The Prevalence of Tick-Borne Pathogens in Ticks Collected from the Northernmost Province (Sinop) of Turkey

Abstract

Ixodes ricinus is a potential vector for some of the tick-borne microorganisms that can cause significant diseases in animals and humans. This study aims to determine the prevalence of Anaplasma, Rickettsia, Bartonella, and Francisella species in host-seeking ticks collected from the forest areas in the Sinop region located in the northernmost part of Turkey. Between May and July 2017, a total of 135 tick pools formed from 2571 of the 2734 ticks collected out of the vegetation. Samples of each pool were homogenized and analyzed by PCR. Infection prevalence was statistically analyzed in view of the maximum likelihood estimation (MLE) with a 95% confidence interval (CI). DNA of the infectious agents was determined only in the adult and nymph pools of I. ricinus. MLE values of Anaplasma spp. and Bartonella spp. in 58 pools formed from 517 of I. ricinus adults were 1.20% (95% CI: 0.50–2.49) and 0.80% (95% CI: 0.26–1.91), respectively. In 42 pools generated from 1222 of I. ricinus nymph, MLE values of infection prevalence for Anaplasma spp. and Bartonella spp. were calculated to be 0.17% (95% CI: 0.03–0.54) and 0.34% (95% CI: 0.11–0.82) in respective order. MLE values for Rickettsia spp. were 7.55% (95% CI: 5.21–10.69) and 0.52% (95% CI: 0.22–1.083) for the adult and nymph I. ricinus, respectively. The DNA of Francisella tularensis was not detected in any tick pool. The outcomes of this research are the first molecular evidence of Bartonella spp. and Bartonella henselae in questing I. ricinus in Turkey. The results also suggested that I. ricinus plays considerable roles in enzootic transmission cycles of Anaplasma phagocytophilum, B. henselae, and Rickettsia monacensis in the northernmost region of Turkey.

Introduction

Ticks act as vectors for pathogenic microorganisms in a much higher variety than other arthropod vectors. Ixodid ticks are the primary vectors for many bacterial infectious agents such as Anaplasma spp., Borrelia spp., Rickettsia spp., and Coxiella burnetii (Parola and Raoult 2001).

The species belonging to genus Anaplasma, Rickettsia, Bartonella, and Francisella are obligate or facultative intracellular microorganisms. The many species within the genus Anaplasma cause anaplasmosis in humans and a considerable number of animals. Anaplasma phagocytophilum infects human granulocytes and causes human granulocytic anaplasmosis (Jin et al. 2012). Ixodes scapularis and Ixodes pacificus in America, Ixodes ricinus in Europe and Asia, and Ixodes persulcatus in Asia act as vectors in the enzootic cycle of A. phagocytophilum. However, A. phagocytophilum DNA was also detected in a few of different tick species out of genus Ixodes, too (Parola and Raoult 2001, Jin et al. 2012). Until recent years, Rickettsia conorii was considered to be the most common tick-borne rickettsiosis in Europe. After that, new tick-borne human rickettsiosis agents including Rickettsia monacensis and Rickettsia slovaca have been identified in Europe (Jado et al. 2007). R. monacensis was first isolated from I. ricinus in Germany and in many European countries thereafter (Parola et al. 2013, Morganti et al. 2017). Bartonella infections in humans are generally caused by Bartonella henselae, Bartonella quintana, and Bartonella bacilliformis. The primary reservoirs of B. henselae are wild and domestic cats, and their main vectors are cat fleas. B. henselae DNA was detected from I. persulcatus in North America and I. ricinus and Dermacentor spp. in Europe (Angelakis et al. 2010, Breitschwerdt 2014). Francisella tularensis causing tularemia in humans and animals has been isolated from I. ricinus, Dermacentor reticulatus, and Dermacentor marginatus in Europe (Maurin and Gyuranecz 2016).

I. ricinus is a tick species found in many climatic regions of Turkey, particularly in coastal areas (Aydin and Bakirci 2007, Aktas et al. 2010), and is the most common species in the forests and shrubs in the Sinop region (Gunes et al. 2007). The objective of this investigation was to reveal the prevalence of Anaplasma spp., Bartonella spp., Rickettsia spp., and Francisella spp. in I. ricinus collected from woodland and bush areas in Sinop located in the northernmost region of Turkey.

Materials and Methods

Field studies

Sinop province is located in the coastline of the Middle Black Sea Region (41–42° N lat, long 34–35° F) of Turkey. Precipitations are observed in Sinop in all seasons so that the average rainfall in the coastline is 679–1077 mm. Average temperatures are 20°C in summer and 7°C in winter. The region is covered with rich forests and vegetation that accommodate animals such as many rodent species, deer, wild boars, badger, squirrel, bears, and foxes, which serve as hosts for ticks and reservoirs for tick-borne microorganisms (Special Provincial Administration, Anonymus, 2019).

Collection and typing of tick specimens

The tick collection was performed from forest areas of 20 different regions of Sinop between May and July 2017 (Fig. 1). Ticks were collected from tree leaves, grass, and bushes in forest areas by blanket dragging (100 × 140 cm). The blanket was inverted in every 5–7 meters and carefully examined for ticks. Each tick clinging onto the blanket was collected with forceps and placed in Eppendorf tubes (0.5–1 mL) containing 96% ethyl alcohol. The samples were stored in a refrigerator at +4°C until identification. All tick samples were examined under the stereomicroscope and identified at species level using the reference key (Nosek and Sixl 1972, Filippova 1977, Estrada-Pena et al. 2004, 2017).

FIG. 1.

Map of Europe showing the location of Sinop and sampling sites from which ticks were collected from vegetation.

A total of 135 tick pools were formed from 2571 of the ticks collected out of the vegetation according to its collection region, gender, and life-stage attributes (adult, larvae, and nymphs). The number of samples in each pool was 3–10 for the adults, 18–40 for the nymphs, and 50–60 for the larvae as previously reported (Aktas et al. 2010, Noh et al. 2017).

Homogenization and DNA isolation of tick samples

Grouped tick samples were homogenized by crushing in 1.5 mL volume Eppendorf tubes by using sterile glass sticks. DNA was isolated from homogenized tick samples using GeneJET Genomic DNA Purification Kit (Thermo Scientific, Waltham, MA) according to the manufacturer's instructions. Isolated DNA samples were stored at −20°C until the study was performed.

PCR study

In this study, the conventional PCR method was used to determine tick-borne bacterial pathogens (Rickettsia spp., Bartonella spp., Ehrlichia/Anaplasma spp., and F. tularensis). Detailed information on the primers used in the study is given in Table 1. The PCR products were electrophoresed on 1% agarose gel containing ethidium bromide (10 mg/mL) and visualized by a computerized gel imaging system (Vilbert Lourmat Photo Documentation and Imaging Systems).

Table 1.

The Primers of Rickettsia spp., Bartonella spp., Ehrlichia/Anaplasma spp., and Francisella tularensis Used in the Study

Pathogen	Target gene	Primer name	Primer sequences (5′→3′)	AZ (bp)	Tm (°C)	PC (μM)	References
Rickettsia spp.	OmpA	Rr 190.70p	ATGGCGAATATTTCTCCAAAA	629–632	55	0.4	Roux et al. (1996)
Rickettsia spp.	OmpA	Rr 190.701	GTTCCGTTAATGGCAGCATCT	629–632	55	0.4	Roux et al. (1996)
Bartonella spp.	16S-23S rRNA	Forward	(C/T)CTTCGTTTCTCTTTCTTCA	154–260	55	1	Jensen et al. (2000)
Bartonella spp.	16S-23S rRNA	Reverse	AACCAACTGAGCTACAAGCC	154–260	55	1	Jensen et al. (2000)
Ehrlichia/Anaplasma spp.	16S rRNA	ge9f	AACGGATTATTCTTTATAGCTTGCT	546	56	0.4	Massung et al. (1998)
Ehrlichia/Anaplasma spp.	16S rRNA	ge2	GGCAGTATTAAAAGCAGCTCCAGG	546	56	0.4	Massung et al. (1998)
F. tularensis	TUL4	Tul4-435	GCT GTA TCA TCA TTT AAT AAA CTG CTG	420	64	0.4	Sjöstedt et al. (1997)
F. tularensis	TUL4	Tul4-863	TTG GGA AGC TTG TAT CAT GGC ACT	420	64	0.4	Sjöstedt et al. (1997)

AZ, amplicon size; PC, primer conc; TM, annealing temperature.

Sequence analysis and phylogenetic analysis

Sequence analysis was performed on 13 of PCR-positive samples by a commercial firm (MG Bioinformatic, Turkey). Random samples were selected for sequence analysis from samples showing clean bands on gel electrophoresis for each pathogen tested. The amplified product was purified using the QIAquick^® Extraction Kit (Qiagen GmbH). Purified DNA was sequenced using the BigDye^® Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). Automated fluorescence sequencing was performed with an ABI PRISM^® 3100 Genetic Analyzer (Applied Biosystems).

The sequence data obtained in this study have been deposited in the GenBank under the accession numbers MK203086–93 for Rickettsia spp., MK177557–59 for Ehrlichia/Anaplasma spp., and MK182391–92 for Bartonella spp. BLAST database was used to evaluate the similarity between the sequences obtained in this study and the sequence available in the GenBank database.

Statistics

The infection rate in tick samples was calculated using the maximum likelihood estimation (MLE) method in a 95% confidence interval (CI) for the unequal pool size and expressed as MLE of infection rate of each 100 ticks (Biggerstaff 2009). The infectivity rates were evaluated using Fisher's exact test, considering p = 0.05 as threshold for the two-sided statistical significance.

Results

The distributions in species level of ticks and the prevalence of tick-borne pathogens are shown in Table 2. The DNA of Anaplasma spp., Rickettsia spp., and Bartonella spp. was determined only for adult and nymph forms of I. ricinus among 135 pools. The tick-borne pathogens' DNA was not detected in larvae I. ricinus, adults Haemaphysalis inermis, and Rhipicephalus turanicus. The DNA of F. tularensis was not detected in any of the 135 tick pools (Table 2).

Table 2.

The Maximum Likelihood Estimation Values of the Prevalence of Anaplasma spp., Rickettsia spp., and Bartonella spp. in Tick Species Collected from Sinop Region, Turkey

Tick species	Coll^*	No. of examined ticks (No. of pools)	Anaplasma spp.		Rickettsia spp.		Bartonella spp.
Tick species	Coll^*	No. of examined ticks (No. of pools)	+P (%)	MLE (95% CI)	+P (%)	MLE (95% CI)	+P (%)	MLE (95% CI)
Ixodes ricinus
Female	290	270 (31)	2	0.75 (0.14–2.44)	16	7.99 (4.83–12.69)	2	0.75 (0.14–2.47)
Male	270	247 (27)	4	1.70 (0.56–4.05)	13	6.91 (3.91–11.54)	2	0.83 (0.15–2.70)
F+M	560	517 (58)		1.20 (0.50–2.49)		7.55 (5.21–10.69)		0.80 (0.26–1.91)
Nymph	1311	1222 (42)	2	0.17 (0.03–0.54)	6	0.52 (0.22–1.083)	4	0.34 (0.11–0.82)
Larvae	641	622 (12)	0	0	0	0	0	0
Total	2512	2361 (112)	8	0.34 (0.16–0.65)	35	1.62 (1.18–2.18)	8	0.35 (0.16–0.66)
Haemaphysalis inermis
Female	119	113 (12)	0	0	0	0	0	0
Male	95	89 (9)	0	0	0	0	0	0
Total	214	202 (21)	0	0	0	0	0	0
Rhipicephalus turanicus
Female	5	5 (1)	0	0	0	0	0	0
Male	3	3 (1)	0	0	0	0	0	0
Total	8	8 (2)	0	0	0	0	0	0
Grand total	2734	2571 (135)	8	0.32 (0.15–0.59)	35	1.47 (1.07–1.99)	8	0.32 (0.15–0.60)

Coll^*, number of collected ticks; MLE, maximum likelihood estimation; CI, confidence intervals; F+M, female+male; +P, positive pools.

Of the 58 pools representing the adult of I. ricinus, 6 pools were found to be positive with Anaplasma spp. and 4 pools were infected with Bartonella spp., and the rates of infection as MLE were determined to be 1.20 (95% CI: 0.50–2.49) and 0.80 (95% CI: 0.26–1.91), respectively. For the 42 pools containing the nymphs of I. ricinus, the infection rates (MLE) of Anaplasma spp. and Bartonella spp. were 0.17 (95% CI: 0.03–0.54) and 0.34 (95% CI: 0.11–0.82), respectively. When the inter-comparison was made for MLE values found for each parameter by “Fisher's exact test”, the prevalences of Anaplasma spp. in adults of I. ricinus were higher than those in nymphs (p = 0.02), but the difference between adults and nymphs was not significant for Bartonella spp. (p = 0.4).

The OmpA gene allows detecting spotted fever group rickettsiae except for Rickettsia helvetica, Rickettsia akari, Rickettsia australis, and Rickettsia bellii (Roux et al., 1996). Therefore, the prevalences of these pathogens were not included in the prevalence of Rickettsia spp. obtained in the present study. According to the OmpA gene, 29 pools of adult I. ricinus and 6 pools of the nymphs were infected with Rickettsia spp., and infection rates as MLE were 7.55 (95% CI: 5.21–10.69) and 0.52 (95% CI: 0.22–1.083), respectively. The prevalence of Rickettsia spp. in adult I. ricinus was higher than its nymphs (p = 0.0001).

Co-positivity of Rickettsia spp. and Anaplasma spp. was observed in two pools of adult I. ricinus (MLE: 0.039, 95% CI: 0.007–0.128), and the co-positivity of Rickettsia and Bartonella spp. was observed in one pool (MLE: 0.019, 95% CI: 0.001–0.094). No pools infected with both Anaplasma spp. and Bartonella spp. were found (Table 3). In nymphs of I. ricinus, two pools were co-positive (MLE: ∼0.006, 95% CI: ∼0.001–0.019) as regard Rickettsia spp. and Bartonella spp., but there was no co-positive pool between Anaplasma spp. with Rickettsia spp. and Anaplasma spp. with Bartonella spp.

Table 3.

Coinfections, Single and Total Infection Between Anaplasma spp., Rickettsia spp., and Bartonella spp. in 517 (58 Pools) of Adult I. ricinus

Infection forms in I. ricinus pools	N.T (N.P)	P.P	MLE (95% CI)
Single infection
Anaplasma spp.	517 (58)	4	0.788 (0.258–1.882)
Rickettsia spp.	517 (58)	26	6.474 (4.372–9.320)
Bartonella spp.	517 (58)	3	0.591 (0.156–1.597)
Total infections
Anaplasma spp. or Rickettsia spp.	517 (58)	33	9.136 (6.461–12.688)
Rickettsia spp. or Bartonella spp.	517 (58)	32	8.754 (6.152–12.219)
Bartonella spp. or Anaplasma spp.	517 (58)	10	2.087 (1.074–3.699)
Anaplasma spp. or Rickettsia spp. or Bartonella spp.	517 (58)	36	10.545 (7.565–14.498)
Coinfections^*
Anaplasma spp. and Rickettsia spp.	517 (58)	2	0.039 (0.007–0.128)
Rickettsia spp. and Bartonella spp.	517 (58)	1	0.019 (0.001–0.094)
Bartonella spp. and Anaplasma spp.	517 (58)	0	0.000 (0.000–0.072)
Anaplasma spp. and Rickettsia spp. and Bartonella spp.	517 (58)	0	0.000 (0.000–0.072)

N.T, no. of ticks; N.P, no. of pools; P.P, positive pool; MLE, maximum likelihood estimation; CI, confidence intervals.

Coinfections^*: To calculate the coinfection, the MLE of coinfection between two infection agents was multiplied by 0.1 because size of coinfected pools were 10 ticks.

In view of nucleotide BLAST, R. monacensis strains in this study are concordant with the R. monacensis isolate 165 I. ricinus/Corum (99% identity, accession number MF383610), which was isolated from ticks of I. ricinus collected from humans in Corum (about 270 km south of Sinop). It was also 100% identical with the R. monacensis strain IrR/Munich complete genome (accession number LN794217).

BLAST analysis showed that Ehrlichia/Anaplasma strains of Sinop samples were 99% identical with A. phagocytophilum isolate Trbrt45 (accession number KP745629), which was isolated from cattle in Turkey. The strains were also identical 98–99% with uncultured Anaplasma spp. clone H151 (accession number FJ172530), which was isolated from ticks of I. ricinus removed from humans living in three provinces (Giresun, Trabzon, and Rize) in the east of the Black Sea Region of Turkey.

In this study, Bartonella spp. sequences in Sinop samples (accession numbers MK182391–92) were 96% identical with uncultured Bartonella spp. clone 199B/Haemaphysalis parva Sivas (accession number MK178559), uncultured Bartonella spp. clone 157B/D. marginatus Sivas (accession number MK178556), and uncultured Bartonella spp. clone 197B/H. parva Sivas (accession number MK178558). At the same time, there was 96% similarity with the B. henselae strain Inha1, Korea (accession number JQ638927).

Discussion

Vegetation, the amount of water in the soil, the humidity of the air, and altitude in a geographic region are the factors determining the distribution of ticks in that region. Especially deciduous forest and bush areas are suitable for I. ricinus (Pfäffle et al. 2013).

In this study, I. ricinus was the most common (71.62%) among the collected ticks from the forest areas of the studied region. The DNA of Anaplasma spp., Rickettsia spp., and Bartonella spp. was determined in the adults and nymphs of I. ricinus. The results of sequence analyses indicated that A. phagocytophilum, R. monacensis, and B. henselae had remarkable contributions to the corresponding prevalence levels of Anaplasma spp., Rickettsia spp., and Bartonella spp., respectively.

The prevalence of A. phagocytophilum in the genus Ixodes ranges from 0% to 67% depending on the geographic regions (Adelson et al. 2004, Milutinović et al. 2008). The prevalences of Anaplasma spp. detected in adults (1.2%) and nymphs (0.17%) of I. ricinus in this work were lower than the results presented in previous investigations in Europe and Turkey (Milutinović et al. 2008, Aktas et al. 2010, Morganti et al. 2017). In the same city where this study was performed, Gunes et al. (2011) found antibody positivity against A. phagocytophilum in 10.62% of the people from the risk group. The comparison of the above-mentioned high antibody positivity with the low prevalence of Anaplasma spp. (0.17–1.2%) in I. ricinus suggests that some people living in rural areas might be exposed to tick bites repeatedly.

The prevalence of R. monacensis and R. helvetica in I. ricinus varies between 1% and 53% (Gargili et al. 2012, Overzier et al., 2013, Minichová et al. 2017, Morganti et al. 2017). In the current study, in view of the OmpA gene sequences, the most likely Rickettsia species identified in I. ricinus is R. monacensis. In Europe, when considering the high prevalence of R. monacensis (1–53%) in I. ricinus, the seroprevalence of R. monacensis determined in humans and animals is considerably low according to other Rickettsia species (Wächter et al. 2015).

I. ricinus has been shown to have vector capacity for B. henselae (Cotté et al. 2008). However, the extent of the role of ticks in the enzootic cycle of B. henselae is not yet fully established. The prevalence of B. henselae varies within the range of 1.2–40% in I. ricinus, I. persulcatus, and I. pacificus (Angelakis et al. 2010, Overzier et al. 2013, Zając et al. 2015). The findings of the present study are the first molecular evidence for the presence of Bartonella spp. and B. henselae in I. ricinus in Turkey. The result of this investigation showed that the prevalence (0.8%) of Bartonella spp. obtained from adults I. ricinus was remarkably low compared with many other countries (Overzier et al. 2013, Zając et al. 2015).

The prevalence of F. tularensis (0–3.8%) determined in ticks is considerably low than the prevalence of other tick-borne infections (Milutinović et al. 2008, Duzlu et al. 2016). It was confirmed in our study that F. tularensis infections in I. ricinus were probably in low levels in Sinop and similar climatic regions.

The prevalence of tick-borne microorganisms is the highest in adult ticks, lower in nymphal forms, and the lowest in larvae (Overzier et al. 2013, Zając et al. 2015, Minichová et al. 2017). The cause of infection in hungry tick larvae is due to transovarial transmission. We could not find any pathogen DNA of tested questing larvae, which supports the fact that transovarial transmission does not exist or is at negligible levels in A. phagocytophilum, R. monacensis, and B. henselae (Bakken and Dumler 2008, Cotté et al. 2008, Minichová et al. 2017).

Since I. ricinus is able of carrying many infectious agents such as Borrelia burgdorferi, A. phagocytophilum, Babesia spp., Rickettsia spp., and Bartonella spp., the presence of coinfection of these pathogens is also considerable (Adelson et al. 2004, Jin et al. 2012). In our study, the prevalence of Anaplasma spp. and Bartonella spp. determined at I. ricinus was even lower than coinfection level between A. phagocytophilum–Bo. burgdorferi, A. phagocytophilum–B. henselae found in many other studies (Derdakova et al. 2003, Stańczak et al. 2004). As seen in the present study, the prevalence of infection and coinfection in ticks in Sinop is low.

Conclusions

The prevalence of vectors and reservoirs plays an essential role in the enzootic cycle of tick-borne infectious agents in a geographic region. This study was the first molecular evidence for Bartonella spp. and B. henselae in ticks in Turkey and exhibited that the infections of tick-borne A. phagocytophilum, R. monacensis, and B. henselae were possible.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the Scientific Research Project Fund of Sivas Cumhuriyet University under the project number “SHMYO-012.”

References

Adelson

, Rao

, Tilton

, Cabets

, et al. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in Northern New Jersey. J Clin Microbiol, 2004; 42:2799–2801.

Aktas

, Vatansever

, Altay

, Aydin

, et al. Molecular evidence for Anaplasma phagocytophilum in Ixodes ricinus from Turkey. Trans R Soc Trop Med Hyg, 2010; 104:10–15.

Angelakis

, Billeter

, Breitschwerdt

, Chomel

, et al. Potential for tick-borne bartonelloses. Emerg Infect Dis, 2010; 16:385–391.

Aydin

, Bakirci

. Geographical distribution of ticks in Turkey. Parasitol Res, 2007; 101:63–166.

Bakken

, Dumler

. Human granulocytic anaplasmosis. Infect Dis Clin North Am, 2008; 22:433–448.

Biggerstaff

. PooledInfRate, Version 4.0: a Microsoft^® Office Excel© Add-In to compute prevalence estimates from pooled samples. Fort Collins, CO: Centers for Disease Control and Prevention, 2009.

Breitschwerdt

. Bartonellosis: One health perspectives for an emerging infectious disease. ILAR J, 2014; 55:46–58.

Cotté

, Bonnet

, Le

Rhun D

, Le

Naour E

, et al. Transmission of Bartonella henselae by Ixodes ricinus . Emerg Infect Dis, 2008; 14:1074–1080.

Derdakova

, Halanova

, Stanko

, Stefancikova

, et al. Molecular evidence for Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks from eastern Slovakia. Ann Agric Environ Med, 2003; 10:269–271.

10.

Duzlu

, Yildirim

, Inci

, Gumussoy

, et al. Molecular investigation of Francisella-like endosymbiont in ticks and Francisella tularensis in ixodid ticks and mosquitoes in Turkey. Vector Borne Zoonotic Dis, 2016; 16:26–32.

11.

Estrada-Pena

. Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species. Zaragoza: University of Zaragoza, 2004: 43–131.

12.

Estrada-Peña

, Pfäffle

, Petney

. (2017). Genus Ixodes Latreille, 1795. In: Estrada-Peña

, Mihalca

, Petney

(eds), Ticks of Europe and North Africa. Springer, Cham.

13.

Filippova

. (1977) Ixodid ticks (Ixodinae). Fauna USSR New Series, vol 4, pp 1–316 (in Russian).

14.

Gargili

, Palomar

, Midilli

, Portillo

, et al. Rickettsia species in ticks removed from humans in Istanbul, Turkey. Vector Borne Zoonotic Dis, 2012; 12:938–941.

15.

Gunes

, Ataş M, Poyraz Ö, Turgut N. The seroprevalence of Anaplasma phagocytophilum in humans from two different climatic regions of Turkey and its co-seroprevalence rate with Borrelia burgdorferi . Turk J Med Sci, 2011; 41:903–908.

16.

Gunes

, Kaya

, Poyraz

, Engin

. The Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks in the Sinop Region of Turkey. Turkish J Vet Anim Sci, 2007; 31:153–158.

17.

Jado

, Oteo

, Aldámiz

, Gil

, et al. Rickettsia monacensis. and human disease, Spain. Emerg Infect Dis. 2007, 13:1405–1407.

18.

Jensen

, Fall

, Rooney

, Kordick

, et al. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol, 2000; 38:1717–1722.

19.

Jin

, Wei

, Liu

, Qian

. Epidemiology and control of human granulocytic anaplasmosis: A systematic review. Vector Borne Zoonotic Dis, 2012; 12:269–274.

20.

Massung

, Slater

, Owens

, Nicholson

. Nested PCR assay for detection of granulocytic ehrlichiae. J Clin Microbiol, 1998; 36:1090–1095.

21.

Maurin

, Gyuranecz

. Tularaemia: Clinical aspects in Europe. Lancet Infect Dis, 2016; 16:113–124.

22.

Milutinović

, Masuzawa

, Tomanović

, Radulović

et al. Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Exp Appl Acarol, 2008; 45:171–183.

23.

Minichová

, Hamšíková

, Mahríková

, Slová

, et al. Molecular evidence of Rickettsia spp. in ixodid ticks and rodents in suburban, natural and rural habitats in Slovakia. Parasit Vectors, 2017; 10:158.

24.

Morganti

, Gavaudan

, Canonico

, Ravagnan

, et al. Molecular Survey on Rickettsia spp., Anaplasma phagocytophilum, Borrelia burgdorferi Sensu Lato, and Babesia spp. in Ixodes ricinus Ticks Infesting Dogs in Central Italy. Vector Borne Zoonotic Dis, 2017; 17:743–748.

25.

Noh

, Lee

, Kim

, Chong

, et al. Molecular detection of Rickettsia species in ticks collected from the southwestern provinces of the Republic of Korea. Parasit Vectors, 2017; 10:20. doi: 10.1186/s13071-016-1955-x.

26.

Nosek

, Sixl

. Central European ticks (Ixodoidea). Key for determination. Mitt Abt Zool Landesmuseum Joanneum Graz, 1972; 1:61–92

27.

Overzier

, Pfister

, Thiel

, Herb

, et al. Diversity of Babesia and Rickettsia species in questing Ixodes ricinus: A longitudinal study in urban, pasture, and natural habitats. Vector Borne Zoonotic Dis, 2013; 13:559–564.

28.

Parola

, Paddock

, Socolovschi

, Labruna

, et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin Microbiol Rev, 2013; 26:657–702.

29.

Parola

, Raoult

. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin Infect Dis, 2001; 32:897–928.

30.

Pfäffle

, Littwin

, Muders

, Petney

. The ecology of tick-borne diseases. Int J Parasitol, 2013; 43:1059–1077.

31.

Roux

, Fournier

, Raoult

. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol, 1996; 34:2058–2065.

32.

Sjöstedt

, Eriksson

, Berglund

, Tärnvik

. Detection of Francisella tularensis in ulcers of patients with tularemia by PCR. J Clin Microbiol, 1997; 35:1045–1048.

33.

Stańczak

, Gabre

, Kruminis-Łozowska

, Racewicz

, et al. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests. Ann Agric Environ Med, 2004; 11:109–114.

34.

Wächter

, Wölfel

, Pfeffer

, Dobler

, et al. Serological differentiation of antibodies against Rickettsia helvetica, R. raoultii, R. slovaca, R. monacensis and R. felis in dogs from Germany by a micro-immunofluorescent antibody test. Parasites Vectors, 2015; 8:126.

35.

Zając

, Wójcik-Fatla

, Dutkiewicz

, Szymańska

. Bartonella henselae in eastern Poland: The relationship between tick infection rates and the serological response of individuals occupationally exposed to tick bites. J Vector Ecol, 2015; 40:75–82.