoes were sorted into 42 pooled samples and subjected to virus isolation. Twelve out of 42 samples induced similar cytopathic effects (CPE) with cell shrinkage and aggregation after two blind passages, but only one of them was positive for JEV by RT-PCR assay (data not shown). Therefore we used NGS techniques to identify the infectious agents other than JEV. Pool No. ID 12IH26 was selected as a representative of the CPE-positive samples and analyzed using the Miseq system. A total of 1,145,599 reads were obtained from a cDNA library constructed from the isolate 12IH26. The longest contig resulting from de novo assembly was 11,466 nt in length. It consisted 882,961 reads and its average coverage was 3670.86. This longest contig was highly homologous to the genomic sequence of GETV. The terminal sequences of the viral genome were determined using 5′ and 3′ RACE procedures, allowing the determination of the complete genome sequence. Consequently, the infectious agent present in isolate 12IH26 was confirmed to be GETV and designated GETV strain 12IH26.

Analysis of GETV genome sequence and phylogenetic characterization

The complete genome of GETV strain 12IH26 was 11,689 nt in length. The viral nonstructural (nsP1–4) and structural proteins (C, E3, E2, 6K, and E1) were encoded at positions 79–7482 and 7527–11,288 on the genome, respectively. Like previously described GETV strains, a leaky stop codon was observed upstream of the cleavage site for nsP3/nsP4 in the genome of the 12IH26 strain (data not shown; Shirako and Yamaguchi 2000). A whole-genome sequence comparison of the 12IH26 strain with previously described strains exhibited 97.3–99.9% nucleotide sequence identity (Table 3). The 12IH26 strain was most similar in nucleotide sequence to recent epidemic strains in Japan, 14-I-605-C1 and 14-I-605-C2, which were isolated from horses in Ibaraki, Japan in 2014 (Nemoto et al. 2016). In addition, the amino acid (aa) sequence identities ranged from 99.0% to 99.9%, and the 12IH26 strain had the highest similarity in aa sequence to the strains 14-I-605-C1 and 14-I-605-C2 (Table 3). Amino acid substitutions among the 12IH26, 14-I-605-C1, 14-I-605-C2, and previous GETV strains (MM2021, Sagiyama, M1, MI-110-C1, MI-110-C2, LEIV 16275 Mag, LEIV 17741 MPR, HB0234, South Korea, YN0540, Kochi/01/2005, SC1210; Table 2) were observed in the nsP1, nsP2, nsP3, nsP4, and 6K proteins (Table 4). Almost all of these substitutions in the genome of the 12IH26 strain were identical to those of the strains 14-I-605-C1 and 14-I-605-C2, and most of the substituted aa were concentrated in nsP3 protein. Previous studies have shown that the genomes of several GETV strains contain insertions or deletions in protein-coding or noncoding regions (Wen et al. 2007, Zhai et al. 2008). However, we found no insertions or deletions in the genome sequence of strain 12IH26.

Table 3.

Nucleotide and Amino Acid Sequence Identities Between the GETV Strain 12IH26 and Previously Reported GETV Isolates

	MM2021		Sagiyama		M1		MI-110-C1		MI-110-C2		LEIV16275		LEIV17741		South Korea		HB0234		YN0540		Kochi/01/2005		SC1210		14-I-605-C1		14-I-605-C2
Region	nt ^a	aa ^b	nt	Aa	nt	aa	Nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa	nt	aa
5′UTR		—	100	—	100	—	100	—	100	—	98.7	—	100	—	100	—	100	—	100	—	100	—	100	—	100	—	100	—
nsP1			97.4	99.4	97.5	98.5	98.4	99.8	98.6	99.8	97.9	99.4	98.7	99.8	99.1	99.8	99.0	99.4	98.8	99.6	98.1	99.8	98.8	99.8	99.9	99.8	99.9	99.8
nsP2			97.8	99.9	98.2	99.7	98.5	99.9	98.5	99.9	97.7	99.6	98.5	99.5	99.2	99.7	99.2	99.4	99.0	99.7	97.9	99.7	98.9	99.7	99.9	100	99.9	100
nsP3			96.8	98.3	97.8	98.7	98.3	98.9	98.3	98.9	96.8	98.3	98.0	98.9	98.9	99.2	99.0	99.2	98.6	99.0	96.9	98.3	98.5	98.9	99.9	99.8	99.9	99.8
nsP4			97.7	99.2	98.4	99.5	98.9	99.7	98.9	99.7	98.2	99.7	98.8	99.3	99.3	99.8	99.5	99.5	99.1	99.7	98.1	99.7	99.0	99.7	100	100	100	100
Junction	90.9	—	93.2	—	97.7	—	97.7	—	97.7	—	97.7	—	97.7	—	97.7	—	97.7	—	97.7	—	95.5	—	97.7	—	100	—	100	—
Capsid	95.4	97.4	97.1	99.3	97.4	98.1	98.6	100	98.6	100	97.4	99.3	98.5	100	99.4	100	99.3	100	99.0	100	97.9	100	98.5	99.6	100	100	100	100
E3	95.3	100	96.9	100	97.9	98.4	97.9	100	97.9	98.4	97.4	100	97.4	100	99.0	100	99.0	100	99.0	100	97.4	100	97.9	100	100	100	100	100
E2	94.8	97.6	97.2	98.3	98.3	98.8	98.7	99.8	98.8	100	97.9	99.8	98.9	100	99.0	99.8	98.8	99.3	99.0	100	97.6	99.1	98.7	99.5	99.9	100	99.9	100
6K	96.2	98.4	96.7	96.7	97.8	98.4	98.9	98.4	98.9	98.4	97.3	98.4	98.9	98.4	99.5	98.4	99.5	98.4	99.5	98.4	97.8	98.4	99.5	98.4	100	100	100	100
E1	95.3	98.6	97.1	98.6	98.1	99.1	98.7	100	98.9	100	97.5	99.3	99.0	100	99.3	100	99.1	99.5	99.2	99.8	98.3	99.8	99.0	100	99.8	100	99.9	100
3′UTR	92.0	—	95.6	—	96.8	—	99	—	100	—	97.3	—	99.5	—	82.1	—	99.3	—	98.8	—	98.3	—	98.8	—	99.0	—	99.0	—
Total			97.3	99.1	98.0	99.0	98.6	99.7	98.7	99.7	97.6	99.4	98.6	99.6	98.1	99.7	99.1	99.4	98.9	99.7	97.8	99.5	98.8	99.6	99.9	99.9	99.9	99.9

Percentage of nucleotide sequence identities to strain 12IH26.

Percentage of amino acid sequence identities to strain 12IH26.

Table 4.

Amino Acid Substitutions Among 12IH26, 14-I-605-C1, 14-I-605-C2, and Previous Strains

Position of amino acid substitution ^a
	Nonstructural protein											Structural protein
	nsP1		nsP2	nsP3						nsP4		6K
Strain	354	385	1178	1347	1730	1735	1738	1763	1793	2372	2448	780
12IH26	A	V	A	S	A	V	L	A	P	T	S	I
14-I-605-C1	A	L	A	S	A	V	L	T	P	T	S	I
14-I-605-C2	V	V	A	S	A	V	L	T	P	T	S	I
Other strains^b	A	V	V or A	G or S	T or I	I or V	M	A	S or T or P	A	N or S	L

Positions are based on the amino acid sequence of the GETV strain 12IH26.

GETV strains MM2021, Sagiyama, M1, MI-110-C1, MI-110-C2, LEIV 16275 Mag, LEIV 17741 MPR, HB0234, South Korea, YN0540, Kochi/01/2005, SC1210 (Table 2).

To clarify the phylogenetic position of the strain 12IH26, we performed phylogenetic analyses based on the whole genome, E2 gene, partial C gene (543 nt), and partial nsP1 gene (351 nt) sequences among GETV strains (Fig. 1). In all cases, the 12IH26 strain formed a robust clade with the strains 14-I-605-C1 and 14-I-605-C2 (Fig. 1). Based on the nucleotide sequences of their E2 genes, the strains 12IH26, 14-I-605-C1, and 14-I-605-C2 were closely related to the Chinese strains SH05-15 and SH05-16 (Fig. 1b). Interestingly, phylogenetic analysis using partial C and nsP1 gene sequences showed that the recent Japanese strains 12IH26, 14-I-605-C1, and 14-I-605-C2 formed a clade with the Chinese and South Korean strains, but not with the previous Japanese strains (Fig. 1c, d).

FIG. 1.

Phylogenetic analyses of GETV strains. Dendrogram of the phylogenetic relationships among the GETV strain 12IH26, other GETV strains, and other related alphaviruses based on their whole genome sequences (a). Dendrogram of the phylogenetic relationships among the GETV strain 12IH26 and other GETV strains based on the nucleotide sequences of their viral E2 genes (b), the partial nucleotide sequences of their viral C genes (c), and the partial nucleotide sequences of their viral nsP1 genes (d). In all dendrograms, the percentages of 1000 bootstrap replications were indicated at the nodes. The GETV strain detected in this study was indicated with black arrows. The GETV strains used in these phylogenetic analyses were indicated using their strain names, country of origin, and collection dates.

GETV prevalence in the Culex tritaeniorhynchus mosquito population in Nagasaki in 2012

The infectious agents present in the 11 CPE-positive samples other than 12IH26 were identified as GETV by RT-PCR assay. Therefore, the minimum GETV infection rate [MIR = (number of positive pools/total specimens tested) × 1000] in Cx. tritaeniorhynchus mosquitoes was calculated to be 13.3. The nucleotide sequences of whole E2 regions of these 11 strains were 100% identical to that of the 12IH26 strain (data not shown). These results suggest that the mosquitoes may have fed on viremic animals (presumably domestic pigs) infected with a genetically homogenous GETV strain circulating in or near our collection site.

Discussion

In this study, we reported the genetic characterization and phylogenetic analysis of GETV strain 12IH26 isolated from Cx. tritaeniorhynchus mosquitoes collected in Nagasaki, Japan in 2012. The collected mosquitoes exhibited a high prevalence of GETV (MIR = 13.3) indicating a high-infection risk in domestic animals, whose value was much higher than those of previous studies in Japan: MIR = 0.28–0.36 in Cx. tritaeniorhynchus mosquitoes and 0.85–2.22 in Ae. vexans nipponii mosquitoes in Ibaraki in 1979 (Kumanomido et al. 1986a), MIR = 0.31–0.72 and 0.87 in Cx. tritaeniorhynchus mosquitoes in Miyazaki and Shiga, respectively, in 1980 (Kumanomido et al. 1986b). However, to date, there are no reports of suspicious or positive cases of GETV infections in pigs, horses, or other animals around our study site in Nagasaki.

Interestingly, the phylogenetic analyses revealed that the strain 12IH26 was most closely related to strains 14-I-605-C1 and 14-I-605-C2, the epidemic strains from the 2014 outbreak at Miho village in Ibaraki, which is about 1000 km away from Nagasaki. In Japan, natural GETV infection in animals is generally thought to occur constantly nationwide, although there are only a few reports on recent GETV prevalence (Sugiura and Shimada 1999, Kyoto biken information for swine veterinarians; available at http://kyotobiken.sakura.ne.jp/security/index.php). In the early 2000s, anti-GETV antibodies were detected in 43 of 90 (47.8%) sera from wild boars in Kyushu district, Japan (Sugiyama et al. 2009), suggesting the presence of an indigenous GETV transmission cycle in this area of Japan. Since 2005, we have continued annual arbovirus surveillance in Cx. tritaeniorhynchus mosquitoes collected at the same study site in Nagasaki, but GETV had never been isolated before this study. Although only limited numbers of mosquito samples had been tested in our continued studies, it is noteworthy that an unprecedented number of GETV isolates were obtained at the same site. We assume that the GETV isolates in this study originated from a newly arrived invasive strain from overseas, but not an indigenous strain.

Sequence analysis revealed that most of aa substitutions in the 12IH26 strain were observed in the carboxyl-terminal domain of the nsP3 protein and were identical to those of the strains 14-I-605-C1 and 14-I-605-C2. Nemoto et al. (2016) suggested that the mutations in the nsP3 region of the strains 14-I-605-C1 and 14-I-605-C2 might result in altered interactions between GETV and its vectors because carboxyl-terminal domain of nsP3 has been reported to be involved in replication and vector specificity of the genus Alphavirus. In this regard, a recent study revealed that the nsP3 protein of Chikungunya virus (CHIKV; genus Alphavirus, family Togaviridae) interacts with a protein of the host mosquito, which is implicated in the infection efficiency of the virus to the host mosquito (Fros et al. 2015). Therefore, like CHIKV, aa substitutions in the nsP3 of the recent Japansese GETV strains might alter their virological properties. Consequently, it might facilitate the spread of the virus to the mosquito populations, resulting in a high MIR observed in this study. Further studies are needed to characterize the biological properties of these recent Japansese GETV strains in the host mosquitoes.

Phylogenetic analyses showed that the strain 12IH26, 14-I-605-C1, and 14-I-605-C2 are closely related to recent Chinese and South Korean strains, but distantly related to Japanese strains of the 1970s and 1980s. Interestingly, the GETV strain Kochi/01/2005 (derived from a swine serum sample collected in Kochi, Japan in 2005; Tajima et al. 2014) was more closely related to the Mongolian strain than the Chinese strains, South Korean strains, or other Japanese strains. These observations raise the possibility that the recent GETV strains were brought into Japan from overseas at least two times in the past few decades. This may be due to the long-distance migratory property of the vector mosquito Cx. tritaeniorhynchus (Asahina and Noguchi 1968, Ming et al. 1993, Tsuda and Kim 2008). In this regard, molecular epidemiologic studies of JEV have suggested that some JEV strains are imported within Cx. tritaeniorhynchus mosquitoes coming from mainland China to the Japanese archipelago on the west wind (Nabeshima et al. 2009, Sawabe 2014). Therefore, as is the case for JEV, Cx. tritaeniorhynchus mosquitoes infected with GETV might come flying to Japan from mainland China.

Some migratory birds go back and forth between Japan and the Korean Peninsula, northeastern China, Mongolia, or Far East Russia. Sometimes they transport avian influenza viruses (genus Influenza virus A, family Orthomyxoviridae) to Japan (Sakoda et al. 2012). As mentioned above, phylogenetic analyses showed that the GETV strain Kochi/01/2005 is closely related to the Mongolian strain, suggesting that this strain might be transported into Japan by migratory birds. Scherer et al. (1962) reported that black-crowned night herons (Nycticorax nycticorax, a migratory bird species) in heronries near Tokyo had neutralizing antibodies to SAGV, a strain of GETV originally isolated from Cx. tritaeniorhynchus mosquitoes in the same sites. In addition, in another study, antibodies against GETV were detected in sera from birds (Doherty et al. 1966), suggesting potential vertebrate hosts of GETV. Thus, GETV might also be brought into Japan by infected migratory birds; however, no studies to date have assessed the GETV infection status of the migratory birds. Future seroepidemiologic study of wild birds might help to understand the long-distance spread and persistence of GETV.

Other than migrating birds and mosquitoes, mosquitoes aboard aircraft have been identified as the greatest threat for West Nile virus (genus Flavivirus, family Flaviviridae) introduction to an island by the quantitative risk assessment of various pathways, such as human-transported mosquitoes, wind-transported mosquitoes, human-transported birds, and migratory birds (Kilpatrick et al. 2004, 2006, Douglas et al. 2007, Brown et al. 2012). Although the same risk-assessment framework is applicable to GETV introduction, data on the transport of goods and animals and especially the epidemiology of GETV are insufficient currently, and an intensive seroepidemiologic study of wild birds will be required in future.

Conclusions

Our genetic and phylogenetic analyses of GETV strains revealed that the strain 12IH26 from Nagasaki in 2012 is closely related to the epidemic strain from the 2014 outbreak in Ibaraki and may have originated from a recent GETV strain in mainland China or the Korean Peninsula. Furthermore, it was also suggested that GETV may be transported into Japan through long-distance migrations of mosquitoes or migratory birds from overseas. More information about the complete genome sequences of GETV strains from both mosquito vectors and reservoir hosts will be important for understanding the processes involved in the introduction and spread of GETV in Japan.

Footnotes

Acknowledgments

This work was supported by grants from the Japanese Ministry of Health, Labor and Welfare (24-Shinko-Ippan-007) and the Research Program on Emerging and Re-emerging Infectious Diseases from Japan Agency for Medical Research and Development, AMED.

Author Disclosure Statement

No competing financial interests exist.

References

Asahina

, Noguchi

. Long distance flight of Culex tritaeniorhynchus . Jpn J Sanit Zool, 1968; 19:110.

Bannai

, Nemoto

, Ochi

, Kikuchi

, et al. Epizootiological investigation of Getah virus infection among racehorses in Japan in 2014. J Clin Microbiol, 2015; 53:2286–2291.

Bannai

, Ochi

, Nemoto

, Tsujimura

, et al. A 2015 outbreak of Getah virus infection occurring among Japanese racehorses sequentially to an outbreak in 2014 at the same site. BMC Vet Res, 2016; 12:98.

Berge

. International Catalogue of Arboviruses Including Certain Other Viruses of Vertebrates. 2nd edition. Washington, DC: US Public Health Service, 1975.

Brown

, Adkin

, Fooks

, Atephenson

, et al. Assessing the risks of West Nile virus-infected mosquitoes from transatlantic aircraft: Implications for disease emergence in the United Kingdom. Vector Borne Zoonotic Dis, 2012; 12:310–312.

Bryant

, Crabtree

, Nam

, Yen

, et al. Isolation of arboviruses from mosquitoes collected in northern Vietnam. Am J Trop Med Hyg, 2005; 73:470–473.

Doherty

, Gorman

, Whitehead

, Carley

. Studies of arthropod-borne virus infections in Queensland. V. Survey of antibodies to group A arboviruses in man and other animals. Aust J Exp Biol Med Sci, 1966; 44:365–377.

Douglas

, Kilpatrick

, Levett

, Lavoie

. A quantitative risk assessment of West Nile virus introduction into Barbados. West Indian Med J, 2007; 56:394–397.

Fros

, Geertsema

, Zouache

, Baggen

, et al. Mosquito Rasputin interacts with chikungunya virus nsP3 and determines the infection rate in Aedes albopictus . Parasit Vectors, 2015; 8:464.

10.

Hoshino

, Isawa

, Tsuda

, Sawabe

, et al. Isolation and characterization of a new insect flavivirus from Aedes albopictus and Aedes flavopictus mosquitoes in Japan. Virology, 2009; 391:119–129.

11.

Igarashi

, Matsuo

, Hayashi

, Oda

, et al. Isolation of Japanese encephalitis and Getah viruses from mosquitoes collected in Nagasaki city in the year of 1980 and 1981, using Aedes albopictus clone C6/36 cells. Trop Med, 1982; 24:47–53.

12.

Izumida

, Takuma

, Inagaki

, Kubota

, et al. Experimental infection of Getah virus in swine. Nihon Juigaku Zasshi, 1988; 50:679–684.

13.

Kamada

, Ando

, Fukunaga

, Kumanomido

, et al. Equine Getah virus infection: Isolation of the virus from racehorses during an enzootic in Japan. Am J Trop Med Hyg, 1980; 29:984–988.

14.

Kilpatrick

, Daszak

, Goodman

, Rogg

, et al. Predicting pathogen introduction: West Nile virus spread to Galáipagos. Conserv Biol, 2006; 20:1224–1231.

15.

Kilpatrick

, Gluzberg

, Burgett

, Daszak

. Quantitative risk assessment of the pathways by West Nile virus could reach Hawaii. EcoHealth, 2004; 1:205–209.

16.

Kumanomido

, Fukunaga

, Ando

, Kamada

, et al. Getah virus isolations from mosquitoes in an enzootic area in Japan. Nihon Juigaku Zasshi, 1986a; 48:1135–1140.

17.

Kumanomido

, Fukunaga

, Kamada

, Imagawa

, et al. Getah virus isolations from mosquitoes collected at two horse habitations in the western areas of Japan. Nihon Juigaku Zasshi, 1986b; 48:1191–1197.

18.

Kumar

., Stecher

, Tamura

. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol, 2015. [Epub ahead of print].

19.

, Qiu

, Yang

, Rao

, et al. Isolation of Getah virus from mosquitoes collected on Hainan Island, China, and results of a serosurvey. Southeast Asian J Trop Med Public Health, 1992; 23:730–734.

20.

Mair

, Timoney

. Getah virus infection. In: Mair

, Hutchinson

, eds. Infectious Disease of the Horse. Kent, UK: Geerings Pint Ltd.; 2009:155–158.

21.

Ming

, Jin

, Riley

, Reynolds

, et al. Autumn southward ‘return’ migration of the mosquito Culex tritaeniorhynchus in China. Med Vet Entomol, 1993; 7:323–327.

22.

Nabeshima

, Loan

HTK

, Inoue

, Sumiyoshi

, et al. Evidence of frequent introductions of Japanese encephalitis virus from south-east Asia and continental east Asia to Japan. J Gen Virol, 2009; 90:827–832.

23.

Nemoto

, Bannai

, Tsujimura

, Kikuchi

, et al. Getah virus infection among racehorse, Japan, 2014. Emerg Infect Dis, 2015; 21:883–885.

24.

Nemoto

, Bannai

, Tsujimura

, Yamanaka

, et al. Genomic, pathogenic, and antigenic comparisons of Getah virus strains isolated in 1978 and 2014 in Japan. Arch Virol, 2016 [Epub ahead of print].

25.

Powers

, Huang

, Roehrig

, Strauss

, et al. Family Togaviridae . In: King

, Adams

, Lefkowitz

, eds. Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses. London, UK: Elsevier Academic Press, 2011:1103–1110.

26.

Sakoda

, Ito

, Uchida

, Okamatsu

, et al. Reintroduction of H5N1 highly pathogenic avian influenza virus by migratory water birds, causing poultry outbreaks in the 2010–2011 winter season in Japan. J Gen Virol, 2012; 93:541–550.

27.

Sawabe

. Domestic overwintering and overseas migration in Japanese encephalitis virus. Antib Chemother, 2014; 30:255–265.

28.

Scherer

, Funkenbusch

, Buescher

, Izumi

. Sagiyama virus, a new group A arthropod-borne virus from Japan. I. Isolation, immunologic classification, and ecologic observations. Am J Trop Med Hyg, 1962; 11:255–268.

29.

Sentsui

, Kono

. Reappearance of Getah virus infection among horses in Japan. Nihon Zyuigaku Zasshi, 1985; 47:333–335.

30.

Shirako

, Yamaguchi

. Genome structure of Sagiyama virus and its relatedness to other alphaviruses. J Gen Virol, 2000; 81:1353–1360.

31.

Simpson

DIH

, Way

, Platt

, Bowen

, et al. Arbovirus infections in Sarawak, October 1968–February 1970: GETAH virus isolations from mosquitoes. Trans R Soc Trop Med Hyg, 1975; 69:35–38.

32.

Sugiura

, Ando

, Imagawa

, Kumanomido

, et al. An epizootiological study of Getah virus among light horses in Japan in 1979. Bull Equine Res Inst, 1981; 18:103–109.

33.

Sugiura

, Shimada

. Seroepizootiological survey of Japanese encephalitis virus and getah virus in regional horse race tracks from 1991 to 1997 in Japan. J Vet Med Sci, 1999; 61:877–881.

34.

Sugiyama

, Shimizu

, Nogami

, Suzuki

, et al. Serological survey of arthropod-borne viruses among wild boars in Japan. J Vet Med Sci, 2009; 71:1059–1061.

35.

Tajima

, Kotaki

, Yagasaki

, Taniwaki

, et al. Identification and amplification of Japanese encephalitis virus and Getah virus propagated from a single porcine serum sample: A case of coinfection. Arch Virol, 2014; 159:2969–2975.

36.

Tsuda

, Kim

. Sudden autumnal appearance of adult Culex tritaeniorhynchus (Diptera: Culicidae) at a park in urban Tokyo: First field evidence for prediapause migration. J Med Entomol, 2008; 45:610–616.

37.

Turell

, O'guinn

, Wasieloski

, Dohm

, et al. Isolation of Japanese encephalitis and Getah viruses from mosquitoes (Diptera: Culicidae) collected near Camp Greaves, Gyonggi Province, Republic of Korea, 2000. J Med Entomol, 2003; 40:580–584.

38.

Wekesa

, Inoshima

, Murakami

, Sentsui

. Genomic analysis of some Japanese isolates of Getah virus. Vet Microbiol, 2001; 83:137–146.

39.

Wen

, Zhao

, Liu

, Zhou

, et al. Genomic analysis of a Chinese isolate of Getah-like virus and its phylogenetic relationship with other alphaviruses. Virus Genes, 2007; 35:597–603.

40.

Yago

, Hagiwara

, Kawamura

, Narita

. A fatal case in newborn piglets with Getah virus infection: Isolation of the virus. Nihon Juigaku Zasshi, 1987; 49:989–994.

41.

Zhai

, Wang

, Sun

, Fu

, et al. Complete sequence characterization of isolates of Getah virus (genus Alphavirus, family Togaviridae) from China. J Gen Virol, 2008; 89:1446–14.