Abstract
Previous molecular-based studies have identified microorganisms of zoonotic and human nature in surface waters. Contaminated water can lead to human health issues, and the detection of pathogenic microorganisms is a valuable tool for the prevention of their spread. Water samples were taken from the River Tiber in and out of the city of Rome. Genetic analysis of the sequences obtained showed the presence of Coxiella burnetii in both the analyzed sites. Blast analysis showed that two sequences were identical to each other. Sequences from the polluted site showed high homology with different strains of C. burnetii. In this article, we report for the first time the presence of C. burnetii in environmental waters.
Introduction
Q
The pathogen can survive for several weeks in the environment in a dormant state, where it is resistant to otherwise detrimental conditions, including heat, drying, and many common disinfectants. This is of particular importance wherein livestock share resources, including bedding and food, resulting in potentially infective material. The main route of infection of humans occurs through the inhalation of infected fomites, but C. burnetii can also be dispersed by the wind (as aerosols). This can explain why Q fever has been found in patients without previous contact with animals. Its high infectivity, airborne transmission, and ability to persist and remain viable in the environment make C. burnetii a potential bacterial agent for use in bioterrorism (Madariaga et al. 2003). In many countries, it is classified as a HG3 organism. Owing to its efficient transmission, C. burnetii is a health hazard, especially for professionals in the livestock sector, but also for laboratory personnel exposed to potentially infectious biological material. Typical symptoms include headache and pneumonia, but also miscarriage and premature labor mostly related to vasculitis or thrombotic phenomena. Furthermore, the infection can become chronic, potentially causing fatal endocarditis (Maurin and Raoult 1999). Because the symptoms of Q fever in the acute phase are nonspecific, it is usually not correctly diagnosed.
Q fever emerged between 2007 and 2010 when an epidemic in The Netherlands originated from dairy goat farms involved more than 4000 infected people, with 25 fatalities (Karagiannis et al. 2009).
Although the number of recorded human infections has reduced in Europe (777 human cases in 2014), the threat is ever present. The Commission Decision 2003/534/EC, therefore, lists Q fever as a communicable disease to be subjected to control and surveillance in the European Union.
The European Food Safety Authority monitors occurrences of animal and zoonotic diseases across Europe, including the prevalence of Q fever in animals (ECDC 2015).
The United States Centers for Disease Control and Prevention (Kersh et al. 2010) emphasizes the presence of C. burnetii in the environment, suggesting that human exposure to the pathogen is more common than cases of Q fever currently reported.
Materials and Methods
The sampling sites were located upstream (Castel Giubileo: 41°59″14″N; 12°29′39″E) and downstream (Mezzocammino: 41°48′25″N; 12°25′05″E) of the city of Rome and visited in March of 2015. Fifty liters of water was collected from both locations and subsequently filtered using a polysulfone hollow fiber module (HF-80S; Fresenius Medical Care, Bad Homburg, Germany) within 24 h (D'Ugo et al. 2016). The hollow filter had a surface of 1.8 m2 and a cutoff size of 20 kDa as previously reported, effectively capturing waterborne microorganisms. Genetic material was extracted and specific targets were amplified as previously described (Chen et al. 2011), thus obtaining DNA libraries subsequently sequenced. Sequences were generated by Eurofins MWG Operon (Ebersberg, Germany) and analyzed using Chromas (Technelysium, Pty Ltd, Brisbane, Australia). Generated sequences were used as target to design internal primers F1-Cox TGAACCTTATCGGCTACCCC, 73–93; R1-Cox TATCGGTAGTTTTGCTAAGG, 416-397, KU866424) for C. burnetii. PCR and sequencing were performed on DNA libraries to confirm the presence of C. burnetii.
Results and Discussion
Blast searches were performed for the obtained sequences to find their closest phylogenetic neighbors and showed an homology of 99% with different strains of C. burnetii (Fig. 1). Sequences are submitted under accession numbers KU866424 and KU866425 (Mezzocammino and Castel Giubileo, respectively). Although it was not possible to establish viability and infectivity of C. burnetii from the water samples, the detectable presence of DNA in the Tiber River, in the city of Rome, may indicate a potential risk for human health. To our knowledge, there is no information about the presence of C. burnetii in surface water. Furthermore, there are no data about the roles contaminated environmental water plays in the transmission of this microorganism to humans and animals.

Phylogenetic tree of the obtained sequences aligned with known strains of Coxiella burnetii. Bayesian Information Criterion was used to determine the model of nucleotide substitution that best fits the data (9). Evolutionary analyses were conducted using the maximum likelihood method based on the Tamura 3-parameter model. The tree is drawn to scale, with branch lengths measured as the number of substitutions per site. The Tiber River sequences are shown in bold (KU866424 and KU866425).
Direct contact with contaminated environmental water (ingestion) and infection through aerosols could pose risks of infection to citizens and animals. Monitoring strategies to detect C. burnetii in the air (de Rooij et al. 2016) could be integrated with monitoring soil and water, providing a useful tool to study and prevent outbreaks of C. burnetii originated from the environment.
Conclusions
In this article, we report for the first time that Tiber River sampled in Rome showed presence of C. burnetii.
Footnotes
Acknowledgments
This work is part of the European project μAQUA-Universal microarrays for the evaluation of fresh water quality based on detection of pathogens and their toxins THEME (KBBE.2010.3.2-04) (Innovative aquatic biosensors—Call: FP7-KBBE-2010-4) grant agreement no. 265409 and was funded by the Seventh Framework Programme for Research and Technological Development. The authors thank all the μAQUA project partners for their scientific and technical contribution.
Author Disclosure Statement
No competing financial interests exist.
