Trypanosoma rangeli 28Sβ Ribosomal Gene Allows Intra and Interspecific Molecular Differentiation

Abstract

Trypanosoma rangeli is an avirulent flagellate protozoan that could mislead correct diagnosis of Trypanosoma cruzi infection, the causative agent of Chagas' disease, given their high similarity. Besides, T. rangeli presents two genetic groups, whose differentiation is achieved mainly by molecular approaches. In this context, ribosomal DNA (rDNA) is a useful target for intra and interspecific molecular differentiation. Analyzing the rDNA of T. rangeli and comparison with other trypanosomatid species, two highly divergent regions (Trβ1 and Trβ2) within the 28Sβ gene were found. Those regions were amplified and sequenced in KP1(+) and KP1(−) strains of T. rangeli, revealing group-specific polymorphisms useful for intraspecific distinction through restriction fragment length polymorphism technique. Also, amplification of Trβ1 allowed differentiation between T. rangeli and T. cruzi. Trβ2 predicted restriction length profile, allowed differentiation between T. rangeli, T. cruzi, Trypanosoma brucei, and Leishmania braziliensis, increasing the use of Trβ1 and Trβ2 beyond a molecular approach for T. rangeli genotyping, but also as a useful target for trypanosomatid classification.

Introduction

T rypanosoma cruzi (Chagas, 1909) and Trypanosoma rangeli (Tejera 1920) are flagellate protozoa that present the same geographic distribution in Central America and South America and share vertebrate and invertebrate hosts (Guhl and Vallejo 2003, Vallejo et al. 2009). T. cruzi pathogenesis in humans is well established, known as Chagas' disease, whereas T. rangeli is considered nonpathogenic to humans even though human infection has been reported in several countries (Coura et al. 1996, Saldaña et al. 2005, Calzada et al. 2006). The significance of T. rangeli infection is related to humoral immune response against the parasite that could recognize T. cruzi antigens and interfere with serological diagnosis of Chagas' disease (Guhl et al. 1987, Caballero et al. 2007, de Moraes et al. 2008).

T. rangeli is divided in two genetic groups based on the presence of kinetoplast DNA (kDNA) minicircles. Genetic group KP1(+) encompasses KP1, KP2, and KP3 kDNA minicircles and KP1(−) genetic group comprises only KP2 and KP3 kDNA minicircles (Vallejo et al. 2002).

Several strategies have been developed in the last years to improve sensitivity and specificity in detection and differentiation between Trypanosoma species (Naves et al. 2017, Schijman 2018), although crossreactivity between T. cruzi and T. rangeli is still reported (Ramírez et al. 2015, Seiringer et al. 2017). As an alternative to immunological assays, molecular techniques are useful and available to differentiate both trypanosomatids relevant in clinic, and it also could be used to distinguish between other trypanosomatids, using suitable targets. In this context, the ribosomal locus is a valuable target to demonstrate intra and interspecific variability in pathogenic or nonpathogenic species (Bargues et al. 2002).

The ribosomal RNA (rRNA) gene locus in trypanosomatids presents a complex arrangement when compared with prokaryotes or other eukaryotes. The major difference is related to the 28S rRNA gene, that in trypanosomatids is fragmented in small genes denominated 28Sα, 28Sγ, 28Sβ, 28Sδ, and 28Sζ (Stoco et al. 2014).

Opposing to T. cruzi, T. brucei, and Leishmania spp that have extensive analysis regarding rRNA genes, in T. rangeli fewer regions were analyzed up to date: the internal transcribed spacer (ITS) flanking the 5.8S gene that was described as a useful target for interspecific differentiation (Beltrame-Botelho et al. 2005), and a variable domain in large subunit (LSU) that was suitable for discrimination of T. rangeli and T. cruzi (Souto et al. 1999).

This study proposes to increase the analysis of rRNA genes in T. rangeli to find molecular markers suitable not only for interspecific discrimination, but also useful to distinguish between both genetic groups of T. rangeli KP1(+) and KP1(−) (Vallejo et al. 2002, Cabrine-Santos et al. 2009, 2011) providing new tools for differential molecular diagnosis, phylogenetic characterization, or trypanosomatid taxonomic studies.

Materials and Methods

Parasite strains

Eight T. rangeli strains, 5 T. cruzi strains, and 1 Leishmania braziliensis Vianna, 1911 strain were used in this work. T. rangeli KP1(+) strains were isolated from blood culture and xenodiagnosis from opossums (Didelphis albiventris) captured in Minas Gerais, Brazil (Ramirez et al. 2002, Marquez et al. 2007) or from Rhodnius prolixus triatomine (Marquez et al. 2007) (Table 1). T. rangeli KP1(-) were isolated from Rhodnius pallescens or Homo sapiens and were provided by Dr Jaime Moreno, Departamento de Biologia, Faculdad de Ciencias Exactas y Naturales, Universidade de Antioquia, Colombia. T. cruzi strains were previously characterized. A DNA sample of L. braziliensis M2904 was provided by Dr Angela Kaysel Cruz, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brasil.

Table 1.

General Characteristics of Trypanosomatid Strains

Species	Genotype	Strain	Hosts	Geographical origin	Reference
Trypanosoma rangeli	KP1(+)	P02	Didelphis albiventris	Brazil	Marquez et al. (2007)
		P04	D. albiventris	Brazil	This study.
		P07	D. albiventris	Brazil	Marquez et al. (2007)
		Cas4	Rhodnius prolixus	Colombia	Marquez et al. (2007)
	KP1(−)	SO18	Rhodnius pallescens	Colombia	Vallejo et al. (2003)
		SO29	R. pallescens	Colombia	Vallejo et al. (2003)
		SO48	R. pallescens	Colombia	Vallejo et al. (2003)
		LDG	Homo sapiens	Colombia	Marquez et al. (2007)
Trypanosoma cruzi	I	ALV	Panstrongylus megistus	Colombia	Cabrine-Santos et al. (2011)
		AQ2	Triatoma sordida	Brazil	Cabrine-Santos et al. (2011)
	II	JG	H. sapiens	Brazil	Andrade et al. (1999)
		RNL1	H. sapiens	Brazil	Cabrine-Santos et al. (2011)
		Y	Panstrongylus megistus	Brazil	Silva and Nussenzweig (1953)
Leishmania braziliensis		M2904	H. sapiens	Brazil	Peacock et al. (2007)

Culture conditions, genomic DNA, and total RNA purification

For genomic DNA purification used in PCR or PCR/restriction fragment length polymorphism (RFLP) analysis and Sanger sequencing, epimastigote forms of T. cruzi and T. rangeli were cultured at 28°C in liver infusion tryptose medium supplemented with 3% (v/v) human urine (Ferreira et al. 2007). Cell density was determined by counting in a hemocytometer. Parasite genomic DNA was isolated by enzymatic lysis of 40 mL of epimastigote culture in the exponential phase of growth containing ∼2.5 × 10⁷ parasites/mL (Vallejo et al. 1999, adapted by Lages-Silva et al. 2001). DNA samples were quantified at 260 and 280 nm using the BioPhotometer (Eppendorf).

For total RNA purification used to evaluate size differences in total RNA of T. cruzi and T. rangeli, 10⁷ epimastigote forms of T. cruzi and T. rangeli were centrifuged (1.370 × g, 10 min, 4°C) and washed three times with NaCl 0.9% (w/v). Total RNA was isolated using TRIzol^® reagent (Invitrogen) according to the manufacturer's instructions. Purified RNA was solubilized in 20 μL purified water and stored at −70°C.

DNA and RNA agarose gel electrophoresis

DNA samples were visualized in 1.0% or 2.0% (w/v) TAE (Tris-Acetate 40 mM, ethylenediaminetetraacetic acid - [EDTA]1 mM) agarose gel in 1 × TAE buffer, stained with 0.5 μg/mL of ethidium bromide solution.

RNA sample integrity was evaluated in denaturing agarose gel with 6% (v/v) formaldehyde in 1 × MOPS/EDTA (3-(N-morpholino) propane sulfonic acid) 20 mM pH 7.0, EDTA 1 mM pH 8.0, and sodium acetate 5 mM). All reagents were prepared with diethyl pyrocarbonate-treated water. Approximately 10 μg of RNA were denatured with 2 μL of 10 × MOPS/EDTA, 4 μL formaldehyde, 10 μL formamide, and 1 μL ethidium bromide (200 μg/mL) and incubated at 55°C for 60 min. Samples were resolved for 80 V for 2 h with 2 μL of loading buffer (50% glycerol, EDTA 10 mM pH 8.0, 0.25% (w/v) Bromophenol blue).

Both DNA or RNA agarose gels were photographed in VersaDoc Imaging System (Bio-Rad).

Primer design

Primers used in PCR and sequencing were synthesized by Invitrogen. Using the data available in GenBank for strain SC58 of T. rangeli (Accession number KJ742907.1), T. cruzi (Accession number L22334.1), Leishmania major (Accession number FR796423.1), and Chritidia fasciculata (Accession number Y00055.1), we aimed to obtain sequences within the 28Sβ gene (Fig. 1a and Supplementary Fig. S1) allowing a scenario useful for intra and interspecific comparison. The 28Sβ gene presented two highly polymorphic regions (named Trβ1 and Trβ2) between the analyzed species, allowing the design of specific primers (Fig. 1a) annealing in conserved regions flanking the polymorphic ones. Additional information about the generated primers are presented in Table 2.

FIG. 1.

Representation and analyzes of Trypanosoma rangeli ribosomal locus. (a) Sequence of the rRNA gene locus was obtained from Stoco et al. (2014) and annotated using Clone Manager Basic 9.51 (Sci-Ed Software). The blue boxes denote intergenic spacers between each rRNA sequence. ITS stands for Internal Transcribed Spacer, localized between each of the subunits from the rRNA and the red arrows represents the seven rRNA subunits. Trβ1 and Trβ2 boxes in the 28Sβ gene are 365 and 383/382 bp sequences, respectively, that were found polymorphic in comparison to other trypanosomatids (Supplementary Fig. S1). (b) PCR analysis of Trβ1 and Trβ2 from different strains from T. rangeli. 01, P02; 02, P07; 03, Cas4; 04, SO18; 05, SO29; 06, LDG; 07, NTC. All samples were resolved in 1.0% agarose gel. MM, GeneRuler DNA Ladder, Thermo. For Trβ1, the predicted size in KP1(+) and KP1(−) is 365 bp. For Trβ2, the predicted size is 382 and 383 bp for KP1(+) and KP1(−) strains of T. rangeli, respectively. (c) Sequencing of PCR products revealed GSPs in KP1(+) and KP1(−) strains. Upper board, GSP found in Trβ1, down board, GSPs found in Trβ2 region. FauI (3'- GCGGG- 5’) and EarI (5'- CTCTTC- 3’) endonuclease sites used in PCR-RFLP analysis are highlighted in red. GSPs, group-specific polymorphisms; ITS, internal transcribed spacer; NTC, no template control; RFLP, restriction fragment length polymorphism; rRNA, ribosomal RNA.

Table 2.

Sequence Targets and Characteristics of Primers Designed for PCR and Sequencing

Primer name	Primer sequence (5′→3′)	Annealing temperature (°C)	Product size (bp)
Trβ1-Fw	ATAGAGAAAGGTACACTCAGGGAAGT	54.30	365
Trβ1-Rv	ATACACCACTTGGATGCATCAC
Trβ2-Fw	GGAACGTTGCTTCACTTATCG	54.85	382/383
Trβ2-Rv	TCGCCTTAGGACACCTGC

PCR and PCR-RFLP analysis

PCR of Trβ1 region of T. rangeli was performed in a final volume of 30 μL containing 1 × reaction buffer, 2.5 mM MgCl₂, 0.24 mM of dNTPs, 30 pmol of each primer (listed in Table 2), 1.25 U of Platinum^® Taq DNA Polymerase (Invitrogen) and 100 ng of genomic DNA. The conditions were: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 54.6°C for 20 s and extension at 72°C for 30 s, and one final extension at 72°C for 10 min in the MyCycler Thermal Cycler (Bio-Rad). The amplification products of 365 bp for Trβ1 in both T. rangeli genotypes or 382/383 bp for Trβ2 in T. rangeli KP1(+) or KP1(−), respectively, were visualized in 1.5% (w/v) TAE agarose gel stained with 0.5 μg/mL of ethidium bromide solution and photographed in VersaDoc Imaging System (Bio-Rad).

PCR-RFLP analysis of Trβ2 region of T. rangeli was performed in a final volume of 30 μL containing 1 × reaction buffer, 2.5 mM MgCl₂, 0.24 mM of dNTPs, 30 pmol of each primer (listed in Table 2), 1 U of Platinum Taq DNA Polymerase (Invitrogen), and 100 ng of genomic DNA. The conditions were: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 65°C for 40 s and extension at 72°C for 40 s, and one final extension at 72°C for 10 min in the MyCycler Thermal Cycler (Bio-Rad). The amplification products were digested with 20 units of EarI or 5 U of FauI endonucleases (New England BioLabs) using 1 × CutSmart^® Buffer at 37°C (EarI) or 55°C (FauI) for 1 h.

DNA sequencing and bioinformatic analysis

The amplification products were excised from the agarose gel and purified using the Corning Costar Spin-X^® Centrifuge Tube Filter (Sigma-Aldrich). Both strands of the T. rangeli strains were sequenced using the appropriate forward or reverse primers in the MyCycler Thermal Cycler under these conditions: 96°C for 1 min, followed by 40 cycles at 96°C for 15 s, 50°C for 15 s, and 60°C for 4 min. The nucleotide sequences were analyzed in an ABI PRISM3130xl Genetic Analyzer sequencer (Applied Biosystems) using the Kit Big Dye v3.1 (Applied Biosystems).

In silico analysis with consensus generated by alignment of forward and reverse sequences was performed using the BLAST program (Altschul et al. 1990) and the ClustalΩ software (Sievers et al. 2011) to compose the multiple alignments.

Results

Analysis of ribosomal locus of T. rangeli

To expand the known regions useful for intra and interspecific discrimination using the ribosomal locus, the 28Sβ gene from T. rangeli (Accession number KJ742907.1) was compared with other trypanosomatids (Supplementary Fig. S1). Although a general conservation is observed, two regions of the gene were not conserved between the scrutinized species. These polymorphic regions inside 28Sβ gene were named Trβ1 and Trβ2 (Fig. 1a), and primers Trβ1-Fw, Trβ1-Rv, Trβ2-Fw, and Trβ2-Rv were designed for PCR and sequencing assays (Table 2 and Fig. 1b). Amplicons were predicted in 365 bp for Trβ1 or ∼380 bp for Trβ2 region. PCR shows that both amplicons were present in all analyzed strains (Fig. 1b).

The obtained PCR products were sequenced and the size of 365 bp for Trβ1 and 382 and 383 bp for Trβ2 in KP1(+) and KP1(−) strains, respectively, were confirmed. Sequenced strains were deposited in GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) (Table 3). Group-specific polymorphisms (GSPs) were found in both regions. For Trβ1 region, only one GSP was found (Fig. 1c, top panel), but in Trβ2 region, 5.48% (21/383 bp) polymorphic events were found (Fig. 1c, bottom panel). These polymorphisms found in Trβ2 region allowed the sketching of a PCR-RFLP assay.

Table 3.

GenBank Accession Numbers of Sequences Generated in This Work

Region	Strain	Accession number
Trβ1	T. rangeli P02	MH620206
	T. rangeli Cas4	MH620207
	T. rangeli SO18	MH620208
	T. rangeli SO29	MH620209
	T. rangeli LDG	MH620210
Trβ2	T. rangeli P02	MH620211
	T. rangeli P07	MH620212
	T. rangeli Cas4	MH620213
	T. rangeli SO18	MH620214
	T. rangeli SO29	MH620215
	T. rangeli LDG	MH620216

Intraspecific comparison

Based on the GSPs found in Trβ2 region, sites of FauI and EarI endonucleases were able to differentiate between KP1(+) and KP1(−) strains of T. rangeli. Thereto, a PCR amplification of Trβ2 region was performed, followed by FauI and EarI digestion. FauI digestion of Trβ2 region discriminated between the two strains of T. rangeli by generating a 147 and 236 bp in KP1(−) strains and did not cut amplicons of KP1(+) strains (Fig. 2a). EarI endonuclease cut amplicons of Trβ2 in both strains generating a 20 and 363 bp in KP1(−) strains or 20, 195, and 167 bp in KP1(+) strains (Fig. 2b).

FIG. 2.

PCR-RFLP analysis of Trβ2 region in T. rangeli GSPs found in sequenced strains guided the PCR-RFLP analysis. Trβ2-Fw and Trβ2-Rv primers amplify a fragment of 382 bp in T. rangeli KP1(+) strains and a fragment of 383 bp in KP1(−) strains, which were digested with (a) FauI or (b) EarI. T. rangeli strains: 01, P02; 02, P07; 03, Cas4; 04, SO48; 05, LDG. Restriction maps for FauI and EarI in Trβ2 sequence are presented at the bottom of the respective gel. Samples were resolved in 2.0% agarose gel. MM, 100 bp Molecular Marker, Promega.

Interspecific comparison

There is a difference in size of subunits comprising rRNA of T. rangeli and T. cruzi. As it can be observed in Fig. 3a, in T. rangeli strains, 18S subunit is closer to the 1.5 kb band of the molecular marker, whereas in T. cruzi strains, the same subunit is closer to 2.0 kb. Further comparison of sequences in GenBank database (T. rangeli accession number KJ742907.1 and T. cruzi accession number L22334.1) reveals clearer differences regarding 28Sα (1806 bp in T. rangeli × 1933 bp in T. cruzi) or 28Sβ subunits (1566 in T. rangeli × 1618 in T. cruzi), for example.

FIG. 3.

Interspecific comparison regarding rRNA. (a) Total RNA gel of T. rangeli and Trypanosoma cruzi strains shows differences in size of rRNA subunits between species. 01, P02; 02, P04; 03, P07; 04, Cas-4; 05, SO18; 06, SO29; 07, LDG; 08, AQ2; 09, ALV; 10, JG; 11, RNL1; and 12, Y. MM (RiboRuler™ High Range RNA Ladder; Fermentas). (b) PCR of Trβ1 region shows differences in size of T. cruzi (471 bp) amplicon when compared with T. rangeli (365 bp) and Leishmania braziliensis (361 bp). 01, Cas4; 02, LDG; 03, T. cruzi JG strain; 04, L. braziliensis; 05, NTC. MM (GeneRuler DNA Ladder; Thermo). Samples were resolved in 1.0% agarose gel. (c) Predicted PCR-RFLP results for Trβ2 region of several trypanosomatids. The 28S gene for each species is deposited in GenBank with the following accession numbers: T. rangeli (GenBank access number KJ742907.1), T. cruzi La Cruz strain (GenBank access number L22334.1), T. cruzi Sylvio strain (GenBank access number CP015657.1), T. cruzi CL Brener strain (GenBank access number NW_916144.1), Trypanosoma brucei brucei (GenBank access number NC_007280.1) and L. braziliensis (GenBank access number JX030153.1).

To endorse the new molecular marker for differentiation between trypanosomatids, PCR of Trβ1 was performed (Fig. 3b): T. rangeli Cas4 or LDG strains generate an amplicon of 365 bp, whereas T. cruzi JG (TcII) generates an amplicon of 471 bp (Fig. 3b), allowing interspecific discrimination between T. rangeli and T. cruzi using only a PCR-targeting Trβ1 region.

Besides that, using bioinformatic analysis the predicted PCR products of Trβ1 region for T. cruzi strain Sylvio (TcI, GenBank access number CP015657.1), T. cruzi strain La Cruz (TcI, GenBank access number L22334.1), and T. cruzi strain CL Brener (TcVI, GenBank access number NW_917211.1) are 468, 471, and 461 bp, respectively, suggesting that interspecific discrimination of T. cruzi from T. rangeli could also be achieved using different T. cruzi lineages. The PCR product of L. braziliensis is more similar (345 bp) to T. rangeli amplicon (365 bp), and so the distinction could be achieved using other strategies, such as PCR-RFLP.

The prediction of PCR-RFLP for a variety of trypanosomatids shows that combining the generated restriction pattern of digestion by FauI and EarI endonucleases allows the discerning in all examined species (Fig. 3c). As shown in Fig. 2, differentiation of KP1(+) and KP1(−) strains of T. rangeli can be achieved using FauI or EarI endonucleases. Also, using only FauI digestion of Trβ2 region, both strains of T. rangeli can be distinguished of T. cruzi La Cruz strain (TcI) (no cuts, generating a 330 bp fragment), T. cruzi strain CL Brener (TcVI) (one cut, generating a 46 and 332 bp fragments), T. brucei brucei (no cuts, generating a 345 bp fragment), and L. braziliensis (two cuts, generating a 21, 150, and 174 bp fragments).

The differentiation can be further corroborated using EarI digestion of Trβ2 region: in all species, a 20 bp fragment is generated and 195, 167 bp in KP1(+) strains of T. rangeli, a 363 bp fragment in KP1(−) strains of T. rangeli (confirmed in Fig. 2). Also, a 310, 358, 325, and 325 bp for T. cruzi La Cruz strain (TcI), T. cruzi CL Brener strain (TcVI), T. brucei brucei, and L. braziliensis, respectively.

Discussion

In this work, two regions of the feebly explored 28Sβ gene of T. rangeli were analyzed, enlightening new approaches for differentiation between trypanosomatids using several molecular techniques. Trβ1 and Trβ2 regions were PCR amplified in both genetic groups of T. rangeli: Trβ1 has 365 bp in KP1(+) and KP1(−) strains, and Trβ2 has 382 or 383 bp in KP1(+) and KP1(−), respectively. Although agarose gel electrophoresis of these amplicons did not allow discrimination between T. rangeli genetic groups, sequencing of PCR products revealed GSPs in both regions. These polymorphisms were previously detected in T. rangeli (Ferreira et al. 2014), although in other genomic loci. Similarly to the preceding report, GSPs detected in T. rangeli allowed the classification of two groups coincident with KP1(+) and KP1(−) genetic groups (Vallejo et al. 2002).

In T. rangeli, fewer genomic regions were analyzed when compared with other trypanosomatids. Regarding ribosomal DNA (rDNA) scrutiny, only ITS (Beltrame-Botelho et al. 2005) or a variable domain in the LSU (Souto et al. 1999) were described as molecular targets for interspecific discrimination. Even though the rDNA is a valuable target for inter or intraspecific analysis, given its abundance in the genome (de Arruda et al. 1990, Souto et al. 1996), other targets were exploited in the last years, like the mini-exon genes (Murthy et al. 1992, Grisard et al. 1999, Urrea et al. 2005), telomeric sequences (Chiurillo et al. 2003, Ferreira et al. 2014), a combination of spliced-leader genes, and small subunit from rDNA (Maia da Silva et al. 2009) or DNA content analysis (Naves et al. 2017).

More recently, pan-organism PCR targeting the 28S LSU was reported to diagnose a human case of retinitis associated with T. cruzi infection (Conrady et al. 2018). Besides, characterization of trypanosomatid diversity in bats using 18S gene (Dario et al. 2017, Bento et al. 2018) enlightens the importance of rDNA analysis to elucidate infection cases or characterization.

Interestingly, two GSPs found within the same region (Trβ2) generated different endonuclease sites, allowing discrimination between KP1(+) and KP1(−) T. rangeli strains using PCR-RFLP technique. Therefore, using DNA sequencing or PCR-RFLP, intraspecific differentiation could be achieved. Experimental comparison of T. rangeli and T. cruzi total rRNA subunits exhibited differences between these two species especially regarding 18S rRNA, which in T. rangeli presented ∼1.5 kb and in T. cruzi presented ∼2.0 kb.

Further investigation by multiple sequence analysis confirmed dissimilarities in genes of ribosomal locus when other trypanosomatids were also included. PCR of Trβ1 region endorsed these observations, when interspecific discrimination (T. rangeli × T. cruzi) were achieved experimentally for T. cruzi JG strain (TcII) and by bioinformatics analysis for different T. cruzi lineages, such as T. cruzi strain Sylvio (TcI), strain La Cruz (TcI), and strain CL Brener (TcVI). Also, PCR-RFLP predictions of Trβ2 region were presented and other species could be distinguished.

This set of experiments increases the current scenario for characterization and differentiation of T. rangeli genetic groups that besides rDNA analysis, include mini-exon PCR (Fernandas et al. 2001), electrophoretic analysis of kDNA and endonuclease digestion (Triana et al. 1999), cathepsin L-like proteases gene sequencing (Ortiz et al. 2009), and sequencing of chromosomal extremities (Cabrine-Santos et al. 2011), for example.

Conclusions

Inter and intraspecific distinction can be accomplished using PCR or PCR-RFLP of Trβ1 and Trβ2 regions, increasing the choice of molecular targets for discrimination between trypanosomatid species. The benefit of using these regions relies on the abundance of ribosomal locus, once it is organized in tandem repeats within the genome, making it more feasible to be detected. Also, using only one approach (PCR or PCR-RFLP) both inter or intraspecific differentiation is achievable.

Footnotes

Author Disclosure statement

All authors declare that they have no conflict of interest and that the experiments comply with the current laws in Brazil. No competing financial interests exist.

Funding Information

R.E.R.S.S. was supported by BIC-FAPEMIG (Bolsa de Iniciação Científica Institucional–Fundação de Amparo à Pesquisa do Estado de Minas Gerais).

Supplementary Material

Supplementary Figure S1

References

Andrade

, Machado

, Chiari

, Pena

, Macedo

. Differential tissue distribution of diverse clones of Trypanosoma cruzi in infected mice. Mol Biochem Parasitol, 1999; 100:163–172.

Altschul

, Gish

, Miller

, Myers

, et al. Basic local alignment search tool. J Mol Biol, 1990; 215:403–410.

Bargues

, Marcilla

, Dujardin

, Mas-Coma

. Triatomine vectors of Trypanosoma cruzi: A molecular perspective based on nuclear ribosomal DNA markers. Trans R Soc Trop Med Hyg, 2002; 96 Suppl 1:S159–S164.

Beltrame-Botelho

, Gaspar-Silva

, Steindel

, Dávila

, et al. Internal transcribed spacers (ITS) of Trypanosoma rangeli ribosomal DNA (rDNA): A useful marker for inter-specific differentiation. Infect Genet Evol, 2005; 5:17–28.

Bento

, Gómez-Hernández

, Batista

, Anversa

, et al. Identification of bat trypanosomes from Minas Gerais state, Brazil, based on 18S rDNA and Cathepsin-L-like targets. Parasitol Res, 2018; 117:737–746.

Caballero

, Sousa

, Marques

, Saez-Alquezar

, et al. Evaluation of serological tests to identify Trypanosoma cruzi infection in humans and determine cross-reactivity with Trypanosoma rangeli and Leishmania spp . Clin Vaccine Immunol, 2007; 14:1045–1049.

Cabrine-Santos

, Ferreira

KAM

, Tosi

LRO

, Lages-Silva

, et al. Karyotype variability in KP1(+) and KP1(−) strains of Trypanosoma rangeli isolated in Brazil and Colombia. Acta Trop, 2009; 110:57–64.

Cabrine-Santos

, Ramírez

, Lages-Silva

, de Souza

, et al. Sequencing and analysis of chromosomal extremities of Trypanosoma rangeli in comparison with Trypanosoma cruzi lineages. Parasitol Res, 2011; 108:459–466.

Calzada

, Pineda

, Montalvo

, Alvarez

, et al. Human trypanosome infection and the presence of intradomicile Rhodnius pallescens in the western border of the Panama Canal, Panama. Am J Trop Med Hyg, 2006; 74:762–765.

10.

Chiurillo

, Crisante

, Rojas

, Peralta

, et al. Detection of Trypanosoma cruzi and Trypanosoma rangeli infection by duplex PCR assay based on telomeric sequences. Clin Diagn Lab Immunol, 2003; 10:775–779.

11.

Conrady

, Hanson

, Mehra

, Carey

, et al. The First Case of Trypanosoma cruzi–Associated Retinitis in an Immunocompromised Host Diagnosed With Pan-Organism Polymerase Chain Reaction. Clin Infect Dis, 2018; 18:141–143.

12.

Coura

, Fernandes

, Arboleda

, Barret

, et al. Human infection by Trypanosoma rangeli in the Brazilian Amazon. Trans R Soc Trop Med Hyg, 1996; 90:278–279.

13.

Dario

, Moratelli

, Schwabl

, Jansen

, et al. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats. PLoS Negl Trop Dis, 2017; 11:e0005790.

14.

de Arruda M

, Reinach

, Colli

, Zingales

. Sequence of the 24S alpha ribosomal RNA gene and characterization of a corresponding pseudogene from Trypanosoma cruzi . Mol Biochem Parasitol, 1990; 40:35–41.

15.

de Moraes

, Guarneri

, Girardi

, Rodrigues

, et al. Different serological cross-reactivity of Trypanosoma rangeli forms in Trypanosoma cruzi-infected patients sera. Parasit Vectors, 2008; 1:20.

16.

Fernandas

, Santos

, Cupolillo

, Mendonça

, et al. A mini-exon multiplex polymerase chain reaction to distinguish the major groups of Trypanosoma cruzi and T. rangeli in the Brazilian Amazon. Trans R Soc Trop Med Hyg, 2001; 95:97–99.

17.

Ferreira

KAM

, Fajardo

, Baptista

, Macedo

, et al. Species-specific markers for the differential diagnosis of Trypanosoma cruzi and Trypanosoma rangeli and polymorphisms detection in Trypanosoma rangeli . Parasitol Res, 2014; 113:2199–2207.

18.

Ferreira

KAM

, Lemos-Júnior

PES

, Lages-Silva

, Ramírez

, et al. Human urine stimulates in vitro growth of Trypanosoma cruzi and Trypanosoma rangeli . Parasitol Res, 2007; 101:1383–1388.

19.

Grisard

, Campbell

, Romanha

. Mini-exon gene sequence polymorphism among Trypanosoma rangeli strains isolated from distinct geographical regions. Parasitology, 1999; 118:375–382.

20.

Guhl

, Hudson

, Marinkelle

, Jaramillo

, et al. Clinical Trypanosoma rangeli infection as a complication of Chagas' disease. Parasitology, 1987; 94:475–484.

21.

Guhl

, Vallejo

. Trypanosoma (Herpetosoma) rangeli Tejera, 1920: An updated review. Mem Inst Oswaldo Cruz, 2003; 98:435–442.

22.

Lages-Silva

, Crema

, Ramírez

, Macedo

, et al. Relationship between Trypanosoma cruzi and human chagasic megaesophagus: Blood and tissue parasitism. Am J Trop Med Hyg, 2001; 65:435–441.

23.

Maia da Silva

, Marcili

, Lima

, Cavazzana

Jr , et al. Trypanosoma rangeli isolates of bats from Central Brazil: Genotyping and phylogenetic analysis enable description of a new lineage using spliced-leader gene sequences. Acta Trop, 2009; 109:199–207.

24.

Marquez

, Ramírez

, Moreno

, Pedrosa

, et al. Trypanosoma rangeli: RAPD-PCR and LSSP-PCR analyses of isolates from southeast Brazil and Colombia and their relation with KPI minicircles. Exp Parasitol, 2007; 117:35–42.

25.

Murthy

, Dibbern

, Campbell

. PCR amplification of mini-exon genes differentiates Trypanosoma cruzi from Trypanosoma rangeli . Mol Cell Probes, 1992; 6:237–243.

26.

Naves

, da Silva

, Fajardo

, da Silva

, et al. DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli . PLoS One, 2017; 12:e0189907.

27.

Ortiz

, Maia da Silva

, Cortez

, Lima

, et al. Genes of cathepsin L-like proteases in Trypanosoma rangeli isolates: Markers for diagnosis, genotyping and phylogenetic relationships. Acta Trop, 2009; 112:249–259.

28.

Peacock

, Seeger

, Harris

, Murphy

, et al. Comparative genomic analysis of three Leishmania species that cause diverse human disease. Nat Genet, 2007; 39:839–847.

29.

Ramírez

, Cura

, da Cruz Moreira

, Lages-Silva

, et al. Analytical validation of quantitative real-time PCR methods for quantification of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. J Mol Diagn, 2015; 17:605–615.

30.

Ramirez

, Lages-Silva

, Alvarenga-Franco

, Matos

, et al. High prevalence of Trypanosoma rangeli and Trypanosoma cruzi in opossums and triatomids in a formerly-endemic area of Chagas disease in Southeast Brazil. Acta Trop, 2002; 84:189–198.

31.

Saldaña

, Samudio

, Miranda

, Herrera

, et al. Predominance of Trypanosoma rangeli infection in children from a Chagas disease endemic area in the west-shore of the Panama canal. Mem Inst Oswaldo Cruz, 2005; 100:729–731.

32.

Schijman

. Molecular diagnosis of Trypanosoma cruzi . Acta Trop, 2018; 184:59–66.

33.

Seiringer

, Pritsch

, Flores-Chavez

, Marchisio

, et al. Comparison of four PCR methods for efficient detection of Trypanosoma cruzi in routine diagnostics. Diagn Microbiol Infect Dis, 2017; 88:225–232.

34.

Sievers

, Wilm

, Dineen

, Gibson

, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol, 2011; 7:539.

35.

Silva

LHP

and Nussenzweig

. Sobre uma cepa de Trypanosoma cruzi altamente virulenta para o camundongo branco. Folia Clónica e Biológica, 1953, 20:191–208.

36.

Souto

, Fernandes

, Macedo

, Campbell

, et al. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi . Mol Biochem Parasitol, 1996; 83:141–152.

37.

Souto

, Vargas

, Zingales

. Trypanosoma rangeli: Discrimination from Trypanosoma cruzi based on a variable domain from the large subunit ribosomal RNA gene. Exp Parasitol, 1999; 91:306–314.

38.

Stoco

, Wagner

, Talavera-Lopez

, Gerber

, et al. Genome of the avirulent human-infective trypanosome—Trypanosoma rangeli . PLoS Negl Trop Dis, 2014; 8:e3176.

39.

Triana

, Jaramillo

, Moreno

. Genetic variability of Colombian populations of Trypanosoma cruzi and Trypanosoma rangeli . Biol Res, 1999; 32:1–10.

40.

Urrea

, Carranza

, Cuba

CAC

, Gurgel-Gonçalves

, et al. Molecular characterisation of Trypanosoma rangeli strains isolated from Rhodnius ecuadoriensis in Peru, R. colombiensis in Colombia and R. pallescens in Panama, supports a co-evolutionary association between parasites and vectors. Infect Genet Evol, 2005; 5:123–129.

41.

Vallejo

, Guhl

, Carranza

, Lozano

, et al. kDNA markers define two major Trypanosoma rangeli lineages in Latin-America. Acta Trop, 2002; 81:77–82.

42.

Vallejo

, Guhl

, Chiari

, Macedo

. Species specific detection of Trypanosoma cruzi and Trypanosoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Trop, 1999; 72:203–212.

43.

Vallejo

, Guhl

, Schaub

. Triatominae–Trypanosoma cruzi/T. rangeli: Vector–parasite interactions. Acta Trop, 2009; 110:137–147.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

7.04 MB

0.00 MB