Molecular Survey on Rickettsia spp.,Anaplasma phagocytophilum,Borrelia burgdorferi Sensu Lato,and Babesia spp. in Ixodes ricinus Ticks Infesting Dogs in Central Italy

Abstract

Dogs are a common feeding hosts for Ixodes ricinus and may act as reservoir hosts for zoonotic tick-borne pathogens (TBPs) and as carriers of infected ticks into human settings. The aim of this work was to evaluate the presence of several selected TBPs of significant public health concern by molecular methods in I. ricinus recovered from dogs living in urban and suburban settings in central Italy. A total of 212 I. ricinus specimens were collected from the coat of domestic dogs. DNA was extracted from each specimen individually and tested for Rickettsia spp., Borrelia burgdorferi sensu lato, Babesia spp., and Anaplasma phagocytophilum, using real-time and conventional PCR protocols, followed by sequencing. Sixty-one ticks (28.8%) tested positive for TBPs; 57 samples were infected by one pathogen, while four showed coinfections. Rickettsia spp. was detected in 39 specimens (18.4%), of which 32 were identified as Rickettsia monacensis and seven as Rickettsia helvetica. Twenty-two samples (10.4%) tested positive for A. phagocytophilum; Borrelia lusitaniae and Borrelia afzelii were detected in two specimens and one specimen, respectively. One tick (0.5%) was found to be positive for Babesia venatorum (EU1). Our findings reveal the significant exposure of dogs to TBPs of public health concern and provide data on the role of dogs in the circulation of I. ricinus-borne pathogens in central Italy.

Introduction

As in other parts of Europe, tick-borne pathogens (TBPs) have shown a tendency to increase over the last decade in Italy due to, among other factors, the increased number of competent vector ticks and the existence of potentially suitable habitats for tick proliferation also in urban settings (e.g., urban forests and private gardens) (Brites-Neto et al. 2015).

Ixodes ricinus (Acarina: Ixodidae) is the most widespread hard tick species in Italy. It has the potential to transmit several viral, bacterial, and protozoan agents of medical and veterinary significance (Otranto et al. 2014, Rizzoli et al. 2014). Climate change, land cover and land use modifications, changes in abundance and distribution of wildlife associated with a high ecological plasticity, and ability to feed on many animal species, including humans, have gradually favored the shifts in the I. ricinus–host associations from large wild mammals (i.e., wild ungulates) to other suitable hosts present in abundance in urban and suburban settings, such as domestic animals (e.g., dogs and cats) or synanthropic species (e.g., hedgehogs, foxes, and hares) (Rizzoli et al. 2014). This is likely to have affected the distribution and prevalence of several I. ricinus-borne pathogens.

Dogs can act as carriers of infected ticks from natural to human settings (Trotta et al. 2012, Otranto et al. 2015). Assessing the prevalence of zoonotic agents in ticks collected from pets is a noninvasive method to evaluate the risk of exposure for humans. Only limited information on the pathogens detectable from I. ricinus specimens feeding on dogs is available in Italy (Pennisi et al. 2012, Trotta et al. 2012). We thus investigated the presence of TBPs of public health concern (e.g., Rickettsia spp., Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato (s.l.), and Babesia spp.) in tick specimens collected from dogs living in urban and suburban settings in a TBP-endemic area of central Italy (Ebani et al. 2014).

Materials and Methods

During a 2-year period, from 2012 to 2014, a total of 605 tick specimens were collected from 344 privately owned dogs living in urban and suburban settings in Umbria (central Italy) and presented to the Veterinary Teaching Hospital of Perugia and local private clinics. Oral consensus was obtained from the dog owners. Ticks were identified in terms of species, life stage, and sex (Manilla 1998) and kept in 70% ethanol for further analyses.

Genomic DNA was extracted individually from each I. ricinus specimen using the QIAmp^® blood and tissue extraction kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. The samples were then tested for the presence of Rickettsia spp., A. phagocytophilum, B. burgdorferi s.l., and Babesia spp. DNA using specific PCR protocols. To assess the presence of A. phagocytophilum and B. burgdorferi s.l. DNA, real-time PCR protocols targeting a 77 bp region of the msp2 gene and a 75 bp fragment of the 23S rRNA genome region were used, respectively. DNA extracted and testing positive at the real-time PCRs were also investigated with a nested PCR targeting the 16S rRNA gene to identify variants of A. phagocytophilum, together with a conventional PCR targeting a conserved region of the fla gene to identify B. burgdorferi s.l. genospecies. For the detection of Babesia spp. and Rickettsia spp. DNA, conventional PCRs targeting a fragment of the 18S rRNA gene and part of the citrate synthase-encoding gene (gltA) were implemented, respectively. Sterile water was used as the negative control, and DNA samples previously confirmed as positive for A. phagocytophilum, Borrelia lusitaniae, Rickettsia conorii, and Babesia canis were used as positive controls and included in each run. Oligonucleotides, amplicon sizes, and references are listed in Table 1.

Table 1.

Target Genes, Primers, Amplicon Sizes (bp), and References of PCR Assays Used for the Detection of Tick-Borne Pathogens in Fed Ixodes ricinus Specimens Collected from Dogs in Central Italy

Target organism	Target gene	Oligonucleotide sequences (5′–3′)	Amplicon size (bp)	Reference
Rickettsia spp.	GltA	f: GGGGACCTGCTCACGGCGG	1234	Roux et al. (1997)
Rickettsia spp.	GltA	r: ATTGCAAAAAGTACAGTGAACA	1234	Roux et al. (1997)
Anaplasma phagocytophilum	Msp2	f: ATGGAAGGTAGTGTTGGTTATGGTATT	77	Silaghi et al. (2008)
		r: TTGGTCTTGAAGCGCTCGTA
		p:TGGTGCCAGGGTTGAGCTTGAGATTG
	16S rRNA	f: CACARGCAAGTCGAACGGATTATTC	548	Massung et al. (1998)
		r: TTCCGTTAAGAAGGATCTAATCTCC
		f: AACGGATTATTCTTTATAGCTTGCT
		r:GGCAGTATTAAAAGCAGCTCCAGG
Borrelia burgdorferi sensu lato	23S rRNA	f: CGAGTCTTAAAAGGGCGATTTAGT	75	Courtney et al. (2004)
		r: GCTTCAGCCTGGCCATAAATAG
		p: FAM-AGATGTGGTAGACCCGAAGCCGAGTG-BHQ1
	Fla	f: AGAGCAACTTACAGACGAAATTAAT	482	Skotarczak et al. (2002)
	Fla	r: CAAGTCTATTTTGGAAAGCACCTAA	482	Skotarczak et al. (2002)
Babesia spp.	18S rRNA	f: GTTTCTGMCCCATCAGCTTGAC	422–440	Hilpertshauser et al. (2006)
Babesia spp.	18S rRNA	r: CAAGACAAAAGTCTGCTTGAAAC	422–440	Hilpertshauser et al. (2006)

f, forward primer; p, probe; r, reverse primer.

The amplicons obtained were visualized under UV light with GelRed™ (Biotium, Inc., Fremont, CA) after electrophoresis in 2% agarose gels. Bands were excised and extracted using the QIAquick^® gel extraction kit (Qiagen GmbH), according to the manufacturer's recommendations. They were then bidirectionally sequenced using the Big-Dye terminator cycle sequencing kit 1.1 (Applied Biosystems, Foster City, CA), assembled, and edited with Bioedit (biological sequence alignment editor) 7.2.5 (Ibis Biosciences, Carlsbad, CA). The sequences obtained were compared with representative sequences available in the GenBank using BLAST (www.ncbi.nlm.nih.gov/BLAST) (Altschul et al. 1990).

The differences in prevalence of the investigated TBPs according to tick stages were tested using the chi-square test or Fisher's exact test when appropriate (Sergeant, ESG, 2016. Epitools epidemiological calculators. Ausvet Pty. Ltd. Available at: http://epitools.ausvet.com.au).

Results

Of the 605 ticks collected, a total of 212 (148 females, 50 males, and 14 nymphs) were morphologically identified as I. ricinus. Of these, females and nymphs presented different stages of engorgement. The other specimens were identified as Rhipicephalus sanguineus and were stored for future analyses.

Sixty-one of 212 I. ricinus specimens (28.8%) overall tested positive for TBPs (Table 2). Rickettsia spp. were the most frequently identified pathogens (n = 39; 18.4%). Of these, 32 (15.1%) were positive for Rickettsia monacensis and 7 (3.3%) for Rickettsia helvetica. Alignment of the partial gltA gene sequences showed that 29 R. monacensis sequences were identical with sequences isolated from I. ricinus specimens in Italy and Romania (GenBank acc. nos. KJ663744, JX003686). Three R. monacensis isolates (GenBank acc. nos. KY231201, KY213882, KY213883) were found to be a different strain and were 100% identical with sequences obtained from I. ricinus in Slovakia (GenBank acc. no. KC996728).

Table 2.

Prevalence of Tick-Borne Pathogens Identified in Fed Ixodes ricinus (n = 212) Collected from Dogs in Central Italy

Tick-borne pathogen	Total isolates (N)	Total prevalence (95% CI)
Rickettsia monacensis	32	15.1% (10.28–19.91)
Rickettsia helvetica	7	3.3% (0.9–5.71)
Borrelia afzelii	1	0.5% (0–1.39)
Borrelia lusitaniae	2	0.9% (0–2.24)
Anaplasma phagocytophilum	22	10.4% (8.71–14.32)
Babesia venatorum	1	0.5% (0–1.39)

CI, confidence interval.

Seven R. helvetica isolates had identical sequences with Italian isolates obtained from I. ricinus (GenBank acc. nos. KM198331, KJ663745).

The other TBPs detected were A. phagocytophilum (n = 22; 10.4%), B. burgdorferi s.l. (n = 3; 1.4%), and Babesia venatorum (formerly Babesia spp. EU1) (n = 1; 0.5%).

Analysis of the partial 16S rRNA gene of A. phagocytophilum revealed seven sequences that were 100% identical to GenBank sequences obtained from farm animals from the Czech Republic (acc. no. HM138366) and dogs from Germany (acc. no. FJ829748). Analysis of the conserved region of the fla gene revealed two sequences of B. lusitaniae (0.94%) and one sequence of Borrelia afzelii (0.5%). Both B. lusitaniae and B. afzelii sequences presented a 100% identity with Italian and Polish strains isolated from ticks (GenBank acc. nos. GU581278, DQ016623, KM198345, KR782215). The B. venatorum sequence presented was 100% identical with sequences from ticks collected in northeast Italy (GenBank acc. nos. JQ669954 and GU647159), Spain (GenBank acc. no. KM289158.1), and the Czech Republic (GenBank acc. no. KM095110). The sequences obtained were deposited in the GenBank under the accession numbers KY203361-89, KY213882-87, KY231194-201, and KY404192-98.

Fifty-seven specimens were infected with one pathogen, while four showed coinfections: two ticks had a double infection with A. phagocytophilum and R. monacensis, one specimen was double infected with B. lusitaniae and R. monacensis, and another tick was positive both for B. lusitaniae and R. helvetica.

The prevalences of TBPs in nymph (21.4%), male (22%), and female (31.8%) ticks were similar (p [χ ²] = 0.41) (Table 3). However, no statistical differences between TBPs and the different tick stages were evidenced and neither were the tests between individual pathogens and the life stage of the ticks.

Table 3.

Stages of Ixodes ricinus, Collected from Dogs in Central Italy, Infected with Tick-Borne Pathogens

	No. of tick stages infected
Tick-borne pathogen	Nymphs (n = 14)	Males (n = 50)	Females (n = 148)	Total no. of I. ricinus positive specimens
R. monacensis	0	8	21	29
R. Helvetica	0	2	4	6
B. afzelii	1	0	0	1
B. lusitaniae+ R. monacensis	0	0	1	1
B. lusitaniae+ R. helvetica	0	0	1	1
A. phagocytophilum	2	1	17	22
A. phagocytophilum+R. monacensis	0	0	2	2
B. venatorum	0	0	1	1
Total n (%)	3 (21.4)	11 (22)	47 (31.8)	61

Discussion

The present findings provide evidence that dogs may substantially contribute to the circulation of I. ricinus infected by some TBPs of public health concern in the investigated area; in fact, all the pathogens detected in the present work are known to cause diseases in humans and are emerging across Europe and other parts of the world (Rizzoli et al. 2014).

Interestingly, the most frequently identified pathogens in I. ricinus infesting dogs were R. monacensis (n = 32, 15.1%) and R. helvetica (n = 7, 3.3%), emerging members of the spotted fever group (SFG), which is responsible for an increasing number of the Mediterranean spotted fever-like illnesses occurring in humans in several European countries, including Italy (Jado et al. 2007, Madeddu et al. 2012, Parola et al. 2013). Until 2002, the only SFG-Rickettsia species reported in Italy was R. conorii. Since then, an increasing number of further species, including R. helvetica and R. monacensis, have been detected by DNA-based analysis in host-seeking ticks as well as in I. ricinus feeding on different hosts (i.e., wild ungulates, foxes, and dogs) with prevalence rates ranging from 8.8% to 34.6% (Beninati et al. 2002, Bertolotti et al. 2006, Capelli et al. 2012, Maioli et al. 2012, Castro et al. 2015, Scarpulla et al. 2016).

R. conorii and R. rickettsii, the causing agents of the Mediterranean spotted fever and the Rocky Mountain spotted fever, respectively, have been shown to cause clinical illness in dogs (Solano-Gallego et al. 2015, Levin et al. 2014). Whether dogs develop clinical symptoms due to other Rickettsia species such as R. monacensis and R. helvetica is still not clear (Boretti et al. 2009, Wächter et al. 2015a). However, fever of an unknown origin that is responsive to antibiotic doxycycline treatment is frequently observed in dogs. Several epidemiological surveys have reported high seroprevalence rates for SFG-Rickettsia species in canine populations in Europe (Solano-Gallego et al. 2006, Trotta et al. 2009, Wächter et al. 2015a, b). Interestingly, R. monacensis was recently recovered by molecular tools from the blood of asymptomatic dogs originating from Cape Verde (Lauzi et al. 2016).

Anaplasma phagocytophilum, the causative agent of human granulocytic anaplasmosis, is an important medical and veterinary health problem worldwide (Rizzoli et al. 2014). In the current study, the overall prevalence of A. phagocytophilum in ticks was 10.4%, in line with epidemiological studies performed in Italy that showed A. phagocytophilum DNA in feeding ticks with prevalence rates ranging from 0.8% to 31.2% (Carpi et al. 2009, Veronesi et al. 2011, Otranto et al. 2014, Ebani et al. 2015, Di Domenico et al. 2016). Dogs act as accidental and sentinel hosts due to the lack of high and persistent bacteremia (Sainz et al. 2015). However, clinical and clinicopathological manifestations have been documented worldwide in canine species also in northern Italy (Dondi et al. 2014).

The sequencing of seven partial 16S rRNA gene sequences from ticks revealed the presence of one genetic variant that was (unofficially) called variant A in previous studies (Silaghi et al. 2011a, b, c, d). This variant A has previously been detected in ticks, hedgehogs, dogs, horses, cats, and in one human patient (Von Loewenich et al. 2003, Silaghi et al. 2008, 2011c, d, Scharf et al. 2011, Silaghi et al. 2012). In a previous comparison of genetic variants of A. phagocytophilum infecting dogs with canine granulocytic anaplasmosis, this variant was suggested to be scant pathogenic (Silaghi et al. 2011c).

Borrelia lusitaniae and B. afzelii have already been detected using the same genetic target in central and northern Italy in host-seeking I. ricinus with prevalence rates ranging from 3.8% to 17.6% (Capelli et al. 2012, Aureli et al. 2015, Castro et al. 2015, Ragagli et al. 2016). Our findings revealed a lower infection rate (1.4%) than in previous studies, but still confirmed the circulation of the Borrelia s.l. genospecies in the urban areas investigated. Several B. burgdorferi s.l. species can cause various clinical manifestations both in humans (i.e., B. afzelii is commonly associated with clinical skin manifestation and B. lusitaniae has been recognized as the agent of vasculitis-like syndrome) (Rauter and Hartung 2005, de Carvalho et al. 2008) and in animals [i.e., recently, a severe polysynovitis was described in a horse infected by B. afzelii (Passamonti et al. 2015)]. However, their clinical role for canine species has not been substantiated.

B. venatorum has been identified in splenectomized human patients living in Italy and in Austria (Herwaldt et al. 2003) as well as in two roe deer in northern Italy (Zanet et al. 2014) and in questing ticks collected in northern Italy (Cassini et al. 2010, Capelli et al. 2012, Aureli et al. 2015, Castro et al. 2015). The detection of B. venatorum in one of the I. ricinus analyzed confirms the presence of this small piroplasm with zoonotic implications also in tick populations of central Italy.

In conclusion, our results highlight (1) the presence of several pathogens at the dog–I. ricinus interface with the potential to cause both canine and human diseases; (2) the need to use prophylactic and control measures for ticks in dogs to minimize human and veterinary health risks; and (3) the need for future research on the pathogenic effects of TBPs, for instance, R. monacensis, R. helvetica, B. lusitaniae, B. afzelii, and B. venatorum, in the canine species.

Footnotes

Acknowledgment

The authors would like to thank Dr. Alexander Mathis for comments on the manuscript.

Author Disclosure Statement

No competing financial interests exist.

References

Altschul

, Gish

, Miller

, Myers

, et al. Basic local alignment search tool. J Mol Biol, 1990; 215:403–410.

Aureli

, Galuppi

, Ostanello

, Foley

, et al. Abundance of questing ticks and molecular evidence for pathogens in ticks in three parks of Emilia-Romagna region of Northern Italy. Ann Agric Environ Med, 2015; 22:459–466.

Beninati

, Lo

, Noda

, Esposito

, et al. First detection of spotted fever group Rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis, 2002; 8:983–986.

Bertolotti

, Tomassone

, Tramuta

, Grego

, et al. Borrelia lusitaniae and spotted fever group rickettsiae in Ixodes ricinus (Acarina: Ixodidae) in Tuscany, central Italy. J Med Entomol, 2006; 43:159–165.

Boretti

, Perreten

, Meli

, Cattori

, et al. Molecular investigations of Rickettsia helvetica infection in dogs, foxes, humans, and Ixodes ticks. Appl Environ Microbiol, 2009; 75:3230–3237.

Brites-Neto

, Duarte

KMR

, Martins

. Tick-borne infections in human and animal population worldwide. Vet World, 2015; 8:301–315.

Capelli

, Ravagnan

, Montarsi

, Ciocchetta

, et al. Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: A cost-effectiveness analysis in north-eastern Italy. Parasit Vectors, 2012; 5:61.

Carpi

, Bertolotti

, Pecchioli

, Cagnacci

, et al. Anaplasma phagocytophilum groEL gene heterogeneity in Ixodes ricinus larvae feeding on roe deer in Northeastern Italy. Vector Borne Zoonotic Dis, 2009; 9:179–184.

Cassini

, Bonoli

, Montarsi

, Tessarin

, et al. Detection of Babesia EU1 in Ixodes ricinus ticks in northern Italy. Vet Parasitol, 2010; 171:151–154.

10.

Castro

, Gabrielli

, Iori

, Cancrini

. Molecular detection of Rickettsia, Borrelia and Babesia species in Ixodes ricinus samples in northeastern, central and insular areas of Italy. Exp Appl Acarol, 2015; 66:443–452.

11.

Courtney

, Kostelnik

, Zeidner

, Massung

. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi . J Clin Microbiol, 2004; 42:3164–3168.

12.

de Carvalho

, Fonseca

, Marques

, Ullmann

, et al. Vasculitis-like syndrome associated with Borrelia lusitaniae infection. Clin Rheumatol, 2008; 27:1587.

13.

Di Domenico

, Pascucci

, Curini

, Cocco

, et al. Detection of Anaplasma phagocytophilum genotypes that are potentially virulent for human in wild ruminants and Ixodes ricinus in Central Italy. Ticks Tick Borne Dis, 2016; 7:782–787.

14.

Dondi

, Russo

, Agnoli

, Mengoli

, et al. Clinicopathological and molecular findings in a case of canine Anaplasma phagocytophilum infection in Northern Italy. ScientificWorldJournal, 2014. DOI:10.1155/2014/810587

15.

Ebani

, Bertelloni

, Torracca

, Cerri

. Serological survey of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, and Ehrlichia canis infections in rural and urban dogs in Central Italy. Ann Agric Environ Med, 2014; 21:671–675.

16.

Ebani

, Bertelloni

, Turchi

, Filogari

, et al. Molecular survey of tick-borne pathogens in Ixodid ticks collected from hunted wild animals in Tuscany, Italy. Asian Pac J Trop Med, 2015; 8:714–717.

17.

Herwaldt

, Cacció

, Gherlinzoni

, Aspock

, et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis, 2003; 9:942–948.

18.

Hilpertshauser

, Deplazes

, Schnyder

, Gern

, et al. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl Environment Microbiol, 2006; 72:6503–6507.

19.

Jado

, Oteo

, Aldamiz

, Gil

, et al. Rickettsia monacensis and human disease, Spain. Emerg Infect Dis, 2007; 13:1405–1407.

20.

Lauzi

, Maia

, Epis

, Marcos

, et al. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick Borne Dis, 2016; 7:964–969.

21.

Levin

, Killmaster

, Zemtsova

, Ritter

, et al. Clinical presentation, convalescence, and relapse of rocky mountain spotted fever in dogs experimentally infected via tick bite. PLoS One, 2014; 9: e115105.

22.

Madeddu

, Mancini

, Caddeo

, Ciervo

, et al. Rickettsia monacensis as cause of Mediterranean spotted fever-like illness, Italy. Emerg Infect Dis, 2012; 18:702–704.

23.

Maioli

, Pistone

, Bonilauri

, Pajoro

, et al. Etiological agents of rickettsiosis and anaplasmosis in ticks collected in Emilia-Romagna region (Italy) during 2008 and 2009. Exp Appl Acarol, 2012; 57:199–208.

24.

Manilla

. Fauna d'Italia, Acari Ixodida. Bologna: Edizioni Calderini, 1998.

25.

Massung

, Slater

, Owens

, Nicholson

, et al. Nested PCR assay for detection of granulocytic Ehrlichiae. J Clin Microbiol, 1998; 36:1090–1095.

26.

Otranto

, Cantacessi

, Pfeffer

, Dantas-Torres

, et al. The role of wild canids and felids in spreading parasites to dogs and cats in Europe. Part I: Protozoa and tick-borne agents. Vet Parasitol, 2015; 213:12–23.

27.

Otranto

, Dantas-Torres

, Giannelli

, Latrofa

, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors, 2014; 14:328.

28.

Parola

, Paddock

, Socolovschi

, Labruna

, et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin Microbiol Rev, 2013; 26:657–702.

29.

Passamonti

, Veronesi

, Cappelli

, Capomaccio

, et al. Polysynovitis in a horse due to Borrelia burgdorferi sensu lato infection, Case study. Ann Agric Environ Med, 2015; 22:247–250.

30.

Pennisi

, Caprì

, Solano-Gallego

, Lombardo

, et al. Prevalence of antibodies against Rickettsia conorii, Babesia canis, Ehrlichia canis, and Anaplasma phagocytophilum antigens in dogs from the Stretto di Messina area (Italy). Ticks Tick Borne Dis, 2012; 3:315–318.

31.

Ragagli

, Mannelli

, Ambrogi

, Bisanzio

, et al. Presence of host-seeking Ixodes ricinus and their infection with Borrelia burgdorferi sensu lato in the Northern Apennines, Italy. Exp Appl Acarol, 2016; 69:167–178.

32.

Rauter

, Hartung

. Prevalence of Borrelia burdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: A metaanalysis. Appl Environ Microbiol, 2005; 71:7203–7216.

33.

Rizzoli

, Silaghi

, Obiegala

, Rudolf

, et al. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: New hazards and relevance for public health. Front Public Health, 2014; 2:251.

34.

Roux

, Rydkina

, Eremeeva

, Raoult

. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the Rickettsiae?. Int J Syst Bacteriol, 1997; 47:252–261.

35.

Sainz

, Roura

, Mirò

, Estrada-Pena

, et al. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasite Vectors, 2015; 8:75.

36.

Scarpulla

, Barlozzari

, Marcario

, Salvato

, et al. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy. Ticks Tick Borne Dis, 2016; 7:1052–1056.

37.

Scharf

, Schauer

, Freyburger

, Petrovec

, et al. Distinct host species correlate with Anaplasma phagocytophilum ankA gene clusters. J Clin Microbiol, 2011; 49:790–796.

38.

Silaghi

, Gilles

, Höhle

, Fingerle

, et al. Anaplasma phagocytophilum infection in Ixodes ricinus, Bavaria, Germany. Emerg Infect Dis, 2008; 14:972–974.

39.

Silaghi

, Hamel

, Thiel

, Pfister

, et al. Genetic variants of Anaplasma phagocytophilum in wild caprine and cervid ungulates from the Alps in Tyrol, Austria. Vector Borne Zoonotic Dis, 2011a;11:355–362.

40.

Silaghi

, Kauffmann

, Passos

LMF

, Pfister

, et al. Isolation, propagation and preliminary characterisation of Anaplasma phagocytophilum from roe deer (Capreolus capreolus) in the tick cell line IDE8. Ticks Tick Borne Dis, 2011b;2:204–208.

41.

Silaghi

, Kohn

, Chirek

, Thiel

, et al. Investigations on the relationship of molecular and clinical findings of Anaplasma phagocytophilum involved in natural infections of dogs. J Clin Microbiol, 2011c;49:4413–4414.

42.

Silaghi

, Liebisch

, Pfister

. Genetic variants of Anaplasma phagocytophilum from 14 equine granulocytic anaplasmosis cases. Parasit Vectors, 2011d;4:161.

43.

Silaghi

, Skuballa

, Thiel

, Pfister

, et al. The European hedgehog (Erinaceus europaeus)—A suitable reservoir for variants of Anaplasma phagocytophilum?. Ticks Tick Borne Dis, 2012; 3:49–54.

44.

Skotarczak

, Wodecka

, Cichoka

. Coexistence DNA of Borrelia burgdorferi sensu lato and Babesia microti in Ixodes ricinus ticks from northwestern Poland. Ann Agric Environ Med, 2002; 9:25–28.

45.

Solano-Gallego

, Llull

, Osso

, Hegarty

, et al. A serological study of exposure to arthropod-borne pathogens in dogs from northeastern Spain. Vet Res, 2006; 37:231–244.

46.

Solano-Gallego

, Caprì

, Pennisi

, Caldin

, et al. Acute febrile illness is associated with Rickettsia spp infection in dogs. Parasit Vectors, 2015; 8:216.

47.

Trotta

, Fogliazza

, Furlanello

, Solano-Gallego

. A molecular and serological study of exposure to tick-borne pathogens in sick dogs from Italy. Clin Microbiol Infect, 2009; 15:62–63.

48.

Trotta

, Nicetto

, Fogliazza

, Montarsi

, et al. Detection of Leishmania infantum, Babesia canis, and Rickettsiae in ticks removed from dogs living in Italy. Ticks Tick Borne Dis, 2012; 3:294–297.

49.

Veronesi

, Galuppi

, Tampieri

, Bonoli

, et al. Prevalence of Anaplasma phagocytophilum in fallow deer (Dama dama) and feeding ticks from an Italy preserve. Res Vet Sci, 2011; 90:40–43.

50.

Von Loewenich

, Baumgarten

, Schröppel

, Geissdörfer

, et al. High diversity of ankA sequences of Anaplasma phagocytophilum among Ixodes ricinus ticks in Germany. J Clin Microbiol, 2003; 41:5033–5040.

51.

Wächter

, Pfeffer

, Schulz

, Balling

, et al. Seroprevalence of spotted fever group Rickettsiae in dogs in Germany. Vector Borne Zoonotic Dis, 2015b;15:191–194.

52.

Wächter

, Wölfel

, Pfeffer

, Dobler

, et al. Serological differentiation of antibodies against Rickettsia helvetica, R. raoultii, R. slovaca, R. monacensis and R. felis in dogs from Germany by a micro-immunofluorescent antibody test. Parasit Vectors, 2015a;8:126.

53.

Zanet

, Trisciuoglio

, Bottero

, Fernández de Mera

, et al. Piroplasmosis in wildlife: Babesia and Theileria affecting free-ranging ungulates and carnivores in the Italian Alps. Parasit Vectors, 2014; 7:70.