Antibodies and Molecular Detection of Leishmania ( Leishmania ) infantum in Samples of Free-Ranging Marmosets (Primates: Callitrichidae: Callithrix spp.) in an Area of Canine Visceral Leishmaniasis in Southeastern Brazil

Abstract

Leishmaniasis is a vector-borne parasitic protozoan infection that affects mammals and involves a complex epidemiology. Although dogs are considered the main reservoir in zoonotic visceral leishmaniasis (VL), the possible presence of other mammalian species acting as reservoirs has been associated as a possible cause of lack of success in the control of human VL in many endemic areas. The knowledge about natural infections of some species is still scarce, such as nonhuman primates (NHP), especially from the genus Callithrix (marmosets). We investigated the infection by Leishmania (Leishmania) infantum, the agent of VL in the Americas, in 26 marmosets captured monthly, from April 2014 to March 2015, in an environmentally protected area (EPA) in Southeastern Brazil. The EPA has undergone significant environmental changes and has a transmission focus of canine VL since 2009. Serology was performed through the direct agglutination test, which detected low antibody titers in seven marmosets (7/26; 26.9%, 95% confidence interval 9.9–44.0), being five Callithrix penicillata (black-tufted-ear marmoset) and two Callithrix jacchus (white-tufted-ear marmoset). The presence of the DNA of Leishmania was investigated in blood and skin samples by PCR and genetic sequencing. This is the first report of the detection of L. (L.) infantum in the skin of a marmoset, which was verified in a sample from one C. penicillata. The results demonstrate the natural infection of marmosets by L. (L.) infantum and may suggest the participation of these animals as hosts in the parasite's transmission cycle in the EPA. However, more comprehensive studies are needed to elucidate their role on the VL epidemiology in this area and also in different endemic areas, especially because these NHP are increasingly in contact with humans and domestic animals, particularly due to environmental changes.

Introduction

Leishmaniasis is a neglected tropical disease caused by the Leishmania genus protozoa (Kinetoplastida: Trypanosomatidae) from the subgenus Viannia and Leishmania (WHO 2010, Brasil 2014). Visceral leishmaniasis (VL) is the most severe among leishmaniasis diseases (WHO 2010). In Europe, Asia, and Africa, VL is caused by Leishmania (Leishmania) donovani and Leishmania (Leishmania) infantum, while the latter is the main agent in the Americas (Quinnell and Courtenay 2009, WHO 2010).

The epidemiology of VL is complex, and the agent is a digenetic parasite that completes its life cycle in phlebotomine sand flies and mammal hosts. Most transmission cycles are zoonotic and involve dogs acting as reservoirs, but a number of other potential transmission routes and hosts have been investigated (Quinnell and Courtenay 2009, Millán et al. 2014).

The identification of the reservoir host involved in the epidemiology of a disease is fundamental for the definition and success of control measures (Haydon et al. 2002). However, it is currently accepted that the concept of reservoir is a system that involves a species or a set of species that are responsible for keeping the parasite in nature in a given period of time and space (Ashford 1996, Haydon et al. 2002).

The species Cerdocyon thous, Didelphis albiventris, and Didelphis marsupialis are described as potential reservoirs of L. (L.) infantum in the Americas (WHO 2010, Brasil 2014). However, studies with firm conclusions about the wild reservoirs of the parasite in most endemic areas are still scarce (Quinnell and Courtenay 2009, WHO 2010). Moreover, the natural infection of some species is still little studied, such as nonhuman primates (NHP) (Roque and Jansen 2014).

Many NHP species are included in conservation programs and are often translocated and reintroduced without considering possible parasite and other infections, and also an eventual role in the epidemiology and transmission cycle of infectious agents, like Leishmania (Roque and Jansen 2014).

NHP are physiologically close to humans (Kennedy et al. 1997), and therefore, different species have been used as biological models in several Leishmania experimental infections, which may be useful for understanding the human disease. Natural infection or serological evidence of Leishmania infection in NHP was reported in countries, such as Argentina (Acardi et al. 2013), Mexico (Rovirosa-Hernández et al. 2013), Kenya (Gicheru et al. 2009), Cameroon (Hamad et al. 2015), Panama (Herrer and Christensen 1976), and Brazil (Malta et al. 2010, de Lima et al. 2012, Lombardi et al. 2014, Bueno et al. 2017).

In this study, we investigate the natural infection of a particularly poorly studied genus of NHP, the Callithrix spp. These animals, called marmosets, are New World primates included in the family Callitrichidae (Roskov et al. 2017). They are small, arboreal, diurnal, various gum-feeding, faunivore (insectivore)/frugivore animals of the forests, Chaco, and scrubs of tropical Central and South America (Rylands et al. 2008). In Brazil, marmosets occur in the Atlantic Forest and in the neighboring biomes of Caatinga and Cerrado (Sena et al. 2002).

The species Callithrix penicillata (black-tufted-ear marmoset) and Callithrix jacchus (white-tufted-ear marmoset) diverging as sister species <1 million years ago (Perelman et al. 2011). They have been introduced in areas outside their respective distributions, particularly in Southeastern Brazil, and established in other areas, including those occupied by other Callithrix species (Rylands et al. 2008, Malukiewicz et al. 2015).

We report a molecular and serology cross-sectional investigation of C. jacchus and C. penicillata captured in an environmentally protected area (EPA) in Southeastern Brazil, which has a transmission focus of canine VL since 2009.

Materials and Methods

Free-ranging marmosets were monthly captured, for five consecutive days, from April 2014 to March 2015, using 60 tomahawk traps in 18 forest fragments in the EPA of the municipality of Campinas, State of São Paulo, Southeastern Brazil.

The EPA is located between the latitudes 22°45′00″ and 22°56′00″ S and longitudes 46°52′30″ and 47°00′00″ W and has an urban occupation area, where humans and their pets are in close contact with wild animals. In this area, there are two residential condominiums where cases of canine VL occur since 2009. The selected areas for mammal capture include forest fragments distant, near and within this urban area.

The captured marmosets were identified with microchip implants (Microchips Brasil^®), and the sampling was performed during manual containment. The capture, containment, handling, and sampling were carried out according to the guidelines for the use of wild mammals in research (Sikes et al. 2011).

Blood and serum samples were collected by venipuncture and were partially conditioned in tubes with and without anticoagulant, which were destined to DNA extraction and serological tests, respectively. Samples of intact (without lesions) tail skin were collected by biopsy, after local antisepsis with 70% ethanol and local anesthesia with 1% lidocaine. An excisional biopsy was performed with a scalpel blade and a fragment of skin measuring ∼5.0 mm in diameter and 30 mg in weight was collected (Solano-Gallego et al. 2001). Samples were stored at 2–8°C until the DNA extraction, which occurred within 72 h after the end of each field week.

To detect antibodies, the direct agglutination test (DAT) was performed according to the study of Paiz et al. (2015), using liquid antigen produced from standard strains of L. (L.) infantum (MHOM/BR/2002/LPC-RPV) and L. (L.) donovani (MHOM/ET/1967/HU3) promastigotes.

The extraction and evaluation of DNA quality, besides PCR and agarose gel electrophoresis, were conducted according to the study of Donalisio et al. (2017). PCR was performed using primers for the internal transcribed spacer-1 (ITS1) of Leishmania spp., LITSR (5′ CTGGATCATTTTCCGATG 3′) and L5.8S (5′ TGATACCACTTATCGCACTT 3′) (el Tai et al. 2000); and to the L. (L.) infantum kinetoplast DNA, Lch14 (5′ CGCACGTTATATCTACAGGTTGAG3′) and Lch15 (5′ TGTTTGGGATTGAGGTAATAGTGA3′) (Silva et al. 2016).

The amplicon was purified with the Illustra GFX PCR DNA and Gel Band Purification kit (GE Healthcare^®), and the identity was confirmed by the Sanger genetic sequencing, which was performed in the Genetic Analyzer 3500 automated sequencer, using the BigDye Terminator v. 3.1 Cycle Sequencing kit (Applied Biosystems™, Life Technologies^®).

Sense and antisense sequences were visualized using Chromas software, v. 2.1.1 (Technelysium Pty Ltd.) and were submitted to global alignment using MEGA7 software (Kumar et al. 2016). Then, they were compared with sequences deposited in the GenBank using the Nucleotide Basic Local Alignment Search Tool (BLASTn). The confidence intervals (CIs) were calculated in Stata software v. 9.2 (Stata Corp.).

This research was approved by the Ethics Committee on Animal Use of the State University of Campinas (protocol No. 3296-1) and by the Brazilian Institute of Environment and Renewable Natural Resources, through the Biodiversity Authorization and Information System (IBAMA, SISBIO, No. 42926-1/2).

Results

A total of 26 marmosets were captured, being 8 C. jacchus and 18 C. penicillata. Blood and serum samples were collected from all marmosets, but for logistical reasons, such as the need of longer animal containment time, skin samples of sufficient quality and quantity were obtained only from one C. jacchus and eight C. penicillata.

Animals that had detectable antibodies or positive PCR, besides information about their capture site, are listed in Table 1. Antibody titers from 20 to 40 were detected by DAT in the serum samples from 7 (7/26; 26.9%, 95% CI 9.9–44.0) marmosets, being 5 C. penicillata and 2 C. jacchus.

Table 1.

Serological and Molecular Results of Free-Ranging Marmosets (Callithrix spp.) Captured in an Environmentally Protected Area in São Paulo State, Brazil

	Antibody titer ^a		DNA detection ^d
Species	DAT ^b Leishmania (Leishmania) infantum	DAT ^c with Leishmania (Leishmania) donovani	ITS1-PCR ^e	Lch-PCR ^f
Callithrix penicillata ^g	20	Negative	ITS1-PCR ^e	Lch-PCR ^f	Negative	Negative
C. penicillata ^h	20	Negative	Negative	Negative
Callithrix jacchus ⁱ	Negative	20	Negative	Negative
C. penicillata ^g	20	20	Negative	Negative
C. penicillata ^h	20	40	Negative	Negative
C. jacchus ^g	20	Negative	Negative	Negative
C. penicillata ^h	40	40	Positive (skin sample)	Negative

Antibody titers detected by DAT and PCR positive results are highlighted in bold.

Antibody titer obtained by the DAT using liquid antigen produced with ^b L. (L.) infantum promastigotes; ^c L. (L.) donovani promastigotes.

PCR was performed in blood and skin samples using primers for ^ethe ITS1 of Leishmania spp. (LITSR/L5.8S) and ^f L. (L.) infantum kinetoplast DNA (Lch14/Lch15).

Marmosets were captured in forest fragments: ^gdistant from the urbanized area in EPA; ^hcondominiums in the urbanized area (transmission area of canine visceral leishmaniasis); ⁱrural areas near the urbanized area.

DAT, direct agglutination test; EPA, environmentally protected area; ITS1, internal transcribed spacer-1.

Amplification of a 320 base pair product was obtained in the ITS1-PCR of skin sample of one C. penicillata (1/26; 3.8%, 95% CI 0.1–19.6), and the genetic sequence resulted in 100% identity with sequences of L. (L.) infantum (query cover 100%; E value 2e-162; access KY658231.1). The obtained sequence is available at the GenBank database, under the accession number MF688836. Marmosets that showed antibody titers and the DNA of L. (L.) infantum were captured in the following months: August (1) and November (1) 2014; January (2), February (2), and March (1) 2015. Among these animals, three (3/7; 42.9%) were captured in the urban area of the EPA, where transmission of canine VL occurs and, therefore, near residences and infected dogs.

Discussion

The role of marmosets in maintaining L. (L.) infantum in natural cycles is still unknown. In this study, we demonstrated serological evidence of infection in seven marmosets. The low antibody titers detected by DAT may indicate that these NHP have been exposed to Leishmania infection.

The use of homologous antigens is recommended for performing DAT (Garcez et al. 1997). Although the antigens used in this study are employed for the detection of antibodies to the L. donovani complex, it is important to note that low titers of DAT were less specific (Veeken et al. 2003) and may occur due to cross-reactions in animals infected with any Leishmania species or even by other parasites (Paiz et al. 2015). Thus, when DAT results in low titers, it may be indicated for screening purposes (Veeken et al. 2003), as used in cross-sectional studies, such as this report.

The use of DAT is particularly important in studies involving different animal species, as it does not require species-specific anti-immunoglobulin, which is a limitation for other serological techniques. However, there is no standard DAT cutoff point for the diversity of wild mammal species (Paiz et al. 2015). In Brazil, studies have used DAT in wild animals' samples with dilutions of 1:10 (Voltarelli et al. 2009) and 1:40 (Schallig et al. 2007) as cutoff points.

Correlation between the results of serological and molecular techniques was not expected, considering that the first consists of detecting antibodies and may be positive even if the parasite is absent in organism (Roque and Jansen 2014). However, a titer of 40 was detected in the C. penicillata that presented the DNA of L. (L.) infantum in its skin sample, which indicates that the low titer may be due to the immune response to L. (L.) infantum infection, in the case of this animal.

This is the first detection of the parasite (DNA) in a skin sample from this genus of NHP. However, it is important to note that the molecular detection does not necessarily demonstrate the capacity of an animal species to transmit the parasite to vectors or to act as a potential reservoir host. Positive skin or blood cultures and/or xenodiagnoses suggest the viability of the parasite and the potencial of its transmission (Roque and Jansen 2014), which can be measured in the future studies.

In our study, the PCR was used to assess the occurrence of Leishmania infections in wild mammals, which was not yet known in the study area (Paiz et al. 2016, Donalisio et al. 2017). Molecular diagnosis is indicated for this purpose, due to its high sensitivity (Roque and Jansen 2014, Navea-Pérez et al. 2015). However, the prevalence of infection by L. (L.) infantum described in this study may be underestimated, considering the impossibility of obtaining skin samples from all the captured marmosets.

It is important to note that the investigation of natural infection of Callithrix spp. by Leishmania spp. is rare. Some Brazilian studies showed negative results when evaluated: one road-killed C. penicillata from São Paulo State, by PCR of tissue samples (Richini-Pereira et al. 2014); and one C. penicillata from Bahia State, by serological tests and isolation (Sherlock 1996).

In a serological study of free-ranging wild mammals, also conducted in São Paulo State, the researchers detected evidence of infection in a C. jacchus with a DAT-titer of 320, although it was a nonendemic area for VL (Paiz et al. 2015).

Captive and free-ranging NHP from São Paulo State were evaluated in another study, which reported that 100.0% (14/14) of the enzyme-linked immunosorbent assay-positive animals were Callithrix spp. and 77.7% (21/27) of the positive animals by PCR of leukocyte fraction and lymph node were C. penicillata (Bueno 2012).

Recently, a study conducted in an endemic area for VL in Bahia State, also in Brazil, reported the molecular detection of Leishmania spp. in two of five marmosets sampled. The authors reinforced the importance of investigating newly infected species in areas that have been modified by human action. They also hypothesized that rainforest remnants located inside urban regions with poor sanitary infrastructure may represent risks for the human population and endangered animal species (Trüeb et al. 2018).

Currently, there is a growing concern about the impact of natural or anthropogenic environmental changes, which have increased the contact between wildlife, pets, and man (Curi et al. 2006). It is an important issue considering that NHP and humans can share disease agents, which represents conservation and public health risks (Chapman et al. 2005).

In the EPA of Campinas, which has undergone intense environmental changes of anthropogenic origin, especially in the 1970s and 1980s (Seplama 1996, Donalisio et al. 2017), marmosets were frequently in contact with humans, being quite attractive and often fed by them.

Since 2009 canine VL is transmitted in EPA-Campinas and presents an atypical epidemiology when compared to most of the Brazilian endemic areas: although canine transmission usually precedes the occurrence of human cases in endemic areas in Brazil (Brasil 2014), no autochthonous human cases have yet been diagnosed; the canine incidence and prevalence are low and VL canine cases remain geographically restricted to residential condominiums located inside the EPA; there is also low vector density (Lutzomyia longipalpis) in this canine VL transmission focus (von Zuben et al. 2014; Donalisio et al. 2017).

Although dogs are considered the main reservoir involved in cases of human VL in the urban environment, especially due to the presence of parasites in dermis (WHO 2010), the participation of other wild mammals in the maintenance of L. (L.) infantum in peridomiciliary areas should not be ignored (Roque and Jansen 2014). In addition to marmosets, opossums were also identified with L. (L.) infantum infection in the EPA (Paiz et al. 2016, Donalisio et al. 2017), showing the importance to considerer other animal species in the epidemiology of VL.

Mammal reservoirs other than dogs have been repeatedly proposed as one of the possible causes for the lack of success of VL control measures (Millán et al. 2014). However, it is important to note that the detection of natural infection in an animal species does not imply their role as reservoir hosts, an assumption that may have to consider several other parameters (Travi et al. 2002).

Conclusions

We reported serological evidence of L. (L.) infantum infection in seven marmosets and demonstrated, for the first time, the presence of the DNA of the parasite in a healthy skin sample of C. penicillata.

We suggest more comprehensive studies to confirm or discard the participation of marmosets in the transmission cycle of canine VL in the study area and also in other areas of VL transmission. We also draw attention to the importance of evaluating these still poorly studied Neotropical NHP because they are in increasingly contact with man and domestic animals in fragmented sylvatic areas. The investigation of Leishmania infection in mammal fauna is important for understanding the epidemiology and the maintenance of the parasite in different VL endemic areas, contributing to the design of control strategies according to eco-epidemiological particularities of each transmission area.

Footnotes

Acknowledgments

The authors gratefully acknowledge the financial support from the São Paulo Research Foundation (FAPESP, www.fapesp.br) grant Nos. 2014/27212-0, 2014/13049-0, and 2016/02572-0. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the article. We also acknowledge the technical support of the Department of Animal Welfare and Protection and Campinas Municipal Health Secretariat, notably the staff of the Zoonosis Surveillance Unit and the veterinarian Claudio Luiz Castagna, besides the staff of the Adolfo Lutz Institute. The authors also thank “Espaço da Escrita, Coordenadoria Geral da Universidade, UNICAMP” for the language services provided.

Author Disclosure Statement

No competing financial interests exist.

References

Acardi

, Rago

, Liotta

, Fernandez-Duque

, et al. Leishmania (Viannia) DNA detection by PCR-RFLP and sequencing in free-ranging owl monkeys (Aotus azarai azarai) from Formosa, Argentina. Vet Parasitol, 2013; 193:256–259.

Ashford

. Leishmaniasis reservoirs and their significance in control. Clin Dermatol, 1996; 14:523–532.

Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de Vigilância Epidemiológica. Manual de vigilância e controle da leishmaniose visceral (Manual of surveillance and control of visceral leishmaniasis.). Brasília: Editora do Ministério da Saúde,, 2014:122.

Bueno

. Pesquisa de Leishmania spp. e Plasmodium spp. em primatas neotropicais provenientes de regiões de Mata Atlântica e Amazônia impactadas por ações antrópicas: Investigação in situ e ex situ [thesis] (survey of Leishmania spp. and Plasmodium spp. in neotropical primates from Atlantic Forest and Amazon Regions impacted by human activities: in situ and ex situ study). São Paulo: Universidade de São Paulo,, 2012:300.

Bueno

, Catão-Dias

, de Oliveira Laroque

, Vasconcellos

, et al. Infectious diseases in free-ranging blonde capuchins, Sapajus flavius, in Brazil. Int J Primatol, 2017; 38:1017–1031.

Chapman

, Gillespie

, Goldberg

. Primates and the ecology of their infectious diseases: how will anthropogenic change affect host-parasite interactions?. Evol Anthropol Issues News Rev, 2005; 14:134–144.

Curi

, Miranda

, Talamoni

. Serologic evidence of Leishmania infection in free-ranging wild and domestic canids around a Brazilian National Park. Mem Inst Oswaldo Cruz, 2006; 101:99–101.

de Lima

VMF

, Santiago

MEB

, da Cruz Sanches

, de Lima

. Molecular diagnosis of Leishmania amazonensis in a captive spider monkey in Bauru, São Paulo, Brazil. J Zoo Wildl Med, 2012; 43:943–945.

Donalisio

, Paiz

, da Silva

, Richini-Pereira

, et al. Visceral leishmaniasis in an environmentally protected area in southeastern Brazil: epidemiological and laboratory cross-sectional investigation of phlebotomine fauna, wild hosts and canine cases. PLoS Negl Trop Dis, 2017; 11:e0005666.

10.

el Tai

, Osman

, El Fari

, Presber

, et al. Genetic heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms and sequencing. Trans R Soc Trop Med Hyg, 2000; 94:575–579.

11.

Garcez

, Silveira

, el Harith

, Lainson

, et al. Experimental cutaneous leishmaniasis. IV. The humoral response of Cebus apella (Primates: Cebidae) to infections of Leishmania (Leishmania) amazonensis, L. (Viannia) lainsoni and L. (V.) braziliensis using the direct agglutination test. Acta Trop, 1997; 68:65–76.

12.

Gicheru

, Jeneby

, Macharia

, Carlsson

, et al. Prevalence of antibodies and cell mediated immune response against Leishmania major in feral nonhuman primates from Kenya. Acta Trop, 2009; 109:136–140.

13.

Hamad

, Forestier

, Peeters

, Delaporte

, et al. Wild gorillas as a potential reservoir of Leishmania major . J Infect Dis, 2015; 211:267–273.

14.

Haydon

, Cleaveland

, Taylor

, Laurenson

. Identifying reservoirs of infection: a conceptual and practical challenge. Emerg Infect Dis, 2002; 8:1468–1473.

15.

Herrer

, Christensen

. Epidemiological patterns of cutaneous leishmaniasis in Panama. III. Endemic persistence of the disease. Am J Trop Med Hyg, 1976; 25:54–58.

16.

Kennedy

, Shearer

, Hildebrand

. Nonhuman primate models to evaluate vaccine safety and immunogenicity. Vaccine, 1997; 15:903–908.

17.

Kumar

, Stecher

, Tamura

. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol, 2016; 33:1870–1874.

18.

Lombardi

, Turchetti

, Tinoco

, Pessanha

, et al. Diagnosis of Leishmania infantum infection by polymerase chain reaction in wild mammals. Pesqui Vet Bras, 2014; 34:1243–1246.

19.

Malta

MCC

, Tinoco

, Xavier

, Vieira

, et al. Naturally acquired visceral leishmaniasis in non-human primates in Brazil. Vet Parasitol, 2010; 169:193–197.

20.

Malukiewicz

, Boere

, Fuzessy

, Grativol

, et al. Natural and anthropogenic hybridization in two species of Eastern Brazilian marmosets (Callithrix jacchus and C. penicillata). PLoS One, 2015; 10:e0127268.

21.

Millán

, Ferroglio

, Solano-Gallego

. Role of wildlife in the epidemiology of Leishmania infantum infection in Europe. Parasitol Res, 2014; 113:2005–2014.

22.

Navea-Pérez

, Díaz-Sáez

, Corpas-López

, Merino-Espinosa

, et al. Leishmania infantum in wild rodents: reservoirs or just irrelevant incidental hosts?. Parasitol Res, 2015; 114:2363–2370.

23.

Paiz

, Donalisio

, Richini-Pereira

, Motoie

, et al. Infection by Leishmania spp. in free-ranging opossums (Didelphis albiventris) in an Environmentally Protected Area inhabited by humans in Southeastern Brazil. Vector-Borne Zoonotic Dis, 2016; 16:728–730.

24.

Paiz

, Fornazari

, Menozzi

, Oliveira

, et al. Serological evidence of infection by Leishmania (Leishmania) infantum (synonym: Leishmania (Leishmania) chagasi) in free-ranging wild mammals in a nonendemic region of the State of São Paulo, Brazil. Vector-Borne Zoonotic Dis, 2015; 15:667–673.

25.

Perelman

, Johnson

, Roos

, Seuánez

, et al. A molecular phylogeny of living primates. PLoS Genet, 2011; 7:e1001342.

26.

Quinnell

, Courtenay

. Transmission, reservoir hosts and control of zoonotic visceral leishmaniasis. Parasitology, 2009; 136:1915–1934.

27.

Richini-Pereira

, Marson

, Hayasaka

, Victoria

, et al. Molecular detection of Leishmania spp. in road-killed wild mammals in the Central Western area of the State of São Paulo, Brazil. J Venom Anim Toxins Incl Trop Dis, 2014; 20:27.

28.

Roque

ALR

, Jansen

. Wild and synanthropic reservoirs of Leishmania species in the Americas. Int J Parasitol Parasites Wildl, 2014; 3:251–262.

29.

Roskov

, Abucay

, Orrell

, Nicolson

, et al., eds. Species 2000 & ITIS catalogue of life, 2017 annual checklist. Leiden: Species 2000: Naturalis, 2017. Available at www.catalogueoflife.org/annual-checklist/2017 Last accessed December 12, 2017 .

30.

Rovirosa-Hernández Mde

, Cortes-Ortíz

, García-Orduña

, Guzmán-Gómez

, et al. Seroprevalence of Trypanosoma cruzi and Leishmania mexicana in free-ranging howler monkeys in southeastern Mexico. Am J Primatol, 2013; 75:161–169.

31.

Rylands

, Coimbra-Filho

, Mittermeier

. The systematics and distributions of the marmosets (Callithrix, Callibella, Cebuella, and Mico) and callimico (Callimico) (Callitrichidae, Primates). In: Ford

, Davis

, Porter

, eds. The Smallest Anthropoids: The Marmoset/Callimico Radiation. New York: Springer, 2008:25–61.

32.

Schallig

HDFH

, da Silva

, van der Meide

, Schoone

, et al. Didelphis marsupialis (common opossum): a potential reservoir host for zoonotic leishmaniasis in the Metropolitan Region of Belo Horizonte (Minas Gerais, Brazil). Vector Borne Zoonotic Dis, 2007; 7:387–393.

33.

Sena

, Vallinoto

, Sampaio

, Schneider

, et al. Mitochondrial COII gene sequences provide new insights into the phylogeny of marmoset species groups (Callitrichidae, Primates). Folia Primatol, 2002; 73:240–251.

34.

Seplama. Secretaria de Planejamento e Meio Ambiente. Prefeitura Municipal de Campinas. Plano de gestão da área de proteção ambiental da região de Sousas e Joaquim Egídio, APA municipal (Plan of management of the environmental protection area of the Sousas and Joaquim Egídio region, municipal APA.). 1996:177. Available at www.campinas.sp.gov.br

35.

Sherlock

. Ecological interactions of visceral leishmaniasis in the State of Bahia, Brazil. Mem Inst Oswaldo Cruz, 1996; 91:671–683.

36.

Sikes

, Gannon

WL;

. Animal Care and Use Committee of the American Society of Mammalogists. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. J Mammal, 2011; 92:235–253.

37.

Silva

, Richini-Pereira

, Kikuti

, Marson

, et al. Detection of Leishmania (L.) infantum in stray dogs by molecular techniques with sensitive species-specific primers with sensitive species-specific primers. Vet Q, 2016; 37:23–30.

38.

Solano-Gallego

, Morell

, Arboix

, Alberola

, et al. Prevalence of Leishmania infantum infection in dogs living in an area of canine leishmaniasis endemicity using PCR on several tissues and serology. J Clin Microbiol, 2001; 39:560–563.

39.

Travi

, Arteaga

, Leon

, Adler

. Susceptibility of spiny rats (Proechimys semispinosus) to Leishmania (Viannia) panamensis and Leishmania (Leishmania) chagasi . Mem Inst Oswaldo Cruz, 2002; 97:887–892.

40.

Trüeb

, Portela

, Franke

, Carneiro

, et al. Trypanosoma cruzi and Leishmania sp. infection in wildlife from urban rainforest fragments in Northeastern Brazil. J Wildl Dis, 2018; 54:76–84.

41.

Veeken

, Ritmeijer

, Seaman

, Davidson

. Comparison of an rK39 dipstick rapid test with direct agglutination test and splenic aspiration for the diagnosis of kala-azar in Sudan. Trop Med Int Health, 2003; 8:164–167.

42.

Voltarelli

, Arraes

, Perles

, Lonardoni

, et al. Serological survey for Leishmania sp. infection in wild animals from the municipality of Maringá, Paraná state, Brazil. J Venom Anim Toxins Incl Trop Dis, 2009; 15:732–744.

43.

von Zuben

APB

, Angerami

, Castagna

, Baldini

MBD

, et al. The first canine visceral leishmaniasis outbreak in Campinas, State of São Paulo Southeastern Brazil. Rev Soc Bras Med Trop, 2014; 47:385–388.

44.

World Health Organization (WHO). Control of the leishmaniases: report of a meeting of the WHO Expert Committee on the Control of Leishmaniasis. Technical report series no. 949. Geneva: WHO Press, 2010:187.