Molecular Evidence of Rickettsia spp.,Anaplasma phagocytophilum,and “ Candidatus Neoehrlichia mikurensis” in Ticks from Natural and Urban Habitats in Eastern Romania

Abstract

Ixodid ticks are competent vectors for multiple pathogens, several of which cause infections in human. The medical importance of tick-borne pathogens is well known, yet unanswered questions remain regarding the occurrence of pathogens such as Rickettsia spp., Anaplasma phagocytophilum, and “Candidatus Neoehrlichia mikurensis” in questing ticks in Romania. Our objectives were to identify three emerging tick-borne zoonotic pathogens in eastern Romania, to assess their prevalence, establish co-infection rates, and to compare infection levels of selected pathogens in questing ticks collected from one suburban area in the city of Iaşi and one forested area located in the Danube Delta Biosphere Reserve. We collected 490 questing nymphs or adult ticks (467 Ixodes ricinus, 4 Dermacentor reticulatus, and 19 Haemaphysalis punctata). We individually analyzed ticks for the presence of Rickettsia spp., A. phagocytophilum, and “C. N. mikurensis.” Rickettsia spp. was detected in 9.4% of ticks from both sampling areas. Rickettsia spp. included R. helvetica (n = 17 I. ricinus ticks), R. monacensis (n = 28 I. ricinus ticks), and R. raoultii (n = 1 D. reticulatus). “C. N. mikurensis” had an infection rate of 4.9% while A. phagocytophilum was detected only in the forested area with a global prevalence of 1.2%. The overall prevalence of ticks infected with at least one pathogen was 15.5%, and 5.3% of infected ticks were tested positives for dual pathogen association. Our study documents the presence of pathogens in questing ticks in the urban recreational areas of Iaşi and forested areas located in the Danube Delta Biosphere Reserve. Worth mentioning, is the presence of “C. N. mikurensis” in ticks from eastern Romania, an agent just recently described in Romania, and the existence of co-infections in ticks at a similar prevalence to other European countries.

Introduction

Ixodid ticks are the most important vectors involved in the transmission of pathogens causing both human and animal disease (de la Fuente et al. 2008). Ixodes ricinus is the most prevalent tick species in forest habitats from Romania (86.9%), followed by Dermacentor marginatus (9.5%), Haemaphysalis punctata (2.6%), and Dermacentor reticulatus (0.02%) (Mihalca et al. 2012). I. ricinus transmits a wide variety of tick-borne pathogens such as bacteria, viruses, and parasites. Borrelia spp. and tick-borne encephalitis virus cause the most severe tick-borne diseases in Europe, but many other pathogens can also significantly impact the health of both humans and animals (Egyed et al. 2012).

Several different Rickettsia from the spotted fever group (SFG) can cause Rickettsiosis. We previously reported SFG Rickettsia in questing I. ricinus ticks in Romania (Raileanu et al. 2017), and several other studies have identified many Rickettsia spp. of medical and veterinary importance in feeding ticks and hosts from Romania: R. conorii, R. monacensis, R. helvetica, R. slovaca, R. massiliae, and R. raoultii (Paduraru et al. 2012, Ionita et al. 2013, 2016, Marcutan et al. 2016, Matei et al. 2016, Zaharia et al. 2016).

Human or animal anaplasmosis caused by the intracellular bacteria Anaplasma phagocytophilum, is a severe tick-borne infection in Europe, but the incidence of this disease is unclear (Lommano et al. 2012). In Romania, A. phagocytophilum prevalence in questing ticks has been assessed in two studies. One nationwide study reported an overall prevalence of 3.4% (Matei et al. 2015), and a recent study recorded a similar A. phagocytophilum prevalence in ticks collected from northern and central Romania (Kalmar et al. 2016).

Additional microorganisms such as “Candidatus Neoehrlichia mikurensis” have recently been identified as tick-borne pathogens, and sporadic human disease cases have been described throughout Europe (von Loewenich et al. 2010, Jahfari et al. 2012). “C. N. mikurensis” was initially detected in an I. ricinus nymph collected from a Romanian patient (Andersson et al. 2014) and in questing ticks from central and northern Romania with a 5.3% infection rate (Kalmar et al. 2016). Currently, no information is available on the occurrence of human “C. N. mikurensis” clinical cases in Romania.

Co-infection with multiple tick-borne pathogens is particularly frequent due to I. ricinus' ability to feed on different host species acting as multiple pathogen reservoirs (Reis et al. 2011). In European countries, tick co-infection prevalence ranges from 3.2% to 45% (Reye et al. 2010, Reis et al. 2011, Lommano et al. 2012, Moutailler et al. 2016).

Many studies from Romania have focused on the identification of single or limited numbers of pathogens in I. ricinus ticks. Therefore, there are still gaps left to fill regarding the presence of pathogens such as Rickettsia spp., A. phagocytophilum, and “C. N. mikurensis” in ticks from Romania, more particularly in other tick species that bite humans such as D. marginatus and H. punctata. In addition, few studies reported infection rates of pathogens in questing ticks from eastern Romania (Kalmar et al. 2013, Matei et al. 2015, Raileanu et al. 2017). The aim of our study was to (1) identify Rickettsia spp., A. phagocytophilum, and “C. N. mikurensis” in questing ticks; (2) perform a comparison of infection rates for the selected pathogens in ticks from two distinct habitats in eastern Romania; (3) determine co-infection rates; (4) highlight the risk of exposure to ticks in recreational areas near the city of Iaşi.

Materials and Methods

Tick sampling

We collected ixodid ticks from 13 sampling sites distributed across 2 geographically distinct areas of eastern Romania (Fig. 1). Questing ticks were collected by dragging (Egyed et al. 2012) from May until September 2014.

FIG. 1.

Sampling areas in eastern Romania. Geographical areas were located in eastern Romania, comprising two counties across two distinct zones. (1) Iaşi area—representing collection sites located in Iaşi recreational areas (Breazu, C.A. Rosseti, Ciric, Cetăţuia, Bârnova, Bucium). (2) Tulcea area—distributed in Tulcea county.

Tick species and developmental stages were identified using a stereomicroscope and standard morphological identification keys (Perez-Eid 2007). DNA was extracted from each individual tick as previously described (Raileanu et al. 2017). Iaşi area included six collection sites in Iaşi recreational areas (Bârnova [47.059598 N, 27.640815 E], Breazu [47.212044 N, 27.530304 E], Bucium [47.068330 N, 27.664561 E], C.A. Rosetti [47.204710 N, 27.556685 E], Cetăţuia [47.132564 N, 27.582936 E], and Ciric [47.178178 N, 27.609791 E]). At these sites, deciduous trees and meadows are predominant (designated suburban forest) (Pavel et al. 2014). Tulcea area comprised seven collection sites from Tulcea county (Macin: 45.26293 N, 28.16968 E; Isaccea: 45.269722 N, 28.459722 E; Babadag: 44.873796 N, 28.735763 E; 44.891311 N, 28.717223 E; 44.86309 N, 28.689242 E; Niculitel: 45.215936 N, 28.415648 E; and Enisala: 44.865767 N, 28.810092 E) that are located in mostly forested and arid zones. This area has an arid climate with sections of coastline (Moise and Dumitru 2012).

PCR for Rickettsia spp.

Samples were screened for the presence of Rickettsia spp. via PCR. Detection was carried out using specific primers (Table 1) targeting the gltA gene of Rickettsia spp. (Regnery et al. 1991). Amplification of PCR products was done by using Thermo Scientific Phusion High-Fidelity PCR Kit (Thermo Scientific). The reaction volume for each reaction was 20 μL, consisting of 4 μL 5× PCR buffer, 200 μM of each dNTP, 0.5 μM of each primer, 5 μL tick DNA, and 0.4 U phusion DNA polymerase. Thermal conditions were as follows: 98°C for 30 s, followed by 35 cycles at 98°C for 10 s, 56°C for 30 s, and 72°C for 30 s, with a final elongation at 72°C for 10 min. Each run contained a negative control (water) and positive control (Rickettsia conorii DNA extracted from culture). PCR products were visualized by electrophoresis on 2% agarose gel stained with ethidium bromide in 1× TBE buffer. The 381 bp Rickettsia-specific fragment was purified and sequenced in both directions by Eurofins MWG Operon (Ebersberg, Germany), using specific primers for gltA gene (Table 1). Sequences were assembled using BioEdit software (Hall 1999), then compared to the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/) using BLASTn algorithm.

Table 1.

Primer Sets for Pathogen DNA Amplification and Sequencing in Ticks

Pathogen	Target gene	Primers	Nucleotide sequence (5′-3′)	Amplicon size (bp)	Reference
Rickettsia spp.	gltA	Rsfg877	GGGGGCCTGCTCACGGCGG	381	Regnery et al. (1991)
Rickettsia spp.	gltA	Rsfg1258	ATTGCAAAAAGTACAGTGAACA	381	Regnery et al. (1991)
Anaplasma phagocytophilum	msp2	An_ph_msp2_F An_ph_msp2_R An_ph_msp2_P	GCTATGGAAGGCAGTGTTGG	77	Michelet et al. (2014)
			GTCTTGAAGCGCTCGTAACC
			AATCTCAAGCTCAACCCTGGCACCAC
“Candidatus Neoehrlichia mikurensis”	groEL	Neo_mik_groEL_F Neo_mik_groEL_R Neo_mik_groEL_P	AGAGACATCATTCGCATTTTGGA	96	Michelet et al. (2014)
			TTCCGGTGTACCATAAGGCTT
			AGATGCTGTTGGATGTACTGCTGGACC

Real-time PCR for A. phagocytophilum and “C. N. mikurensis”

Real-time PCR assays were performed using primers and probes (Table 1) targeting the msp2 gene for A. phagocytophilum, and the groEL gene for “C. N. mikurensis” (Michelet et al. 2014). Fluorogenic probes were synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached to the 5′ end and a Black Hole Quencher 1 at the 3′ end. Real-time TaqMan PCR was performed in a volume of 12 μL using the LightCycler^® 480 Probe Master mix (Roche Applied Science, Germany) at 1× final concentration. Primers and probes had a concentration of 200 nM, and each reaction included 2 μL of DNA. Thermal conditions were as follows: 95°C for 5 min, 45 cycles at 95°C for 10 s, then 60°C for 15 s, with a final cooling step at 40°C for 10 s. Samples were considered positive at a cycle threshold value of <40 and characteristic amplification curves. Negative (water) and positive controls were used with each run. A. phagocytophilum DNA (extracted from infected embrionary cells of Ixodes scapularis) and “C. N. mikurensis” DNA (extracted from infected ticks) were used as positive controls for the detection of A. phagocytophilum and “C. N. mikurensis”, respectively.

Statistical analysis

Data were analyzed using the IBM SPSS^® Statistics version 21 software (IBM^® Corporation, Chicago, IL) and MS Excel 2016. The 95% confidence interval (CI) were calculated for the prevalence of each pathogen. Prevalence rates between tick developmental stages and geographic groups were compared using independent-sample T-tests. In cases of statistical significance, p-values are given in parentheses. Differences were considered statistically significant when p < 0.05.

Results

Only adult and nymphal ticks were collected, totaling 490 ticks (Iaşi area n = 315; Tulcea area n = 175) from three different species: I. ricinus (n = 467), D. reticulatus (n = 4), and H. punctata (n = 19) (Table 2).

Table 2.

Total Number of Questing Ticks and Identified Pathogens According to Sampling Area

					Tested pathogens
		No. of ticks investigated			Rickettsia spp.			A. phagocytophilum			“C. N. mikurensis”
	Tick species	A	N	Total	A/%	N/%	Total/%	A/%	N/%	Total/%	A/%	N/%	Total/%
Iaşi area	Ixodes ricinus	64	233	297	7/10.9	21/9.0	28/9.4	—	—	—	—	3/1.3	3/1.0
	Haemaphysalis punctata	3	11	14	—	—	—	—	—	—	—	—	—
	Dermacentor reticulatus	4		4	1/25.0	—	1/25.0	—	—	—	—	—	—
	Total	71	244	315	8/11.3	21/8.6	29/9.2	—	—	—	—	3/1.2	3/1.0
Tulcea area	I. ricinus	5	165	170	—	17/10.3	17/10.0	—	6/3.6	6/3.5	—	21/12.7	21/12.4
	H. punctata		5	5	—	—	—	—	—	—	—	—	—
	Total	5	170	175	—	17/10.0	17/9.7	—	6/3.5	6/3.4	—	21/12.4	21/12.0
Total		76	414	490	8/10.5	38/9.2	46/9.4	—	6/1.4	6/1.2	—	24/5.8	24/4.9

The prevalence of each tested pathogen is also expressed as the percentage of ticks with detectable pathogens (PCR-positive).

A, adult; N, nymph; “C. N. mikurensis”, “Candidatus Neoehrlichia mikurensis.”

Tick-borne pathogens detected in I. ricinus

I. ricinus ticks represented 95.3% (467/490) of collected ticks with 69 adult ticks (Iaşi area n = 64; Tulcea area n = 5) and 398 nymphs (Iaşi area n = 233; Tulcea area n = 165). The overall prevalence of infection with one or more of the tested pathogens was 16.1% (75/467; 95% CI: 12.7–19.4). Rickettsia spp. DNA was observed in 45/467 (9.6%; 95% CI: 7.0–12.3) I. ricinus ticks. There were no differences in infection prevalence between adults and nymphs (p = 0.758). Rickettsia spp. DNA was detected in 7/69 adults (10.1%; 95% CI: 3.0–17.3) and in 38/398 nymphs (9.5%; 95% CI: 6.7–12.4). The prevalence encountered in Iaşi area (9.4%; 95% CI: 6.1–12.8) was similar to the one registered in Tulcea area (10.0%; 95% CI: 5.5–14.5) (p = 0.687). Among the Rickettsia-positive I. ricinus samples, 17 gltA sequences demonstrated identity to Rickettsia helvetica, displaying 99–100% identity (GenBank acc. nos. AM418450.1 [n = 1]; JX040636.1 [n = 7]; KJ663745.1 [n = 7]; and KF447530.1 [n = 2]) and 28 gltA sequences shared 100% identity with Rickettsia monacensis (GenBank acc. nos. JX003686.1 [n = 11]; KJ663734.1 [n = 6]; JX040639.1 [n = 3]; JX040640.1 [n = 4]; KJ663735.1 [n = 3]; and KC996728.1 [n = 1]). The overall mean infection rate was 3.6% for R. helvetica (1.4% of the adults and 4.0% of the nymphs) and 6.0% for R. monacensis (10.1% of the adults and 5.3% of the nymphs).

A. phagocytophilum was detected in 6/467 I. ricinus nymphal ticks (1.3%; 95% CI: 0.3–2.3), however, no adult ticks tested positive and no A. phagocytophilum-positive ticks were found in Iaşi area (Table 2). A. phagocytophilum prevalence in I. ricinus ticks collected from Tulcea area was 3.5% (6/170; 95% CI: 0.8–6.3).

“C. N. mikurensis” DNA was found in 24/467 (5.1%; 95% CI: 3.1–7.1) ticks, all of which were I. ricinus nymphs (Table 2). Prevalence was significantly higher in Tulcea area (12.4%; 21/170; 95% CI: 7.4–17.3) compared to Iaşi area (1.0%; 3/297; 95% CI: 0.0–2.1) (p < 0.001).

Co-infections were identified in 4/467 (0.9%; 95% CI: 0.0–1.7) I. ricinus ticks only from Tulcea area, accounting for 5.3% (4/75; 95% CI: 0.2–10.4) of infected ticks. No more than two pathogens were found in nymphal I. ricinus ticks. Co-infected ticks represented 2.4% (4/170; 95% CI: 0.1–4.6) tested ticks from Tulcea area. The Rickettsia spp. pathogen was the most frequently associated with other agents, as observed in all four ticks; two ticks tested positive for R. monacensis and “C. N. mikurensis,” one nymph was infected with R. monacensis and A. phagocytophilum, and the fourth tick had association between R. helvetica and A. phagocytophilum.

Tick-borne pathogens detected in D. reticulatus and H. punctata

D. reticulatus ticks were only found in Iaşi area, and consisted of four adult females (4/490; 0.8%) (Table 2). Molecular testing for the listed tick-borne pathogens revealed one D. reticulatus tick positive for Rickettsia spp. The gltA sequence obtained from the Rickettsia-positive D. reticulatus adult shared 99% similarity to Rickettsia raoultii (GenBank acc. no. KJ663737.1).

H. punctata ticks represented 3.9% of collected ticks, with 19 ticks (3 adults and 16 nymphs). After testing for the selected pathogens, we were not able to confirm any infection in these ticks.

Discussion

Ixodes ricinus

I. ricinus is the most prevalent tick species found in forested areas within Romania (Mihalca et al. 2012). It is also known to have extensive host diversity, with more than 300 host species (Mihalca and Sandor 2013) and can harbor several different pathogens able to significantly impact human health.

Tick-borne rickettsioses are well-recognized emerging diseases present throughout Europe and Romania that cause a wide range of clinical manifestations (Oteo and Portillo 2012, Ionita et al. 2016). In this study, the two different habitats had similar prevalence rates, which could signify uniform distribution of SFG Rickettsia in questing ticks from eastern Romania.

Our results revealed a similar prevalence rate in both nymphs and adults. This may be due to transovarial transmission that can occur with Rickettsia species, in which I. ricinus also plays the role of a reservoir host (Sprong et al. 2009). This phenomenon increases overall prevalence rates similar to the effect of infectious bloodmeals (Reis et al. 2011). We identified two SFG Rickettsia species in infected I. ricinus ticks: R. helvetica and R. monacensis. The pathogenic potential of R. helvetica is currently unknown, but it was suspected to cause acute perimyocarditis, unexplained febrile illness, and sarcoidosis in several isolated cases (Nilsson et al. 1999, 2010, Svendsen et al. 2011). R. monacensis was recently described in Romanian ticks (Ionita et al. 2016, Marcutan et al. 2016); however, its risk to human health remains unclear. Based on these findings, it is likely that other unidentified rickettsial species are also present in Romanian ticks, requiring greater efforts to better characterize and evaluate their pathogenic potential.

A. phagocytophilum can cause tick-borne fever anywhere Ixodes ticks bite humans. In this study, 1.3% of I. ricinus nymphs were infected with A. phagocytophilum, representing a lower rate when compared to previous Romanian studies that surveyed questing I. ricinus ticks (Matei et al. 2015, Kalmar et al. 2016). We did not detect A. phagocytophilum-positive ticks in Iaşi area. This situation could suggest the focalized infection distribution pattern; moreover, previous reports have also indicated significant variance in prevalence between distinct habitats and geographical areas (Matei et al. 2015).

The relatively low prevalence in our study might reflect reduced infection levels in reservoir hosts, of which the majority are rodents (Jin et al. 2012). Additionally, adult I. ricinus ticks may be more frequently infected by this tick-borne pathogen due to their greater number of bloodmeals than when at the nymphal stage, also taking into account that transovarial A. phagocytophilum transmission has not yet been proven. Consequently, the prevalence of human granulocytic anaplasmosis agents in ticks from eastern Romania could be higher than we detected.

There have been no reported cases of human A. phagocytophilum infection in Romania to date. However, considering that many studies indicate A. phagocytophilum circulation in Romanian territory (Mircean et al. 2012, Pastiu et al. 2012, Dumitrache et al. 2013, Ionita et al. 2013, Kiss et al. 2014), there might still be a high infection risk.

We detected “C. N. mikurensis” in unfed I. ricinus ticks with a global prevalence similar to other European studies, and in accordance with a recent study that established “C. N. mikurensis” prevalence in unfed I. ricinus ticks from central and northern parts of Romania (Kalmar et al. 2016).

I. ricinus ticks from Tulcea area had high “C. N. mikurensis” prevalence, and a low infection was observed in Iaşi area. Wild rodents are common reservoirs for “C. N. mikurensis” (Burri et al. 2014) and Tulcea area is a habitat known for its large range of various mammal species (Murariu 2006), likely explaining the observed “C. N. mikurensis” rates.

Only the nymphal stage of I. ricinus ticks tested positive for “C. N. mikurensis” infection. This may be due to the large number of small mammals (especially rodents), which are the suggested reservoir hosts of the pathogen (Obiegala et al. 2014) and are predominantly parasitized by larval stages of I. ricinus ticks. Because “C. N. mikurensis” is an important human tick-borne pathogen and as limited data exist regarding its circulation in Romania, this pathogen should undergo further study.

There are several published cases of humans being infected with multiple tick-borne pathogens (Duffy et al. 1997); and although tick co-infections may have a major impact on the diagnosis and treatment of tick-borne disease, only few studies have addressed the prevalence of co-infection. We determined that 0.9% of ticks harbored more than one pathogen, and co-infections were detected in ticks from Tulcea area, which is located near the Danube Delta Biosphere Reserve. This reserve is known to harbor a wide variety of mammals, and resident and migratory bird species previously described as tick hosts (Sándor et al. 2014) and thus appears to be a high-risk zone for tick-borne pathogens.

Dermacentor reticulatus and Haemaphysalis punctata

D. reticulatus is the second-most reported tick species after I. ricinus in central Europe (Rubel et al. 2016). This tick rarely bites humans, but can maintain and distribute tick-borne pathogens between susceptible hosts or can serve as a microorganism reservoir (Mierzejewska et al. 2015). In Romania, however, questing D. reticulatus prevalence was estimated at 0.02% (Mihalca et al. 2012). In this study, one D. reticulatus tick tested positive for R. raoultii infection, confirming its presence in ticks from eastern Romania. D. reticulatus appears to be the most competent vector for R. raoultii in Europe (Mierzejewska et al. 2015). This pathogen causes tick-borne lymphadenopathy in humans (TIBOLA) and was previously described in feeding Dermacentor ticks from Romania (Ionita et al. 2013, 2016) confirming their role in R. raoultii transmission. Moreover, this tick species can also transmit other pathogens such as Anaplasma marginale, Bartonella spp., Coxiella burnetii, Borrelia spp., Francisella philomiragia, Francisella-like endosymbiont, and Babesia spp. (Bonnet et al. 2013, Michelet et al. 2016). More research is needed to obtain an improved understanding of the importance of questing Dermacentor ticks in tick-borne pathogen transmission in Romania.

H. punctata are small ticks that can parasitize humans in almost all European countries, and these are considered competent vectors for Crimean-Congo hemorrhagic fever and TBEv (Estrada-Pena and Jongejan 1999).

Studies in Europe indicate the presence of tick-borne pathogens in H. punctata ticks (Tijsse-Klasen et al. 2013, Aktas 2014, Ponomareva et al. 2015). Further, large epidemiological surveys in Romania are required to confirm the implications of H. punctata in pathogen transmission.

Conclusions

Our study provides additional information regarding the co-infections in I. ricinus ticks and confirms the presence of “C. N. mikurensis” in ticks from eastern Romania. It is worth highlighting that these pathogens pose a significant risk in areas with intense recreational activities. We have therefore described new risk areas, and have generated detailed data regarding the occurrence of the surveyed pathogens, which could act as a starting point for further studies examining tick-borne infection risk, to enable the implementation of appropriate protection or control measures.

Footnotes

Acknowledgments

This work was partially funded by the INRA. We thank the Tiques et Maladies à Tiques (TMT) group of the Réseau Ecologie des Interactions Durables for stimulating discussion and support. This work was supported by the COST Action TD1303 (EurNegVec).

Funding was also provided by the European Social Fund Program, Human Resources Development Operation 2007–2013, project no. POSDRU/159/1.5/S/132765.

Author Disclosure Statement

No competing financial interests exist.

References

Aktas

. A survey of ixodid tick species and molecular identification of tick-borne pathogens. Vet Parasitol, 2014; 200:276–283.

Andersson

, Zaghdoudi-Allan

, Tamba

, Stefanache

, et al. Co-infection with “Candidatus Neoehrlichia mikurensis” and Borrelia afzelii in an Ixodes ricinus tick that has bitten a human in Romania. Ticks Tick Borne Dis, 2014; 5:706–708.

Bonnet

, de la Fuente

, Nicollet

, Liu

, et al. Prevalence of tick-borne pathogens in adult Dermacentor spp. ticks from nine collection sites in France. Vector Borne Zoonotic Dis, 2013; 13:226–236.

Burri

, Schumann

, Gern

. Are Apodemus spp. mice and Myodes glareolus reservoirs for Borrelia miyamotoi, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, R. monacensis and Anaplasma phagocytophilum?. Ticks Tick Borne Dis, 2014; 5:245–251.

de la Fuente

, Estrada-Pena

, Venzal

, Kocan

, et al. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci, 2008; 13:6938–6946.

Duffy

, Pittlekow

, Kolbert

, Rutledge

, et al. Coinfection with Borrelia burgdorferi and the agent of human granulocytic ehrlichiosis. Lancet, 1997; 349:399.

Dumitrache

, Pastiu

, Kalmar

, Mircean

, et al. Northern white-breasted hedgehogs Erinaceus roumanicus as hosts for ticks infected with Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in Romania. Ticks Tick Borne Dis, 2013; 4:214–217.

Egyed

, Elo

, Sreter-Lancz

, Szell

, et al. Seasonal activity and tick-borne pathogen infection rates of Ixodes ricinus ticks in Hungary. Ticks Tick Borne Dis, 2012; 3:90–94.

Estrada-Pena

, Jongejan

. Ticks feeding on humans: A review of records on human-biting Ixodoidea with special reference to pathogen transmission. Exp Appl Acarol, 1999; 23:685–715.

10.

Hall

. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser, 1999; 41:95–98.

11.

Ionita

, Mitrea

, Pfister

, Hamel

, et al. Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania. Vet Parasitol, 2013; 196:71–76.

12.

Ionita

, Silaghi

, Mitrea

, Edouard

, et al. Molecular detection of Rickettsia conorii and other zoonotic spotted fever group rickettsiae in ticks, Romania. Ticks Tick Borne Dis, 2016; 7:150–153.

13.

Jahfari

, Fonville

, Hengeveld

, Reusken

, et al. Prevalence of Neoehrlichia mikurensis in ticks and rodents from North-west Europe. Parasit Vectors, 2012; 5:74.

14.

Jin

, Wei

, Liu

, Qian

. Epidemiology and control of human granulocytic anaplasmosis: A systematic review. Vector Borne Zoonotic Dis, 2012; 12:269–274.

15.

Kalmar

, Mihalca

, Dumitrache

, Gherman

, et al. Geographical distribution and prevalence of Borrelia burgdorferi genospecies in questing Ixodes ricinus from Romania: A countrywide study. Ticks Tick Borne Dis, 2013; 4:403–408.

16.

Kalmar

, Sprong

, Mihalca

, Gherman

, et al. Borrelia miyamotoi and Candidatus Neoehrlichia mikurensis in Ixodes ricinus Ticks, Romania. Emerg Infect Dis, 2016; 22:550–551.

17.

Kiss

, Cadar

, Krupaci

, Bordeanu

, et al. Prevalence of Anaplasma phagocytophilum infection in European wild boar (Sus scrofa) populations from Transylvania, Romania. Epidemiol Infect, 2014; 142:246–250.

18.

Lommano

, Bertaiola

, Dupasquier

, Gern

. Infections and coinfections of questing Ixodes ricinus ticks by emerging zoonotic pathogens in Western Switzerland. Appl Environ Microbiol, 2012; 78:4606–4612.

19.

Marcutan

, Kalmar

, Ionica

, D'Amico

, et al. Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasit Vectors, 2016; 9:294.

20.

Matei

, Kalmar

, Lupse

, D'Amico

, et al. The risk of exposure to rickettsial infections and human granulocytic anaplasmosis associated with Ixodes ricinus tick bites in humans in Romania: A multiannual study. Ticks Tick Borne Dis, 2017; 8:375–378.

21.

Matei

, Kalmar

, Magdas

, et al. Anaplasma phagocytophilum in questing Ixodes ricinus ticks from Romania. Ticks Tick Borne Dis, 2015; 6:408–413.

22.

Michelet

, Delannoy

, Devillers

, Umhang

, et al. High-throughput screening of tick-borne pathogens in Europe. Front Cell Infect Microbiol, 2014; 4:103.

23.

Michelet

, Joncour

, Devillers

, Torina

, et al. Tick species, tick-borne pathogens and symbionts in an insular environment off the coast of Western France. Ticks Tick Borne Dis, 2016; 7:1109–1115.

24.

Mierzejewska

, Pawelczyk

, Radkowski

, Welc-Faleciak

, et al. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasit Vectors, 2015; 8:490.

25.

Mihalca

, Gherman

, Magdas

, Dumitrache

, et al. Ixodes ricinus is the dominant questing tick in forest habitats in Romania: The results from a countrywide dragging campaign. Exp Appl Acarol, 2012; 58:175–182.

26.

Mihalca

, Sandor

. The role of rodents in the ecology of Ixodes ricinus and associated pathogens in Central and Eastern Europe. Front Cell Infect Microbiol, 2013; 3:56.

27.

Mircean

, Dumitrache

, Gyorke

, Pantchev

, et al. Seroprevalence and geographic distribution of Dirofilaria immitis and tick-borne infections (Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, and Ehrlichia canis) in dogs from Romania. Vector Borne Zoonotic Dis, 2012; 12:595–604.

28.

Moise

, Dumitru

. Identifying aridization vulnerability zones in Dobrogea using medalus indices. Annals of the University of Craiova–Agriculture, Montanology, Cadastre Series, 2012; XLII-1:394–399.

29.

Moutailler

, Valiente Moro

, Vaumourin

, Michelet

, et al. Co-infection of ticks: The rule rather than the exception. PLoS Negl Trop Dis, 2016; 10:e0004539.

30.

Murariu

. Mammal ecology and distribution from North Dobrogea (Romania). Travaux du Muséum National d'Histoire Naturelle «Grigore Antipa», 2006; XLIX:387–399.

31.

Nilsson

, Elfving

, Pahlson

. Rickettsia helvetica in patient with meningitis, Sweden, 2006. Emerg Infect Dis, 2010; 16:490–492.

32.

Nilsson

, Lindquist

, Pahlson

. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet, 1999; 354:1169–1173.

33.

Obiegala

, Pfeffer

, Pfister

, Tiedemann

, et al. Candidatus Neoehrlichia mikurensis and Anaplasma phagocytophilum: Prevalences and investigations on a new transmission path in small mammals and ixodid ticks. Parasit Vectors, 2014; 7:563.

34.

Oteo

, Portillo

. Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis, 2012; 3:271–278.

35.

Paduraru

, Buffet

, Cote

, Bonnet

, et al. Zoonotic transmission of pathogens by Ixodes ricinus ticks, Romania. Emerg Infect Dis, 2012; 18:2089–2090.

36.

Pastiu

, Matei

, Mihalca

, D'Amico

, et al. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: Evidence for host-switching behaviour in ticks?. Parasit Vectors, 2012; 5:301.

37.

Pavel

, Miron

, Raileanu

, Macovei

, et al. Seasonal dynamics of ixodid ticks in Iasi urban area. Journal Scientific papers–Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine Iaşi. 2014; 57:135–139.

38.

Perez-Eid

. Les tiques. Identification, biologie, importance medicale et veterinaire. Paris: Editions Medicales Internationales, 2007 (In French).

39.

Ponomareva

, Mikryukova

, Gori

, Kartashov

, et al. Detection of Far-Eastern subtype of tick-borne encephalitis viral RNA in ticks collected in the Republic of Moldova. J Vector Borne Dis, 2015; 52:334–336.

40.

Raileanu

, Moutailler

, Pavel

, Porea

, et al. Borrelia diversity and co-infection with other tick borne pathogens in ticks. Front Cell Infect Microbiol, 2017; 7:36:1–12.

41.

Regnery

, Spruill

, Plikaytis

. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol, 1991; 173:1576–1589.

42.

Reis

, Cote

, Paul

, Bonnet

. Questing ticks in suburban forest are infected by at least six tick-borne pathogens. Vector Borne Zoonotic Dis, 2011; 11:907–916.

43.

Reye

, Hubschen

, Sausy

, Muller

. Prevalence and seasonality of tick-borne pathogens in questing Ixodes ricinus ticks from Luxembourg. Appl Environ Microbiol, 2010; 76:2923–2931.

44.

Rubel

, Brugger

, Pfeffer

, Chitimia-Dobler

, et al. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick Borne Dis, 2016; 7:224–233.

45.

Sándor

, Mărcuţan

, D'Amico

, Gherman

, et al. Do the ticks of birds at an important migratory hotspot reflect the seasonal dynamics of Ixodes ricinus at the migration initiation site? A case study in the Danube Delta. PLoS One, 2014; 9:e89378.

46.

Sprong

, Wielinga

, Fonville

, Reusken

, et al. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species. Parasit Vectors, 2009; 2:41.

47.

Svendsen

, Milman

, Andersen

, Rasmussen

, et al. Is sarcoidosis a rickettsiosis? An archival study. Scand J Infect Dis, 2011; 43:349–353.

48.

Tijsse-Klasen

, Hansford

, Jahfari

, Phipps

, et al. Spotted fever group rickettsiae in Dermacentor reticulatus and Haemaphysalis punctata ticks in the UK. Parasit Vectors, 2013; 6:212.

49.

von Loewenich

, Geissdorfer

, Disque

, Matten

, et al. Detection of “Candidatus Neoehrlichia mikurensis” in two patients with severe febrile illnesses: Evidence for a European sequence variant. J Clin Microbiol, 2010; 48:2630–2635.

50.

Zaharia

, Popescu

, Florescu

, Ceausu

, et al. Rickettsia massiliae infection and SENLAT syndrome in Romania. Ticks Tick Borne Dis, 2016; 7:759–762.