Genetic Diversity and Coexistence of Babesia in Ticks (Acari: Ixodidae) from Northeastern China

Abstract

Background:

Human babesiosis is an emerging zoonotic disease transmitted by ticks in China. A few systematic reports on Babesia spp. was involved with ticks, especially in the human babesiosis endemic areas in Northeastern China.

Materials and Methods:

Ticks were collected from 30 individual waypoints along 2.0 km transects in two recreational forests. Babesia spp. infection in ticks was screened by amplifying the partial 18s rRNA gene with subsequent sequencing. Multivariate logistic regression analysis was used to determine the association between tick infection and related environmental risk factors. Cluster analyses were performed using SaTScan v6.0 software to identify any geographical cluster of infected ticks.

Results:

A total of 2380 Ixodes persulcatus and 461 Haemaphysalis concinna ticks were collected. Of the 0.97% of I. persulcatus ticks that tested positive, five Babesia species were identified, including B. bigemina (n = 6), B. divergens (n = 2), B. microti (n = 3), B. venatorum (n = 11), and one novel strain HLJ-8. Thirteen (2.92%) H. concinna ticks tested positive for B. bigemina (n = 1), B. divergens (n = 1), three genetic variants of Babesia represented by HLJ-874, which was closely related to Babesia sp.MA#361-1, and eight other Babesia variants represented by HLJ242, which were similar to B. crassa. Each study site had 5–6 different Babesia spp. One waypoint was more likely to yield B. venatorum (relative risk = 15.36, p = 0.045) than all other waypoints.

Conclusions:

There exists a high genetic diversity of Babesia spp. across a relatively small sampled region. Further study is needed to understand the risks these variants pose to human health.

Introduction

Babesiosis, caused by infection with intraerythrocytic parasites of the genus Babesia, is one of the most common infections of free-living animals globally. Cases of human babesiosis have been reported in Europe, Africa, Australia, South America, and Asia (Vannier and Krause 2012). More than 100 Babesia species have been documented in a wide variety of wild and domestic animals, some of which are known to infect humans. In America, Babesia microti is the most important causative agent of human babesiosis, followed by sporadic cases of B. duncani and B. divergens-like infections (Barbara et al. 2012). In Europe, the primary agent is B. divergens, but a small number of B. venatorum (formerly known as Babesia sp. EU1) patients have also been reported in Austria, Germany, and Italy (Herwaldt et al. 2003). B. microti-like organisms have been reported to cause human infection in Japan and Korea (Kim et al. 2007, Wei et al. 2001). In China, many Babesia parasite isolates, including B. bovis, B. equi, B. caballi, and B. gibsoni, have been documented in domestic animals (Xu et al. 2003; Liu et al. 2007). However, there have been relatively few studies focusing on human cases of babesiosis in China (Shih et al. 1997, Qi et al. 2011, Yao et al. 2012, Jiang et al. 2015), warranting additional efforts to study this neglected disease.

Besides through blood transfusion, the transmission of Babesia occurs primarily through tick bite. Ixodes ovatus, I. persulcatus, I. ricinus, and Haemaphysalis japonica in Asia were found to be mainly infected with Babesia microti, B. venatorum, B. divergens, and B. capreoli (Rar et al. 2010, Alexandru et al. 2011). In China, reports of Babesia spp. were recently detected in ticks and confirmed through genetic sequencing (Luo et al. 2002, Sun et al. 2008, Wei et al., 2016). In recent years, cases of probable or subclinical human babesiosis in patients reporting a recent tick bite have been recorded in Lyme disease-endemic areas of Northeastern China (Jiang et al. 2015). The similarity in symptoms and potential for misdiagnosis presents the possibility that the prevalence of Babesia is underestimated. In these areas, there is still a lack of detailed information on pathogenic or nonpathogenic Babesia spp. in ticks and humans. Thus, we conducted a 3-year longitudinal study to identify the prevalence, distribution, and molecular diversity of Babesia in sampled ticks, which was expected. What we found will be very helpful to understand these tick borne pathogenic agents' risks posed to human health.

Materials and Methods

Ticks collection

Host-seeking ticks were collected between April to July from 2010 to 2012 by flagging vegetation at 30 individual waypoints along a 2.0 km transect, respectively, at two recreational forested areas, Dashigou (E129°11′10″, N44°58′32″) and Heiniubei (E129°27′31″, N45°2′07″), both of which are located near Mudanjiang city in Heilongjiang province, about fifty kilometers apart. The spatial distribution of sample sites and collected ticks was mapped in ArcGIS 9.3 software (ESRI, Inc., Redlands, CA).

DNA extraction and amplification of Babesia parasites

Each tick was identified and then crushed individually in a sealed microcentrifuge tube with Buller Blender Homogenizer (Next Advance, Inc., NY). DNA was then extracted from tick homogenate using the Tissue DNA Extract Kit (Tiangen Biotechnique, Inc., Beijing, China) according to the manufacturer's instructions. PCR targeting the specific fragment encoding the partial 18S rRNA gene was performed with modified primers PIRO-A and PIRO-B to screen for Babesia spp. infection (Hilpertshauser et al. 2006). For Babesia spp. with unclear taxonomy based on the gene segment above, additional two pairs of designed primers (5′-GAAACTGCGAATGGCTCATTACAACA-3′ and 5′ CAACCGTTCCTATTAACCATTA-3′; 5′ TAATGGTTAATAGGAACGGTTG-3′ and 5′ CTACGGAAACCTTGTTACGACTT-3′) were used for the amplification of near-entire sequences of the 18S rRNA gene. The other two pairs of designed primer (5′ CTCGCGAATCGCAATTTA-3′ and 5′ ACAGACCTGTTATTGCCTTAC; 5′-AAATTAGCGAATCGCATGG-3′ and 5′-ACAG ACCTGTTATTGCCTTAC-3′) were used for amplification of entire sequences of the 18S rRNA of B. microti.

Sequencing and phylogenetic analysis of the Babesia parasites

The amplification product below 500 bp was sequenced directly. The long purified DNA fragments were cloned into the plasmid Promega pGEM^™-T (Thermo Fisher Scientific) vector and the nucleotide sequences of the plasmid inserts were determined using an automated DNA sequencer (3730 DNA Sequencer; Applied Biosystems). The alignment and assembly of sequences and construction of phylogenetic trees were performed using MEGA 5.0 software (Tamura et al. 2011).

Risk factors analyses

Univariate logistic analysis was conducted to determine the associations between the prevalence of Babesia spp. and sample sites, vector species, vector gender, forest stand composition, niche, elevation, location of hill, shape, direction and degree of slope, dominant/secondary tree, dominant/secondary shrub, and herbaceous plant grass. A p-value <0.05 was considered statistically significant. Odds ratios (ORs) were estimated by comparing infection status with suspected risk factors. Multivariate logistic analysis was then performed using variables with p-value <0.10 from the univariate analyses as covariates.

Spatial cluster analyses

Geographic cluster analyses of the positive ticks were performed using SaTScan v6.0 Software (www.satsan.org). SaTScan uses a circular window that moves through space to identify clusters. The window varied in size for up to 50% of the population tested, allowing for the identification of small and large clusters. A likelihood ratio test was conducted to determine whether there was an elevated prevalence of “cases,” or infected ticks, in one area compared to surrounding areas. Significance (set a priori at p < 0.05) was then calculated using Monte Carlo replicates.

Results

The prevalence of Babesia spp. in ticks

A total of 2380 questing adult I. persulcatus and 461 Haemaphysalis concinna ticks were collected from 60 waypoints in two field study sites. The annual prevalence of ticks for Babesia DNA ranged from 1.02% to 1.62% (Table 1). The prevalence of Babesia was 1.74% (24/1383) in Heiniubei and 0.82% (12/1458) in Dashigou, respectively (p = 0.04). The overall prevalence in I. persulcatus ticks was 0.97% with 23 positive ticks. Thirteen (2.81%) H. concinna ticks, including eight males and five females, contained Babesia DNA. The Babesia prevalence between the two tick species was significant (p = 0.001) (Table 2).

Table 1.

Population Index of Collected Ticks and Prevalence of the Agent of Babesia spp. in Ticks at Two Study Sites from 2010–2012

Year	Heiniubei (S1)			Dashigou (S2)			Total
Year	n	Prevalence (%)	Population index^a	n	Prevalence (%)	Population index	n	Prevalence (%)	Population index
2010	234	1.71	13.0	689	0.88	28.7	923	1.10	22.0
2011	591	2.03	16.4	536	1.16	29.7	1127	1.62	20.9
2012	558	1.43	18.6	233	0	7.7	791	1.02	13.2
Total	1383	1.74	16.5	1458	0.82	20.2	2841	1.27	18.2

Average number of ticks collected per hours from each person.

Table 2.

Results of PCR for Babesia spp. of Ticks at Two Study Sites

Study sites	No. of positive/no. of tested (%)
	Ixodes persulcatus			Haemaphysalis concinna			Total
	Male	Female	Total	Male	Female	Total	Total
Heiniubei (S1)	5/500 (1.0)	6/499 (1.2)	11/999 (1.10)	8/239 (3.35)	5/145 (3.45)	13/384 (3.39)	24/1383(1.74)	χ² = 4.72 p = 0.04
Dashigou (S2)	5/721 (0.69)	7/660 (1.06)	12/1381 (0.87)	0/44 (0.0)	0/33 (0.0)	0/77 (0.0)	12/1458(0.82)
Total	10/1221 (0.82)	13/1159 (1.12)	23/2380 (0.97)	8/283 (2.82)	5/178 (2.81)	13/461 (2.81)	36/2841 (1.27)
	χ² = 0.57 p = 0.53			χ² = 0.001 p = 0.99
χ² = 10.61 p = 0.001

Diversities of Babesia

Based on the ∼400 bp sequences recovered from 36 positive samples, some sequences were closely related to common species B. divergens isolate Nov-Ip316 GU057385), B. bigemina strain 563 (HQ840960), B. venatorum (GU734773), and B. microti (GU057383), respectively. The strain HLJ8 from one I. persulcatus had high variation (more than 8% difference) with our study samples and share 97% identities with Babesia motasi from sheep in Germany. The represented sequence HLJ874 from H. concinna was most closely related to Babesia sp. SAP#091 (Sapporo, Hokkaido, Japan) isolated from raccoons in Japan. The sequences from eight H. concinna ticks represented by HLJ242 had 2–7 bp differences at position 200–250 nt from Babesia crass detected in sheep in Iran (AY260176). I. persulcatus and H. concinna ticks can carry four and five species of Babesia spp., respectively. The species of Babesia carried by these two ticks had significant differences (p = 0.001), and showed high diversity, and to some extent vector tropism. Also, the two sites studied showed significant differences (p = 0.01) in the distribution of different kinds of Babesia spp. (Table 3). Through phylogenic analysis, the sequences from our study formed a closely related clade with B. venatorum (Babesia sp. EU1), B. microti, Babesia crass like, Babesia sp. MA361, B. bigemina, and B. divergens, respectively (Fig. 1A).

FIG. 1.

Phylogenetic tree based on partial (406–435 bp) (A) and near-entire 18s rRNA sequences (B) of Babesia spp. Phylogenetic trees were performed using MEGA 5.0 software by neighbor-joining method with Kimura 2-parameter analysis and bootstrap analysis of 1000 replicates. Numbers on the branches indicate percentage of replicates that reproduced the topology for each clade. Parentheses enclose GenBank numbers of the sequences used in the phylogenetic analysis. The asterisk (*) indicates novel sequences obtained from tick in this study. Scale bar indicates number of nucleotides per 1000 bp Babesia spp.

Table 3.

Results of Infected Ticks by Different Babesia species

Sample sites^a	Tick species^b	No. of tested	No. of positive
Sample sites^a	Tick species^b	No. of tested	Babesia bigemina	Babesia divergens	Babesia venatorum	Babesia microti	Babesia sp HLJ-8	Babesia sp. HLJ-874	Babesia sp HLJ-242	Total
Heiniubei	Ixodes persulcatus	999	3	0	8	0	0	0	0	11
Heiniubei	Haemaphysalis concinna	384	1	1	0	0	0	3	8	13
Dashigou	I. persulcatus	1381	3	2	3	3	1	0	0	12
Dashigou	H. concinna	77	0	0	0	0	0	0	0	0
Total		2841	7	3	11	3	1	3	8	36

χ² = 18.48 p = 0.01

χ² = 60.50 p = 0.001.

For the Babesia spp. samples, which had unclear taxonomy, and three B. microti-like samples, which had divergence from other known species in this study, nearly the entire 18s rRNA sequence of Babesia was analyzed. The 1600–1688 bp sequences of Babesia recovered from the HLJ48, HLJ223, HLJ231, and HLJ1002 were identical to each other, and had 2 nt difference at the 1277 and 1443 bp position with B. venatorum from patients. The 1605 near-entire rrs sequences of Babesia from the HLJ242, HLJ143, and HLJ199 had highest homology (97.5%) with B. crass (AY260176) in the GenBank. The sequences of HLJ874 showed the highest homology with Babesia sp. SAP091 from Japan. The HLJ72 also showed the highest homology with B. microti-Nov Ip307. The phylogenetic tree also showed the same topological graph (Fig. 1B) as the results with those based on 400 bp sequences.

Risk factors

Univariate logistic regression analysis indicated that ticks in Heiniubei sites had higher likelihood of infection when compared to Dashigou sites (OR = 2.13, 95% confidence interval [CI] = 1.06–4.27). H. concinna had higher likelihood of infection than I. persulcatus (OR = 2.97, 95% CI = 1.50–5.91). For Heiniubei sites, the forest stand composition, location on the hill, shape of slope, dominant grass, and endemic tick species were significantly correlated with Babesia infection in ticks (Table 4). Multivariate logistic regression analysis indicated that tick species (H. concinna, OR = 3.54, CI = 1.57–8.24, p = 0.003), shape of slope (concave slope, OR = 46.01, CI = 1.38–152.9, p = 0.03), and land-dominant grass (Equisetum ramosissimum, OR = 6.95, CI = 0.75–63.75, p = 0.046) were significantly associated with the prevalence of Babesia infection in ticks.

Table 4.

Results of Univariate Logistic Regression Analysis for Babesia Infection in Ticks from Heiniubei Site in Northeastern China

Variable	Prevalence % (positive/tested No.)	OR (95% CI)	p
Species			0.006
Ixodes persulcatus	1.10 (11/999)	1.00
Haemaphysalis concinna	3.50 (13/371)	3.15 (1.40–7.09)	0.006
Forest stand composition			0.030
Meadow	1.27 (1/79)	1.00
Theropencedrymion	1.64 (15/915)	2.29 (0.28–18.62)	0.437
Coniferous forest	1.80 (2/111)	1.65 (0.21–12.46)	0.629
Deciduous broadleaved forest	2.16 (6/278)	5.73 (0.70–46.71)	0.043
Niche			0.041
Border of forest	0.89 (6/675)	1.00
Undergrowth	2.70 (17/629)	3.09 (1.21–7.91)	0.18
Herbosa	1.27 (1/79)	1.43 (0.17–12.03)	0.742
Shape of slope			0.061
Harmonious slope	1.59 (14/879)	1.00
Concave slope	4.84 (6/124)	8.59 (1.02–72.31)	0.048
Convex slope	1.43 (3/210)	2.45 (0.25–23.76)	0.440
Convexoconcave slope	0.59 (1/170)	2.73 (0.36–20.94)	0.333
Dominant grass			0.043
Eriophorum sp.	0.45 (2/449)	1.00	0.467
Aegopodium alpestre	1.69 (1/59)	3.85 (0.34–43.16)	0.274
Brachybotrys paridiformis	1.82 (1/55)	4.13 (0.36–46.41)	0.249
Ranunculus repens	1.76 (3/170)	4.01 (0.67–24.24)	0.130
Matteuccia struthiopteris	2.03 (5/246)	4.63 (0.89–24.07)	0.068
Aralia elata(Miq.) seem	2.08 (1/48)	4.76 (0.43–53.43)	0.206
Adonis amurensis	2.68 (6/224)	6.15 (1.23–30.73)	0.027
Athyrium multdentatum	2.44 (1/41)	5.58 (0.49–62.97)	0.164
Equisetum ramosissimum	4.40 (4/91)	10.27 (1.85–56.91)	0.008

CI, confidence interval; OR, odds ratio.

Spatial distribution of collected ticks and positive samples

The total number of ticks that were collected per waypoint varied from 24 to 89 over 3 years of sampling. One waypoint in site Dashigou (Fig. 2A) and three waypoints in site Heiniubei (Fig. 2B) had positive samples for two continuous years. The remaining 15 positive waypoints were all randomly distributed over different years. However, the cluster analysis for data of site Dashigou by different Babesia species or variants demonstrated that there were significant clusters in each field, indicating a relative cluster distribution of positive ticks for B. venatorum and HLJ242-like variants (Fig. 2C). Positive ticks collected in this cluster (waypoint) were 15.36 times (relative risk = 15.36, p = 0.045) more likely to be infected with B. venatorum than those collected elsewhere in the transect area.

FIG. 2.

GIS mapping of the field site, total number of ticks collected at each 30 individual waypoints, and distribution of positive ticks in Dashigou (A) and Heiniubei (B), and predominantly Babesia spp. in this study (C). The size of the dot at each waypoint is proportional to the number of ticks at each site. Each tick that tested positive for Babesia spp. DNA by PCR from each waypoint was mapped. The size of the dot at each waypoint is proportional to the number of ticks at each site. The location of the cluster for Babesia venatorum and HLJ242-like variants is circled. Color images are available online.

Discussion

In this study, we examined Babesia spp. infections of 2841 ticks. Although the overall prevalence of Babesia (1.27%) is not high, at least seven Babesia species coexisted in these relatively small areas, which indicates that the discovered agents show genetic diversity and complexity, and are more widely distributed among ticks in Northeastern China than previously recognized. As the interface between humans and wildlife increases, humans may come into contact with these tick species more often, introducing greater risks to human health.

In our study, 0.46% of the examined I. persulcatus ticks were infected by B. venatorum. This Babesia species was first characterized from a few patients in Europe and then 48 cases in China (Herwaldt et al. 2003, Jiang et al. 2015), and has been identified in roe deer, wild cervids, migratory birds, and I. ricinus and I. persulcatus (Casati et al. 2006, Bonnet et al. 2007, Alexandru et al. 2011, Wei et al. 2016). Our finding is identical to the main species of Babesia recovered from the patients in these regions (Jiang et al. 2015), which showed that B. venatorum is a predominant Babesia species in I. persulcatus in these sampled areas. B. divergens was also detected for the first time in China in both tick species sampled for this study. This kind of protozoan has been found in two anemic patients from Shandong province, whose exposed history was not clear (Qi et al. 2011), which suggests there is likely another competent tick vector in Shandong province, since neither I. persulcatus nor H. concinna ticks have been reported in this region. The organism B. bigemina is thought to be transmitted by Rhipicephalus microplus, R. haemaphysaloides, and Haemaphysalis longicornis ticks, and is responsible for disease in dairy cattle, buffaloes, and dogs in southern China (Yin and Luo 2007). However, little information on B. bigemina in northeastern China is known. Our study demonstrates this organism is presented in both I. persulcatus and H. concinna, and given these two species often bite humans, the pathogenicity of this organism warrants further investigation.

The genetic variants of Babesia strico lato, represented by HLJ-874 strain from three H. concinna, were closely related to Babesia sp. SAP#091 isolated from a feral raccoon in Japan (Jinnai et al. 2009). The other genetic variants recovered from eight H. concinna ticks representing HLJ-242 strain were most similar to Babesia sp. Hj131 found in H. japonica tick from Khabarovsk Territory in Far East Russia. This was similar to the human Babesia crassa-like pathogen (KX590750) and ovine pathogen B. crassa (97%) (Rar et al. 2010). The genetic variant of Babesia strico lato, HLJ-8 strain recovered from I. persulcatus, was closely related to B. motasi (AY260180) isolated from a feral raccoon in Japan (Jinnai et al. 2009). It suggests that they are new variants/species or recordings in China. These results may indicate at least two yet undescribed Babesia species exist within these small natural foci.

I. persulcatus and H. concinna were infected with four or five disparate Babesia species, respectively, which may reflect differences in vector competence for each kind of Babesia parasite. This study also suggests heterogeneity in the spatial distribution of Babesia spp. in ticks at small scale. The two predominant ticks in these areas have relatively different habitats, which is likely responsible for the heterogeneous distribution observed in this study. This in turn likely contributes to differences in Babesia prevalence and species diversity. Infection with Babesia spp. in ticks occurred mainly in the Heiniubei study site, where more H. concinna found suitable habitats, such as E. ramosissimum grass on concave slope. The concave slope might be a more appropriate habitat for rodent reservoir hosts as a possible explanation for this association.

Based on geospatial analysis, we found a cluster distribution of positive ticks for B. venatorum and HLJ-242-like variants (Fig. 2C). Positive ticks collected in the cluster (waypoint 1) were 15.36 times (p = 0.045) more likely to be infected with B. venatorum than those collected elsewhere from the transect area. These findings are of importance for the assessment of regional and environmental risks of exposure for human babesiosis in northeastern China. Previous reports on natural foci of Babesia often comprised a larger scale. By means of a 3-year longitudinal study that mapped the location of ticks testing positive for Babesia DNA, we were able to identify small foci of transmission. Babesia foci may persist depending on transovarial and transstadial transmission within ticks, as well as stable infection in hosts.

Regardless, this study demonstrates a high level of genetically diverse Babesia within a small natural area, whose presence are of potential medical relevance for these sampled regions as well as other suburban forest where I. persulcatus and H. concinna ticks are reported.

Footnotes

Author Disclosure Statement

No conflicting financial interests exist.

Funding Information

This study was supported by State Key Research Development Program of China (2016YFC1201902) and Natural Science Foundation of China (81673235 and 81621005).

References

Alexandru

, Anna

, Reye

, Dubinina

, et al. Detection of Babesia sp. EU1 and members of spotted fever group rickettsiae in ticks collected from migratory birds at Curonian Spit, North-Western Russia. Vector Borne Zoonotic Dis, 2011; 11:89–91.

Barbara

, Herwaldt

, Susan Montgomery

, Dana Woodhall

, et al. Babesiosis surveillance—18 States, 2011. MMWR Morb Mortal Wkly Rep, 2012; 61:505–509.

Bonnet

, Jouglin

, L'Hostis

, Chauvin

. Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus . Emerg Infect Dis, 2007; 13:1208–1210.

Casati

, Sager

, Gern

, Piffaretti

. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med, 2006; 13:65–70.

Herwaldt

, Cacciò S, Gherlinzoni F, Aspöck H, et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis, 2003; 9:942–948.

Hilpertshauser

, Deplazes

, Schnyder

, Gern

, et al. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl Environ Microbiol, 2006; 72:6503–6507.

Jiang

, Zheng

, Jiang

, Li

, et al. Epidemiological, clinical, and laboratory characteristics of 48 cases of “Babesia venatorum” infection in China: A descriptive study. Lancet Infect Dis, 2015; 15:196–203.

Jinnai

, Kawabuchi-Kurata

, Tsuji

, Nakajima

, et al. Molecular evidence for the presence of new Babesia species in feral raccoons (Procyon lotor) in Hokkaido, Japan. Vet Parasitol, 2009; 162:241–247.

Kim

, Cho

, Joo

, Tsuji

, et al. First case of human babesiosis in Korea: Detection and characterization of a novel type of Babesia sp. (KO1) similar to ovine babesia. J Clin Microbiol, 2007; 45:2084–2087.

10.

Liu

, Yin

, Guan

, Schnittger

, et al. At least two genetically distinct large Babesia species infective to sheep and goats in China. Vet Parasitol, 2007; 147:246–251.

11.

Luo

, Yin

, Guan

, Zhang

, et al. Description of a new Babesia sp. infective for cattle in China. Parasitol Res, 2002; 88(13 Suppl 1):S13–S15.

12.

, Dong

, Jianzhu

, Ziqiang

, et al. Detection of Babesia divergens using molecular methods in anemic patients in Shandong Province, China. Parasitol Res, 2011; 10:241–245.

13.

Rar

, Epikhina

, Livanova

, Panov

, et al. Detection of Babesia spp. DNA in small mammals and ixodic ticks on the territory of north Ural, west Siberia and far east of Russia. Mol Gen Mikrobiol Virusol, 2010; 3:26–30.

14.

Shih

, Liu

, Chung

, Ong

, et al. Human babesiosis in Taiwan: Asymptomatic infection with a Babesia microti-like organism in a Taiwanese woman. J Clin Microbiol, 1997; 35:450–454.

15.

Sun

, Liu

, Yang

, Xu

, et al. Babesia microti-like rodent parasites isolated from Ixodes persulcatus (Acari: Ixodidae) in Heilongjiang Province, China. Vet Parasitol, 2008; 156:333–339.

16.

Tamura

, Peterson

, Stecher

, et al. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011; 28:2731–2739.

17.

Vannier

, Krause

. Human Babesiosis. N Engl J Med, 2012; 366:2397–2407.

18.

Wei

, Song

, Liu

, Wang

, et al. Molecular detection and characterization of zoonotic and veterinary pathogens in ticks from Northeastern China. Front Microbiol, 2016; 7:1913. eCollection 2016.

19.

Wei

, Tsuji

, Zamoto

, Kohsaki

, et al. Human babesiosis in Japan: Isolation of Babesia microti-like parasites from an asymptomatic transfusion donor and from a rodent from an area where babesiosis is endemic. J Clin Microbiol, 2001; 39:2178–2183.

20.

, Zhang

, Huang

, Bayin

, et al. Seroepidemiologic studies on Babesia equi and Babesia caballi infections in horses in Jilin province of China. J Vet Med Sci, 2003; 65:1015–1017.

21.

Yao

, Ruan

, Zeng

, Li

, et al. Pathogen identification and clinical diagnosis for one case infected with Babesia . Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 2012; 30:118–121 (in Chinese).

22.

Yin

, Luo

. Ticks of small ruminants in China. Parasitol Res, 2007; 101 Suppl 2:S187–S189.