Antimicrobial Susceptibility and Genotypic Characteristic of Campylobacter spp. Isolates from Free-Living Birds in Poland

Abstract

Campylobacter spp. is the most commonly reported, bacterial cause of human foodborne infection worldwide. Commercial poultry and free-living birds are natural reservoirs of three particular species: Campylobacter jejuni, Campylobacter coli, and Campylobacter lari. The aim of this study was to determine the genotypic characteristics and antibiotic susceptibility of 43 Campylobacter strains, obtained from free-living birds, in Poland. In total, 700 birds were examined. The strains were isolated from 43 birds (6.14%) from the feces of 7 wild bird species: Mallard ducks Anas platyrhynchos (29 positive/121 tested), great cormorants Phalacrocorax carbo (5/77), velvet scoters Melanitta fusca (4/30), tawny owls Strix aluco (2/5), common buzzard Buteo buteo (1/3), rook Corvus frugilegus (1/6), and Eurasian tree sparrow Passer montanus (1/30). Thirty-eight (88.37%) of obtained strains belonged to C. jejuni and five (11.63%) to C. coli. Other 428 examined birds from different bird species were Campylobacter negative. The antimicrobial susceptibility to nine antimicrobials was also studied in investigated isolates of Campylobacter spp. Sixteen of the examined strains (37.21% of all positive samples) showed susceptibility to all of the nine antimicrobials. Moreover, the prevalence of selected virulence genes, such as flaA, cadF, ceuE, virB11, cdtA, cdtB, and cdtC were all analyzed. The virulence gene that was found most frequently in total number of Campylobacter strains was ceuE (72.10%) and other genes, such as flaA, cadF, cdtA, cdtB, and cdtC, were found in over 60% of all examined strains. Variable antimicrobial susceptibility and the presence of different virulence genes of examined strains, isolated from free-living birds, suggest that special attention should be given to wild birds and any potential approaches to the control of antibiotic-resistant Campylobacter should be discussed.

Introduction

According to a report of the European Food Safety Authority (EFSA) and the European Center for Disease Prevention and Control (ECDC), campylobacteriosis was the most commonly reported zoonosis in the European Union (EU) in both 2013 and 2014 (EFSA 2015a, 2015b, Scientific Reports). The occurrence of Campylobacter (particularly Campylobacter jejuni) in broiler meat continued to be high at the EU level.

Consumption of undercooked poultry or poultry products is one of the major risk factors for human campylobacteriosis. C. jejuni causes ∼90% of human infections, whereas most of the remaining cases are caused by Campylobacter coli (Gillespie et al. 2002). Campylobacter lari occasionally causes disease, mostly in immunocompromised patients (Martinot et al. 2001). Following gastrointestinal infections, 1% of cases caused by C. jejuni may develop peripheral neuropathies, including Guillain–Barré syndrome, reactive arthritis, and functional bowel diseases, such as irritable bowel syndrome (Epps et al. 2013).

Campylobacter colonizes the intestines of chickens, turkeys, and waterfowl, but is generally nonpathogenic in birds, which might be asymptomatic transmitters of this bacteria (Kramer et al. 2000). Commercial poultry and free-living birds are natural reservoirs of Campylobacter, where the C. jejuni, C. coli, and C. lari species are the most frequently isolated (Shane 2000, Frost 2001, Hughes et al. 2009). The occurrence of Campylobacter spp. in the gut of apparently healthy wild birds has also been reported (Waldenström et al. 2002, Abdollahpour et al. 2015).

Transmission of Campylobacter spp. from birds, including free-living birds to humans can mostly occur by direct or indirect contact, through contaminated food or water (Berghaus and Stewart-Brown 2013). Direct contact with infected animals has also been documented, as a mean of disease transmission (Blaser et al. 1978, Velazgez et al. 1995, Alterkuse et al. 1999). Campylobacter can be dangerous to people, with a lower immunological system, especially to senior citizens or children less than 5 years of age, spending their time at such public resting places.

Many public places, such as main market squares, beaches, or playgrounds located in parks are natural habitats for wild birds, which may carry many different bacteria, including Campylobacter (French et al. 2009, Abdollahpour et al. 2015). In addition, an increasing proportion of noneffective therapy among human infections, caused by antimicrobial-resistant Campylobacter has been reported (Alterkuse et al. 1999). There are also more reports on the increasing resistance of Campylobacter strains, isolated from domestic animals, such as poultry or swine (Gallay et al. 2007, Woźniak 2011). Little information is available on the antibiotic susceptibility and virulence genes in Campylobacter spp., isolated from free-living birds.

In this study, we have focused on the prevalence of Campylobacter spp. in wild birds, in Poland. The affiliation of isolates to the genus and species of Campylobacter was determined, as well. Moreover, the antibiotic susceptibility and genotypic characteristic of 43 Campylobacter strains were analyzed.

The evaluation of the occurrence of selected pathogenic (virulence and toxin) genes, such as flaA, cadF, ceuE, virB11, and cdtA, cdtB, cdtC was performed as well. The flagellin A-pathogenic gene is responsible for the expression of adherence and colonization (flaA). Gene cadF encodes a cadF protein, which mediates the binding of C. jejuni to fibronectin, promotes bacterium–host cell interaction, and is important for colonization. Gene ceuE is a virulence gene encoding a lipoprotein for C. jejuni and C. coli separately. The plasmid-associated, pathogenic gene is responsible for the expression of invasion (virB11). The CDT-cytolethal, distending toxin genes, is responsible for the expression of toxin production (cdtA, cdtB, and cdtC).

Materials and Methods

Sample collection

The material was collected from September 2011 to August 2013. Seven hundred feces and cloacal swab samples from 40 species of wild birds were obtained, including 278 from waterbirds, 13 from birds of prey, 391 from passerines, and 18 from other wild birds. Samples were raised by ornithologists, in six different regions of Poland (Table 1). The feces from small garden birds were collected using the special cotton bags (different color for different bird species), where the birds were waiting for measurement by ornithologists. The rectal swabs from larger animals were taken individually from every bird. Each sample (around 1 g of feces) was stored at a temperature of 4°C in Amies Transport Medium (Copan Italia S.P.A., Brescia, Italy) and transported to the laboratory with ca. 18–24 h.

Table 1.

The Prevalence of Campylobacter jejuni and Campylobacter coli in Different Species of Free-Living Birds

			No. of positive birds, n (%)
Species of bird (English/Latin)	Localization and time of isolation	No. of examined birds	C. jejuni	Campylobacter coli
Waterbirds
Mallard duck/Anas platyrhynchos	A, B	121	29 (23.96)	0 (0.0)
Great cormorant/Phalacrocorax carbo	A	77	0 (0.0)	5 (6.49)
Velvet scoter/Melanitta fusca	C	30	4 (13.3)	0 (0.0)
Mute swan/Cygnus olor (27); graylag goose/Anser anser (4); Eurasian coot/Fulica atra (7); whooper swan/Cygnus cygnus (6); razorbill/Alca torda (1); long-tailed duck/Clangula hyemalis (1); great crested grebe/Podiceps cristatus (1); common scoter/Melanitta nigra (1); red-throated loon/Gavia stellata (1); guillemot/Uria aalge (1)	A, B, C, F	50	0 (0.0)	0 (0.0)
Total		278	33 (11.87)	5 (1.80)
Birds of prey and owls
Common buzzard/Buteo buteo	F	3	1 (33.33)	0 (0.0)
Tawny owl/Strix aluco	B, F	5	2 (40.0)	0 (0.0)
Kestrel/Falco tinnunculus (3); little owl/Athene noctua (1); Eurasian marsh harrier/Circus aeruginosus (1)	B, F	5	0 (0.0)	0 (0.0)
Total		13	3 (23.08)	0 (0.0)
Passerines
Eurasian tree sparrow/Passer montanus	B, D, E	30	1 (3.33)	0 (0.0)
Rook/Corvus frugilegus	B	6	1 (16.66)	0 (0.0)
Great tit/Parus major (70); blue tit/Cyanistes caeruleus (33); hooded crow/Corvus cornix (6); starling/Sturnus vulgaris (9); Eurasian siskin/Carduelis spinus (26); greenfinch/Carduelis chloris (17); blackbird/Turdus melura (5); magpie/Pica pica (3); black redtstart/Phoenicurus ochruros (3); waxwing/Bombycilla garrulus (3); chiffchaff/Phylloscopus collybita (36); bluethroat/Luscinia svecica (43); reed bunting/Emberiza schoeniclus (31); robin/Erithacus rubecula (14); redpoll/Carduelis flammea (47); Eurasian reed warbler/Acrocephalus scirpaceus (5); fieldfare/Turdus pilaris (4)	B, D, E, F	355	0 (0.0)	0 (0.0)
Total		391	2 (0.51)	0 (0.0)
Other birds
Common swift/Apus apus (5);wood pigeon/Columba palumbus (6); common pheasant/Phasianus colchicus (7);	B, D, F	18	0 (0.0)	0 (0.0)
In total		700	38 (5.43)	5 (0.71)

A—The ponds of the Lower Silesia region (51.2667°N, 17.3333°E; 51.3044°N, 16.5939°E) nature reserves; material collected during early winter of year 2011 and from August 15 until December 15, 2012.

B—Wrocław city center, suburbs (around residential private properties and agricultural lands, including farms), and parks (51.1000°N, 17.0333°E); material collected in winter and early spring of 2011/2012 and 2012/2013.

C—The Baltic coast (54.3833°N, 19.4500°E); material collected during winter and early spring of 2012/2013.

D—Rakutowskie Lake of the Kuyavian–Pomeranian Voivodeship (northern Poland; 52.5333°N, 19.2500°E), quite close to the farm land. Material collected during summer and early autumn 2012 and 2013.

E—The Sudetic Mountains (southern Poland–Bukówka Lake 50.71230°N, 15.94030°E)-nature reserve; material collected during late summer and autumn 2012 and 2013.

F—Two, wildlife rescue centers (51.132185°N 17.284803°E; 53.8833°N, 20.3500°E), material collected constantly during year 2012 and 2013, but mostly collected during late winter and spring of both years.

Ornithologists ringed the birds, with the consent of the General Directorate of Environmental Protection, Poland (nos. 253/2012 and 259/2013). Cloacal swabs from mallard ducks and black coots were obtained, during the hunting season, by two hunting associations, in accordance with local hunting laws, special permission (with the consent of the Regional Directorate of Environmental Protection, Wrocław, Poland, no. WPN. 6205.67.2012.MK.1), and hunting programs. Samples from great cormorants were obtained during the annual population cull, in Poland. Cloacal swabs from waterbirds of the Baltic coast were collected from birds found dead in fishing nets. The research was conducted with the consent of the Second Local Ethics Committee for Animal Experiments with decision that no permission was needed. No animal was killed specifically for this study.

Campylobacter isolation and identification

Samples were transmitted into 3 mL of Bolton broth (Oxoid, Basingstoke, United Kingdom), and incubated at 42°C for 48 h in a microaerobic atmosphere (French et al. 2009). In the next step, cultures were streaked on the modified charcoal cefoperazone desoxycholate agar plates (Oxoid) and incubated at 42°C under microaerobic conditions for 48 h. Colonies suspected of being Campylobacter spp. were examined for cell morphology by Gram staining method, motility, catalase, oxidase, and hippurate hydrolysis reactions (Hendriksen et al. 2003). All isolates were stored in Microbank vials (Microbank, Pro-Lab Diagnostics, Round Rock, TX) at −80°C until required for further investigations.

DNA extraction and PCR amplification

The bacterial, genomic DNA was extracted, using the GeneJET Genomic DNA Purification Kit (Thermo Fischer Scientific, Tewksbury, MA), whereas plasmid DNA was extracted using the Thermo Scientific GeneJet Plasmid MiniPrep Kit (Thermo Fischer Scientific) according to manufacturer's instructions. The DNA was quantified spectrophotometrically (BioPhotometer, Eppendorf, Wesseling-Berzdorf, Germany) and stored at −20°C.

The genus Campylobacter was confirmed with single PCR. The species level of C. jejuni, C. coli, and C. lari was determined in another multiplex PCR. The protocols for the PCR were performed as described by Wangroongsarb et al. (2011). The primer sequences used for amplification were previously described (Stucki et al. 1995, Linton et al. 1996, Gonzalez et al. 1997, Wangroongsarb et al. 2011) and are summarized in Table 2. Products obtained in amplification were divided by electrophoresis method in 2.5% agarose gel. DNA bands were stained with Midori Green DNA Stain (Nippon Genetics Europe GMbH, Dueren, Germany) and visualized with an UV transilluminator.

Table 2.

Primers Used in Polymerase Chain Reactions of the Present Study (Detection of the Genus and the Selected Species of Campylobacter, as Well as of Virulence Genes)

	Gene	Sequence (5′→3′)	Product (bp)	References
Campylobacter spp.	16S rRNA	AGTCTTGGCAGTAATGCACCTAACG	408	Wangroongsarb et al (2011)
Campylobacter spp.	16S rRNA	ATATGCCATTGTAGCACGTGTGTCG	408	Wangroongsarb et al (2011)
Campylobacter jejuni	mapA	CTATTTTATTTTTGAGTGCTTGTG	589	Stucki et al. (1995)
Campylobacter jejuni	mapA	GCTTTATTTGCCATTTGTTTTATTA	589	Stucki et al. (1995)
C. coli	ceuE	AATTGAAAATTGCTCCAACTATG	462	Gonzalez et al. (1997)
C. coli	ceuE	TGATTTTATTATTATTTGTAGCAGCG	462	Gonzalez et al. (1997)
Campylobacter lari	16S rRNA	CAAGTCTCTTGTGAAATCCAAC	561	Linton et al. (1996)
Campylobacter lari	16S rRNA	ATTTAGAGTGCTCACCCGAAG	561	Linton et al. (1996)
Virulence gene	flaA	GGATTTCGTATTAACACAAATGGTGC	1728	Nachamkin et al. (1993)
Virulence gene	flaA	CTGTAGTAATCTTAAAACATTTTG	1728	Nachamkin et al. (1993)
Virulence gene	cadF	TGGAGGGTAATTTAGATATG	400	Konkel et al. (1999)
Virulence gene	cadF	CTAATACCTAAAGTTGAAAC	400	Konkel et al. (1999)
Virulence gene	ceuE C. jejuni	CCTGCTCGGTGAAAGTTTTG	794	Bang et al. (2003)
Virulence gene	ceuE C. jejuni	GATCTTTTTGTTTTGTGCTGC	794	Bang et al. (2003)
Virulence gene	ceuE C. coli	ATGAAAAAATATTTAGTTTTTGCA	894	Bang et al. (2003)
Virulence gene	ceuE C. coli	ATTTTATTATTTGTAGCAGCG	894	Bang et al. (2003)
Virulence gene	virB11	GAACAGGAAGTGGAAAAACTAGC	708	Bang et al. (2003)
Virulence gene	virB11	TTCCGCATTGGGCTATATG	708	Bang et al. (2003)
Toxin gene	cdtA	GGAAATTGGATTTGGGGCTATACT	165	Bang et al. (2003)
Toxin gene	cdtA	ATCACAAGGATAATGGACAAT	165	Bang et al. (2003)
Toxin gene	cdtB	GTTAAAATCCCCTGCTATCAACCA	495	Bang et al. (2001)
Toxin gene	cdtB	GTTGGCACTTGGAATTTGCAAGGC	495	Bang et al. (2001)
Toxin gene	cdtC	TGGATGATAGCAGGGGATTTTAAC	555	Bang et al. (2003)
Toxin gene	cdtC	TTGCACATAACCAAAAGGAAG	555	Bang et al. (2003)

Two strains of C. jejuni (ATCC 33560) and C. coli (ATCC 33559) were used as positive controls for isolation and identification of DNA extraction of Campylobacter.

Antimicrobial susceptibility testing (minimal inhibitory concentration)

Antimicrobial susceptibility was determined for each isolated Campylobacter strain using commercial Sensititre™ Campylobacter minimal inhibitory concentration (MIC) plates (Thermo Fischer Scientific) for nine antimicrobials: azithromycin, ciprofloxacin, erythromycin, gentamicin, tetracycline, florfenicol, nalidixic acid, telithromycin, and clindamycin, according to the manufacturer's protocols. Antimicrobials mentioned above are commonly used in human medicine against campylobacteriosis. Some of them are also popular in veterinary medicine against many bacterial infections, because of that the plates mentioned above have been chosen to check the prevalence and range of antimicrobial susceptibility among free-living birds.

MIC might indicate a potential antimicrobial contamination among examined group of birds or environment of their habitat. Ranges of antimicrobial concentrations, including MIC of examined C. jejuni and C. coli are shown in Tables 3 and 4, respectively. Bacterial isolates were categorized as susceptible, intermediate, or resistant to antimicrobials using interpretive criteria, published by the Clinical and Laboratory Standards Institute, as well as Food and Drug Administration (CLSI 2010, 2014, FDA 2013).

Table 3.

Minimal Inhibitory Concentration Distribution of Campylobacter jejuni Isolates

	Antimicrobial dilution range (μg/mL)
Antimicrobial agent	0.015	0.03	0.06	0.12	0.25	0.5	1	2	4	8	16	32	64
Waterbirds, n = 33
Azithromycin	4	2	5	4	2	2			8	2		1	3
Ciprofloxacin	8			8	4				6		3		4
Erythromycin	x	8		3	8	3		3	3	1	1		3
Gentamicin	x	x	x	7	3	12	1	2	3		2	3	x
Tetracycline	x	x		6	15					2	7		3
Florfenicol	x	4			3	8	3	6	5			2	2
Nalidixic acid	x	x	x	x	x	x	x	x	6	7	9	9	2
Telithromycin	3			2	5	6	3	3	8	3	x	x	x
Clindamycin	x	3	5	9				1	3	5	7	x	x
Birds of prey and owls, n = 3
Azithromycin									3
Ciprofloxacin				1					2
Erythromycin					1		1		1
Gentamicin	x	x	x			2	1
Tetracycline	x	x			2						1
Florfenicol	x											3
Nalidixic acid	x	x	x	x	x	x	x	x	1	2
Telithromycin				1		1				1	x	x	x
Clindamycin	x			1						2		x	x
Passerines, n = 2
Azithromycin					1				1
Ciprofloxacin	1								1
Erythromycin					2
Gentamicin	x	x	x			1	1
Tetracycline	x	x			2
Florfenicol	x	1			1
Nalidixic acid	x	x	x	x	x	x	x	x	1	1
Telithromycin	1				1						x	x	x
Clindamycin	x	1								1		x	x

Sensitive

Intermediate

Resistant

Breakpoints were adopted from CLSI (Clinical and Laboratory Standards Institute), when available; for florfenicol, only a susceptible breakpoint (≤4 μg/mL) has been established. In this report, isolates with an MIC >8 μg/mL are categorized as resistant; x—means that the dilution range marked in this box was not examined for a given antimicrobial.

MIC, minimal inhibitory concentration.

Detection of genes associated with virulence (PCR)

All of the virulence and toxin genes, flaA, cadF, ceuE, virB11, cdtA, cdtB, and cdtC, were detected using the method described by Nachamkin et al. (1993), Gonzalez et al. (1997), Konkel et al. (1999), Bang et al. (2001), and Bang et al. (2003). The primer sequences used in this study and size of PCR amplicons are presented in Table 2.

Results

Bacteria of the genus Campylobacter were detected in 43 (6.14%) of all 700 examined birds. Most of the positive samples (38) were obtained from free-living waterbirds: Mallard ducks Anas platyrhynchos (29), great cormorants Phalacrocorax carbo (5), and velvet scoters Melanitta fusca (4). Other strains of Campylobacter were isolated from tawny owl Strix aluco (2), the common buzzard Buteo buteo (1), rook Corvus frugilegus (1), and the Eurasian tree sparrow Passer montanus (1) (Table 1). Thirty-eight (88.37% of all Campylobacter isolates) obtained strains belonged to C. jejuni species (isolated from waterbirds, birds of prey, owls, and passerines), whereas five (11.63%) to C. coli (all were isolated from great cormorants).

This study revealed the high variability of antimicrobial susceptibility detected by MIC among Campylobacter strains, isolated from free-living birds in Poland. Sixteen strains (37.21% of all isolates) showed susceptibility to all of the nine antimicrobials. All of the MIC values for examined Campylobacter strains are shown in Tables 3 and 4.

Table 4.

Minimal Inhibitory Concentration of Campylobacter coli (n = 5) Isolated from Great Cormorants

Antimicrobial agent	0.015	0.03	0.06	0.12	0.25	0.5	1	2	4	8	16	32	64
Azithromycin					2				3
Ciprofloxacin	1			1	1					2
Erythromycin					3		1					1
Gentamicin	x	x	x	2		3
Tetracycline	x	x			4						1
Florfenicol	x					2		2					1
Nalidixic acid	x	x	x	x	x	x	x	x	3	2
Telithromycin					2	3					x	x	x
Clindamycin	x		1	2							2	x	x

Gray color indicates the antimicrobial resistance.

x—means that the dilution range marked in this box was not examined for a given antimicrobial.

The isolates of C. jejuni obtained from waterbirds were mostly resistant to ciprofloxacin (39.39%), clindamycin (36.36%), and tetracycline (30.30%), whereas low resistance was detected to erythromycin (9.09%). No resistance was detected to telithromycin. Among examined C. jejuni collected from birds of prey and owls, the highest resistance was shown to florfenicol (100.0%), but only three Campylobacter strains were obtained in this group of birds. The MIC values for C. jejuni isolated from other groups of birds (birds of prey, passerines) are presented in Table 3. The isolates of C. coli obtained from great cormorants were mostly resistant to ciprofloxacin, nalidixic acid, and clindamycin (all 40%). All five isolates of C. coli were susceptible to azithromycin, gentamicin, and telithromycin (Table 4).

The values of MIC₅₀ and MIC₉₀ were calculated only for 33 of C. jejuni strains isolated from waterbirds and for 5 of C. coli isolated from great cormorants (Table 5). The highest values of MIC₅₀ and MIC₉₀ in both C. jejuni and C. coli were detected for nalidixic acid and comprised of MIC₅₀—16 μg/mL and MIC₉₀—32 μg/mL for C. jejuni, whereas MIC₅₀—4 μg/mL and MIC₉₀—8 μg/mL for C. coli. The values of MIC₅₀ and MIC₉₀ of C. jejuni and C. coli detected for tetracycline were the same (MIC₅₀ was 0.25 μg/mL and MIC₉₀ was 16 μg/mL) and clindamycin (MIC₅₀ was 0.12 μg/mL and MIC₉₀ was 16 μg/mL).

Table 5.

Values of MIC₅₀ and MIC₉₀ for Campylobacter jejuni Isolated from Waterbirds and for Campylobacter coli Isolated from Great Cormorants

	C. jejuni (n = 33)		C. coli (n = 5)
Antimicrobial agent	MIC₅₀ (μg/mL)	MIC₉₀ (μg/mL)	MIC₅₀ (μg/mL)	MIC₉₀ (μg/mL)
Azithromycin	0.25	32	—	4
Ciprofloxacin	0.25	64	0.25	8
Erythromycin	0.25	16	0.25	32
Gentamicin	0.5	16	—	0.5
Tetracycline	0.25	16	0.25	16
Florfenicol	0.5	32	2	64
Nalidixic acid	16	32	4	8
Telithromycin	2	4	—	0.5
Clindamycin	0.12	16	0.12	16

Among all C. jejuni strains 0.25 μg/mL as a value of MIC₅₀ was detected for azithromycin, ciprofloxacin, erythromycin, and tetracycline. The values of MIC₉₀ for these four antimicrobials among C. jejuni strains were 32, 64, 16, and 16 μg/mL, respectively. Similar values of MIC₅₀ (0.25 μg/mL) for ciprofloxacin, erythromycin, and tetracycline were found among C. coli strains. MIC₅₀ for azithromycin could not be defined. The values of MIC₉₀ for azithromycin, ciprofloxacin, erythromycin, and tetracycline among C. coli isolates were: 4, 8, 32, and 16 μg/mL, respectively. All of the other values of MIC₅₀ and MIC₉₀ are shown in Table 5.

Nineteen (50.00%) strains belonging to the C. jejuni and three (60.00%) of five C. coli strains were multidrug resistant (MDR). Two (4.65%) of all Campylobacter strains were resistant to six antimicrobials, another four (9.30%) strains were resistant to five antimicrobials, seven (16.28%) to four antimicrobials, and nine (20.93%) to three antimicrobials (data not shown).

The results of prevalence of putative virulence and toxin genes among C. jejuni and C. coli strains isolated from free-living birds in Poland are summarized in Table 6. Among virulence gen ceuE (72.10% of all strains; 68.42% of C. jejuni and 100.00% of C. coli isolates) was the most common, followed by flaA and cadF (69.77% of all strains; 71.05% of C. jejuni; and 60.00% of C. coli strains). VirB11 was detected in 13 isolates (30.23%). Toxin gens, cdtA, cdtB, and cdtC, were found in 30 (69.77%), 29 (67.44%), and 25 (58.13%) of isolates of Campylobacter spp., respectively.

Table 6.

The Prevalence of Selected Virulence and Toxin Genes in Campylobacter jejuni and Campylobacter coli Isolated from Free-Living Birds

		Genes, n (%)
Campylobacter species	No. of isolates	flaA	cadF	ceuE	virB11	cdtA	cdtB	cdtC
C. jejuni	38	27 (71.05)	27 (71.05)	26 (68.42)	12 (31.58)	27 (71.05)	26 (68.42)	22 (57.89)
C. coli	5	3 (60.0)	3 (60.0)	5 (100.0)	1 (20.0)	3 (60.0)	3 (60.0)	3 (60.0)
Total	43	30 (69.76)	30 (69.76)	31 (72.09)	13 (30.23)	30 (69.76)	29 (67.44)	25 (58.13)
Percentage	100.00	69.77	69.77	72.10	30.23	69.77	67.44	58.13

Discussion

The prevalence and characterization of Campylobacter within wild birds were evaluated to assess the probability of transfer of these bacteria to commercially reared poultry, domestic animals, and people. The overall prevalence of Campylobacter spp. in all free-living birds examined in the present study was 6.14%. This result is higher than the results obtained by Hughes et al. (2009) in Northern England, which was 1.4% (nevertheless, the amount of all examined birds in England exceeded 2000), but was comparable to the results obtained by Keller et al. (2011) in the USA, who reported a prevalence of 7.2%. Incidence in birds may vary from 0–100% depending on bird species, feeding habits, and localization. Because of that the same author, in 2014, revealed the higher prevalence of Campylobacter among wild birds–9.2% (Keller and Shriver 2014). Other researchers from New Zealand (French et al. 2009), Iran (Abdollahpour et al. 2015), Japan (Shyaka et al. 2015), and Chile (Fernandez et al. 1996) reported the higher prevalence of Campylobacter spp. in wild birds, ranging from 12.5% to 17.5%, 19.7%, and 24.2%, respectively. In accordance with Waldenström et al. (2002) certain birds appear to be colonized more frequently, whereas others not at all. Readings have stated incidence rates of 21.6% in wild migrating birds (Waldenström et al. 2002), 7% (Molina-Lopez et al. 2011) or 25.3% among birds of prey (Dipineto et al. 2014), 33% in wild urban birds (Mohan 2015), and 50% (Mohan 2015) or 67.4% in aquatic birds (Fernandez et al. 1996). The Campylobacter detection rate in our study was also variable among different species and habitats of birds. Waterfowl seems to have a high carrier state. In this research, 88.37% of the isolated strains obtained from waterbirds and most of these isolates came from mallard ducks (67.44% of all isolated strains and 76.32% of the strains isolated from waterbirds). Such results are in compliance with rates reported by other authors mentioned above. Because only few strains were isolated from passerines and raptors in previous studies, the susceptibility of Campylobacter could not be compared with other results among these groups of birds.

The frequency of respective species of Campylobacter obtained in our study was as follows: C. jejuni (88.37%) and then C. coli (11.63%). A similar tendency was reported by other authors, who revealed that C. jejuni was the most commonly isolated species. C. jejuni represented a percentage from 69.5% up to 94.1% of Campylobacter spp. isolates (Fernandez et al. 1996, Keller et al. 2011, Shyaka et al. 2015). No C. lari was detected in the present study. C. lari is supposed to be the most common species of Campylobacter spp. in wild seabirds (Waldenström et al. 2002) and was isolated even from birds in Antarctica (Leotta et al. 2006). The negative result of C. lari in marine waterbirds examined in our study might be caused by time that dead birds spent under the water. The waterbirds examined in the present study, were sent to our laboratory immediately after they were found dead in fishing nets, but unfortunately we do not know how long these birds spent under the water.

Moreover, the results of 5 strains of C. coli were obtained in our research, among the population of 77 great cormorants examined from the area of one pond. This result was comparable to the results obtained by Dobbin et al. (2005) who reported the isolation of 7 strains of C. coli among 100 examined chicks of free-living double-crested cormorants Phalacrocorax auritus in Canada. Chicks of many different aquatic bird species seem to be more sensitive to Campylobacter infections than adult ones. All of C. coli-positive samples came from young great cormorants. Feng et al. (2009) have also reported that the positive rate of Campylobacter infection in young red-crowned cranes (Grus japonensis) was significantly higher than that in adult ones. Similar situation was observed by Szczepańska et al. (2015) in an investigated population of white storks. Szczepańska et al. (2015) also revealed that the samples collected from polluted areas had the highest prevalence of Campylobacter (12.2%). Weis et al. (2014) reported very high prevalence of Campylobacter in American crows caught and examined in urban, suburban, and agricultural settings. The same observation was visible in the present study. All of the positive Campylobacter samples came from birds feeding on ponds, where people spend time and rest. Although these areas are protected and isolated from urban areas, a lot of agricultural lands and properties are located in the neighborhood. Besides, wild ducks or other examined aquatic birds migrate all the time from other places, also from lakes located in big cities and urban areas, so it might be possible that they may have transmitted Campylobacter from those places. Also, each of the positive samples found in birds of prey, rook, or Eurasian tree sparrow came from birds living in suburban areas. The habitats frequented by different bird species may result in different levels of exposure to Campylobacter. According to reports on the isolation of these bacteria from surface water (Stanley et al. 1998) and to the knowledge of Waldenström et al. (2002), as Campylobacter survives in the environment, the frequent isolation of the examined pathogen from wild waterbirds, might confirm their status as carriers of Campylobacter.

Some of the Campylobacter strains, in our study, presented resistance to antibiotics, which are suggested to be effective antimicrobial agents and are used in the veterinary medicine or treatment of human campylobacteriosis (Flores et al. 1985, Gibreel et al. 2004). Most of the clinically important antimicrobial agents, such as macrolides, sulfonamides, fluoroquinolones, and tetracyclines have already been detected in soils, surface water, and groundwater, and it was proved that tetracyclines and fluoroquinolones are able to persist in the environment for long (Hirsch et al. 1999, Boxall et al. 2006, Milic et al. 2013). Many reports indicate the emergence of increasing of antimicrobial resistance among bacteria in wildlife and potential impact of this phenomenon on environment, animals, and human health. The resistance of Campylobacter strains may also vary among different countries and bird species. Antimicrobial resistance to erythromycin, ciprofloxacin, nalidixic acid, tetracycline, gentamicin, and chloramphenicol in the present study was similar to results obtained by Feng et al. (2009) in red-crowned cranes in China, but higher than the resistance of strains isolated by other authors (Waldenström et al. 2005, Szczepańska et al. 2015). Similarly, high fluoroquinolone resistance rates as in our study have been reported in Campylobacter strains isolated from humans and livestock (Nelson et al. 2007). Moreover, the increasing prevalence of multidrug resistance Campylobacter reported worldwide (Gupta et al. 2004, Luangtongkum et al. 2009, Szczepańska et al. 2015, Wieczorek et al. 2015) has also been demonstrated in our study. Waterbirds, from whom most of the Campylobacter strains were isolated, in our study, came from ponds and lakes in close proximity to human properties. Resistance in bacteria might be a response to extensive antimicrobial usage, in livestock or humans (Nelson et al. 2007). The high level of MDR strains among birds that have never been treated, might suggest their prevalence in environment, as a result of contamination from farms and represent an important public health problem, in the case of human (Nelson et al. 2007, Luangtongkum et al. 2009).

The high occurrence of selected virulence and toxin factors detected in MDR strains, examined in this study, might indicate that some free-living bird species shed Campylobacter spp. in their feces that are potentially pathogenic to humans and other animals, for example, poultry. Krutkiewicz and Klimuszko (2010) detected the same putative virulence markers among the population of Polish C. jejuni and C. coli isolates, obtained from children, chickens, pigs, and dogs. In our study, 30.23% (13/43) of all Campylobacter isolates had the virB11 gene. Most reports on Campylobacter from wild or domestic birds show rather an absence of gene virB11 (Feng et al. 2009, Krutkiewicz and Klimuszko 2010, Zhang et al. 2016). A quite high prevalence of the virB11 gene was found in pigs isolates (35.7%) (Krutkiewicz and Klimuszko 2010). Most of the research on virulence gene of Campylobacter from wild birds or poultry indicates a high prevalence of gene flaA (100%) (Feng et al. 2009, Shyaka et al. 2015, Szczepańska et al. 2015, Zhang et al. 2016). Bacterial flagellum is one of the most important virulence factors, which is associated with motility, adhesion, and invasion. In the present study, not all of the examined strains isolated from free-living birds showed the presence of the flaA gene (only 69.77%). Similar observation was reported by Weis et al. (2014), who revealed the presence of the flaA gene only in 46% (27/59) of C. jejuni isolated from American crows. In accordance with the report of Shyaka et al. (2015), C. jejuni isolates from wild birds showed a reduced motility with the exception of one isolate, which showed a high motility phenotype. Although these authors have detected genes flaA and flaB in PCR of their tested strains, they have mentioned that it has been postulated that naturally, C. jejuni can produce nonmotile deletion copies of wild-type strain that are more suitable to environments, where the flagellar expression would be unnecessary (Karlyshev et al. 2002). Moreover, gene cadF has also been reported as frequent in the population of wild birds, but the rate of prevalence is different: 100% (Shyaka et al. 2015, Szczepańska et al. 2015); 95% (Feng et al. 2009), and 69.77% in the present study. Additionally, toxin genes cdtA, cdtB, and cdtC were detected in varying rates, ranging from 100% to only 20% (Feng et al. 2009, Weis et al. 2014, Shyaka et al. 2015, Szczepańska et al. 2015). In our study, more than 58% of Campylobacter isolates obtained from free-living birds included these three genes: cdtA, cdtB, and cdtC (69.76%, 67.44%, and 58.13%, respectively). The high ratio of presence of virulence genes was observed in C. jejuni isolated from diarrheal patients in Bangladesh (Talukder et al. 2008). This author revealed that the prevalence of seven toxin and virulence genes was as follows: flaA and cadF (100.%), ceuE (82.5%), virB11 (0.0%), and cdtA, cdtB, and cdtC (97.5%).

This study demonstrated that potentially virulent strains of Campylobacter are shed (and can be transmitted) in the feces of free-living birds. The most frequent prevalence of C. jejuni, together with high antimicrobial resistance of isolates, as well as the occurrence of known virulence and toxin genes in isolates obtained from wild birds as in people, suggest that wild birds (especially waterbirds) might play an important role in the transmission of zoonotic pathogens to the environment and to people and it could be significant in the epidemiology of human campylobacteriosis. Also, C. coli, the second main cause of human campylobacteriosis, was isolated, in this study, from five great cormorants from an area of one pond—a place where entire families might rest. Specific virulence mechanisms of Campylobacter infections in humans are not yet well defined and pathogenesis of Campylobacter infection is not clearly understood, therefore, special attention should be paid to the presence of virulence markers among populations of Campylobacter isolated from free-living birds, which can be a potential source of human and/or other farm animals' infection.

Conclusions

The prevalence of C. jejuni and C. coli, coupled with the occurrence of virulence (marker) genes and resistance to antimicrobials, and multidrug resistance, suggest that free-living birds may transmit and shed bacteria in their feces that are potentially pathogenic to other animals and humans. Variable antimicrobial susceptibility and the presence of the different resistance and virulence genes of Campylobacter spp. strains, isolated from free-living birds, suggest the potential diversity of pathogenic properties, among isolates. In this case, special attention should be given to free-roaming birds (especially waterbirds) and potential approaches to the control of antibiotic-resistant Campylobacter should be discussed.

Footnotes

Acknowledgments

This research project was financed by the National Center for Research and Development, project number no. 12 0126 10.

Publication was supported by the Wroclaw Center of Biotechnology, The Leading National Research Center Program (KNOW) for years 2014–2018.

The authors are grateful to ornithologist Stanisław Rusiecki, the Odra Wrocław Bird-Ringing Group, the Sudetic Bird-Ringing Group, and the organizers of the Rakutowskie ornithological camp, as well as to Mr. Piotr Zaijczek and Mr. Mieczysław Łyskawa, for their help with collection of the samples.

Authors Disclosure Statement

No competing financial interests exist.

References

Abdollahpour

, Zehdenbad

, Alipour

, Khayatzadeh

. Wild-bird feces as a source of Campylobacter jejuni infection in children's playgrounds in Iran. Food Control, 2015; 50:378–381.

Alterkuse

, Stern

, Fields

, Swerdlov

. Campylobacter jejuni—An emerging foodborne pathogen. Emerg Infect Dis, 1999; 5:28–35.

Bang

, Nielsen

, Scheutz

, Pedersen

, et al. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J Appl Microbiol, 2003; 94:1003–1014.

Bang

, Scheutz

, Ahrens

, Pedersen

, et al. Prevalence of cytolethal distending toxin (cdt) genes and CDT production of Campylobacter spp. isolated from Danish broiler. J Med Microbiol, 2001; 50:1087–1094.

Berghaus

, Stewart-Brown

. Public health significance of poultry diseases. In: Swayne

, ed. Diseases of Poultry, 13th ed, Ames, IA: John Wiley & Sons, Inc., 2013:47.

Blaser

, Cravens

, Powers

, Wang

. Campylobacter enteritis associated with canine infection. Lancet, 1978; 2:979–981.

Boxall

ABA

, Johnson

, Smith

, Sinclair

, et al. Uptake of veterinary medicines from soils into plants. J Agric Food Chem, 2006; 54:2288–2297.

Clinical and Laboratory Standards Institute (CLSI). Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Approved Guidelines-Second Edition. Wayne, PA: Clinical and Laboratory Standards Institute, 2010.

Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. CLSI document M100-S24. Wayne, PA: Clinical and Laboratory Standards Institute, 2014.

10.

Dipineto

, De Luca Bossa

, Cutino

, Gargiulo

, et al. Campylobacter spp. and birds of prey. Avian Dis, 2014; 58:303.

11.

Dobbin

, Hariharan

, Daoust

, Hariharan

, et al. Bacterial flora of free-living Double-crested cormorant (Phalacrocorax auritus) chicks on Prince Edward Island, Canada, with reference to enteric bacteria and antibiotic resistance. Comp Immunol Microbiol Infect Dis, 2005; 28:71–82.

12.

EFSA. Scientific Report of EFSA and ECDC. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2013. EFSA J, 2015a; 13:3991–4156.

13.

EFSA. Scientific Report of EFSA and ECDC. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA J, 2015b; 13:4329–4520.

14.

Epps

, Harvey

, Hume

, Phillips

, et al. Foodborne Campylobacter: Infections; metabolism; pathogenesis and reservoirs. Int J Environ Res Public Health, 2013; 10:6292–6304.

15.

FDA. Executive Report of National Antimicrobial Resistance Monitoring System. 2011. –Enteric Bacteria (NARMS): 2011 Executive Report. Rockville, MD: U.S. Department of Health and Human Services, Food and Drug Administration, 2013.

16.

Feng

, Jiang

, Fei

, Xiao-Rong

, et al. Isolation and characterization of Campylobacter from red-crowned cranes in China. J Anim Vet Adv, 2009; 8:2442–2446.

17.

Fernandez

, Gesche

, Montefusco

, Schlatter

. Wild birds as reservoir of thermophilic enteropathogenic Campylobacter species in Southern Chile. Mem Inst Oswaldo Cruz, 1996; 91:699–700.

18.

Flores

, Fennell

, Holmes

, Stamm

. In vitro susceptibility of Campylobacter like organism to twenty antimicrobial agents. Antimicrob Agents Chemother, 1985; 39:542–544.

19.

French

, Midwinter

, Holland

, Collins-Emerson

, et al. Molecular epidemiology of Campylobacter jejuni isolates from wild-birds fecal material in children's playgrounds. Appl Environ Microbiol, 2009; 75:779–783.

20.

Frost

. Current epidemiological issues in human campylobacteriosis. J Appl Microbiol, 2001; 30:85–95.

21.

Gallay

, Prouzet-Mauleon

, Kempf

, Lehours

, et al. Campylobacter antimicrobial drug resistance among humans, broiler chickens and pigs, France. Emerg Infect Dis, 2007; 13:259–266.

22.

Gibreel

, Tracz

, Nonaka

, Ngo

, et al. Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance. Antimicrob Agents Chemother, 2004; 48:3442–3450.

23.

Gillespie

, O'Brien

, Frost

, Adak

, et al. A case–case comparison of Campylobacter coli and Campylobacter jejuni infection: A tool for generating hypotheses. Emerg Infect Dis, 2002; 8:937–942.

24.

Gonzalez

, Grant

, Richardson

, Park

, et al. Specific identification of the entheropathogens Campylobacter jejuni and Campylobacter coli using a PCR test based on the ceuE gene encoding a putative virulence determinant. J Clin Microbiol, 1997; 35:759–763.

25.

Gupta

, Nelson

, Barrett

, Tauxe

, et al. NARMS Working Group. Antimicrobial resistance among Campylobacter strains, United States, 1997–2001. Emerg Infect Dis, 2004; 10:1102–1109.

26.

Hendriksen

, Wagenaar

, Bergen

. Global Salm-Surv. A global Salmonella surveillance and laboratory support project of the World Health Organization Level 2 training course: Isolation of thermotolerant Campylobacter from faeces; identification of thermotolerant Campylobacter. 2003. Available at www.who.int/salmsurv/supported/en/ (accessed December 15, 2006 ).

27.

Hirsch

, Ternes

, Haberer

, Kratz

. Occurrence of antibiotics in the aquatic environment. Sci Total Environ, 1999; 225:109–118.

28.

Hughes

, Bennett

, Coffey

, Elliott

, et al. Molecular epidemiology and characterization of Campylobacter spp. isolated from wild bird populations in Northern England. Appl Environ Microbiol, 2009; 75:3007–3015.

29.

Karlyshev

, Linton

, Gregson

, Wren

. A novel paralogous gene family involved in phase-variable flagella-mediated motility in Campylobacter jejuni . Microbiology, 2002; 148:473–480.

30.

Keller

, Shriver

. Prevalence of three Campylobacter species C. jejuni, C. coli and C. lari, using multilocus sequence typing in wild birds of the Mid-Atlantic region, USA. J Wild Dis, 2014; 50:31–41.

31.

Keller

, Shriver

, Waldenström

, Griekspoor

, et al. Prevalence of Campylobacter in wild birds of the Mid-Atlantic region, USA. J Wild Dis, 2011; 47:750–754.

32.

Konkel

, Gray

, Kim

, Garvis

, et al. Identification of enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF virulence genes and its product. J Clin Microbiol, 1999; 38:510–517.

33.

Kramer

, Frost

, Bolton

, Wareing

. Campylobacter contamination of raw meat and poultry at retail sale: Identification of multiple types and comparison with isolates from human infection. J Food Prot, 2000; 63:1654–1659.

34.

Krutkiewicz

, Klimuszko

. Genotyping and PCR detection of potential virulence genes in Campylobacter jejuni and Campylobacter coli isolates from different sources in Poland. Folia Microbiol, 2010; 55:167–175.

35.

Leotta

, Vigo

, Giacoboni

. Isolation from Campylobacter lari from seabirds in Hope Bay, Antarctica. Pol Polar Res, 2006; 27:303–308.

36.

Linton

, Owen

, Stanley

. Rapid identification by PCR of the genus Campylobacter and of five Campylobacter species enteropathogenic for man and animals. Res Microbiol, 1996; 147:707–718.

37.

Luangtongkum

, Jeon

, Han

, Plummer

, et al. Antibiotic resistance in Campylobacter: Emergence, transmission and persistence. Future Microbiol, 2009; 4:189–200.

38.

Martinot

, Jaulhac

, Moog

, De Martino

, et al. Campylobacter lari bacteremia. Clin Microbiol Infect, 2001; 7:96–97.

39.

Milic

, Milanovic

, Letic

, Sekulic

, et al. Occurrence of antibiotics as emerging contaminant substances in aquatic environment. Int J Environ Health Res, 2013; 23:296–310.

40.

Mohan

. Faeco-prevalence of Campylobacter jejuni in urban wild birds and pets in New Zealand. BMC Res Notes, 2015; 8:1.

41.

Molina-Lopez

, Valverdú

, Martin

, Mateu

, et al. Wild raptors as carriers of antimicrobial resistant Salmonella and Campylobacter strains. Vet Rec, 2011; 168:565.

42.

Nachamkin

, Bohachick

, Patton

. Flagellin gene typing of Campylobacter jejuni by fragment lengh polymorphism analysis. J Clin Microbiol, 1993; 31:1531–1536.

43.

Nelson

, Chiller

, Powers

, Angulo

. Fluoroquinolone-resistant Campylobacter species and the withdrawal of fluoroquinolones from use in poultry: A public health success story. Clin Infect Dis, 2007; 44:977–980.

44.

Shane

. Campylobacter infection of commercial poultry. Rev Sci Tech, 2000; 19:376–395.

45.

Shyaka

, Kusumoto

, Chaisowwong

, Okouchi

, et al. Virulence characterization of Campylobacter jejuni isolated from resident wild birds in Tokachi area, Japan. J Vet Med Sci, 2015; 77:967–972.

46.

Stanley

, Cunningham

, Jones

. Isolation of Campylobacter jejuni from groundwater. J Appl Microbiol, 1998; 85:187–191.

47.

Stucki

, Frey

, Nicolet

, Burnens

. Identification of Campylobacter jejuni on the basis of a species-specific gene that encodes a membrane protein. J Clin Microbiol, 1995; 33:855–859.

48.

Szczepańska

, Kamiński

, Andrzejewska

, Śpica

, et al. Prevalence, virulence, and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli in white stork Ciconia ciconia in Poland. Foodborne Pathog Dis, 2015; 12:24–31.

49.

Talukder

, Aslam

, Islam

, Azmi

, et al. Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J Clin Microbiol, 2008; 46:1485–1488.

50.

Velazgez

, Jimenez

, Chomon

, Villa

. Incidence and transmission of antibiotic resistance in Campylobacter jejuni and Campylobacter coli . J Antimicrob Chemother, 1995; 35:173–178.

51.

Waldenström

, Broman

, Carlsson

, Hasselquist

, et al. Prevalence of Campylobacter jejuni, Campylobacter lari, and Campylobacter coli in different ecological guilds and taxa of migrating birds. Appl Environ Microbiol, 2002; 68:5911–5917.

52.

Waldenström

, Mevius

, Veldman

, Broman

, et al. Antimicrobial resistance profiles of Campylobacter jejuni Isolates from wild birds in Sweden. Appl Environ Microbiol, 2005; 71:2438–2441.

53.

Wangroongsarb

, Jittapprasatsin

, Suwannasing

, Suthivarakom

, et al. Identification of genus Campylobacter and four enteropathogenic Campylobacter species by PCR. J Trop Med Parasitol, 2011; 34:17–29.

54.

Weis

, Miller

, Byrne

, Chouicha

, et al. Prevalence and pathogenic potential of Campylobacter isolates from free-living, human-commensal American crows. Appl Environ Microbiol, 2014; 80:1639–1644.

55.

Wieczorek

, Denis

, Osek

. Comparative analysis of antimicrobial resistance and genetic diversity of Campylobacter from broilers shlaughtered in Poland. Int J Food Microbiol, 2015; 210:24–32.

56.

Woźniak

. Fluoroquinolones resistance of Campylobacter jejuni and Campylobacter coli isolated from poultry in 1994–1996 and 2005–2008 in Poland. Bull Vet Inst Pulawy, 2011; 55:15–20.

57.

Zhang

, Luo

, Chen

, Li

, et al. Molecular epidemiology, virulence determinants and antimicrobial resistance of Campylobacter spreading in retail chicken meat in Central China. Gut Pathog, 2016; 8:48–56.