New Records of Bartonella spp. and Rickettsia spp. in Lice Collected from Small Rodents

Abstract

Lice are blood-sucking insects that are of medical and veterinary significance as parasites and vectors for various infectious agents. More than half of described blood-sucking lice species are found on rodents. Rodents are important hosts of several Bartonella and Rickettsia species, and some of these bacteria are characterized as human pathogens in Europe. Rodent ectoparasites, such as fleas and ticks, are important vectors of Bartonella spp. and Rickettsia spp., but knowledge about the presence of these bacteria in lice is limited. The aim of this study was to determine the prevalence of Bartonella and Rickettsia bacteria in lice collected from rodents in Slovakia. The ectoparasites were collected from small rodents captured from 2010 to 2015 at four different sites in eastern Slovakia. The presence of Bartonella and Rickettsia species in lice samples was screened by real-time PCR, targeting ssrA and gltA genes, respectively. The molecular characterization of the Bartonella strains was based on sequence analysis of partial rpoB and intergenic spacer (ITS) genes, and of the Rickettsia species on sequence analysis of the gltA gene. A total of 1074 lice of seven species were collected from six rodent species. Bartonella DNA was detected in Hoplopleura affinis (collected from Apodemus agrarius, Apodemus flavicollis, and Myodes glareolus), Polyplax serrata (from A. agrarius), and Hoplopleura sp. (from A. flavicollis). Sequence analysis revealed that the Bartonella strains belonged to the Bartonella coopersplainsensis, Bartonella tribocorum, and Bartonella taylorii genogroups. Rickettsia DNA was detected in H. affinis and P. serrata collected from A. agrarius. Sequence analysis revealed two Rickettsia species: Rickettsia helvetica and Rickettsia sp. The results of the study confirm the presence of Bartonella spp. and Rickettsia spp. in lice collected from rodents.

Introduction

Small rodents are important hosts of ectoparasites such as fleas, ticks, mites, and lice and are reservoir hosts or carriers of medically important pathogens (Gutiérrez et al. 2015). Rodent ectoparasites (fleas and ticks) are vectors of Bartonella spp. and Rickettsia spp. (Buffet et al. 2013, Gutiérrez et al. 2015, Špitalská et al. 2020). Bartonella spp. and Rickettsia spp. are gram-negative bacteria that can cause severe disease in humans and animals (Breitschwerdt and Kordick 2000, Parola et al. 2013).

Small rodents represent potential reservoirs for many Bartonella infections (Buffet et al. 2013). Recently, Bartonella spp. have been reported in rodents in Slovakia (Kraljik et al. 2016, Špitalská et al. 2017). Spotted fever group (SFG) rickettsiae are widespread in Europe and are currently recognized as human and animal pathogens (Parola et al. 2013). Several molecular studies in Slovakia (Miťková et al. 2015, Špitalská et al. 2015, 2020, Minichová et al. 2017, Heglasová et al. 2018, 2020) have demonstrated the presence of rickettsial DNA in small rodents and their ectoparasites (such as ticks, mites, and fleas).

Sucking lice (Phthiraptera: Anoplura) are obligate blood-feeding insects and permanent ectoparasites of eutherian mammals. All their life cycle stages are closely related to their vertebrate hosts. More than 540 species of blood-sucking lice have been described that parasitize more than 840 mammal species belonging to 12 orders (Light et al. 2010, Dong et al. 2014). About 67% of the described sucking lice species have been found on rodents (Wang et al. 2018). The sucking lice are of medical and veterinary significance as vectors of louse-borne pathogens (viruses, bacteria, fungi, and protozoa) to vertebrate hosts (Hornok et al. 2010). Sucking lice are highly host-specific, that is, each species parasitizes a single or a few closely related host species (Light et al. 2010, Martinů et al. 2018).

In Europe, reports of pathogens in lice are scarce. Hornok et al. (2010) were the first to report Rickettsia spp. in lice from livestock and proved that they could be potential vectors of arthropod-borne pathogens. However, there is limited information available with regard to Bartonella spp. and Rickettsia spp. in lice collected from rodents in Europe. The role of lice in the life cycles of Rickettsia and Bartonella is still not clear. The aim of this study was to determine the prevalence of Bartonella and Rickettsia species in lice collected from rodents in Slovakia.

Materials and Methods

Sample collection and identification

Small mammals were live-captured between 2010 and 2015 using Swedish bridge metal traps baited with sunflower seeds at four different sites in eastern Slovakia: two with mixed forest vegetation with a predominance of beech, hornbeam, and spruce (Čermeľ [208–600 meters a.s.l.; 48°45′46 · 67″N; 21°8′8 · 17″E] and Hýľov [500–750 meters a.s.l.; 48°44′22 · 80″N; 21°4′18 · 90″E]), and two with deciduous forest vegetation (the Botanical garden in Košice [208 meters a.s.l.; 48°44′6 · 84″N; 21°14′16 · 14″E] with a predominance of hornbeam, and the Rozhanovce game reserve [215 meters a.s.l.; 48°45′36″N; 21°21′30″E], an ecotone of oak-hornbeam forest and pasture in a menagerie) (collection sites were described in more details by Blaňarová et al. 2014, Stanko et al. 2015, Kraljik et al. 2016, Špitalská et al. 2020).

At each site, 50 traps were placed 5 meters apart in transects (∼250 meters in length) for two consecutive nights. A total of 5400 trapping nights during research were carried out, of which 1653 trapping nights in the Čermeľ valley (30.6%), 1701 in the Rozhanovce game reserve (31.5%), 1447 in the Botanical garden (26.8%), and 599 in Hýľov (11.1%). Captured animals were transported to the laboratory where they were identified to species level and euthanized under licenses from the Ministry of Environment of the Slovak Republic number 4874/2011-2 · 2.

The ectoparasites (ticks, fleas, mites, and lice) were collected and placed in 70% ethanol. Lice were then identified by life stage, species, and sex under light microscopy according to keys by Smetana (1965) and Wegner (1972).

Molecular analyses

Lice from each rodent host were grouped in pools by species, life stage, and sex. A total of 275 sample pools (between 1 and 10 lice per pool): 38 pools of larvae, 151 pools of females, and 86 pools of males were analyzed. DNA from lice was extracted using 2.5% ammonium hydroxide solution (Rijpkema et al. 1996). Bartonella and Rickettsia DNA in samples was detected using a duplex TaqMan real-time PCR targeting a 124 bp fragment of ssrA and a 103 bp fragment of citrate synthase (gltA) genes, respectively. The quantitative PCR amplifications were carried out in a 15-μL final volume consisting of 1 μL of extracted DNA, (1 × ) SensiMix™ II Probe No-ROX Kit (Bioline Reagents Ltd, UK), 1 μM of each primer, and 0.5 μM of each probe.

The reaction was carried out in a real-time thermocycler Rotor-Gene Q 5plex model with software version 1.7 (Qiagen GmbH, Germany). The optimized thermal cycler program was 95°C for 10 min (1 cycle), followed by 50 cycles of denaturation at 95°C for 20 s, annealing at 50°C for 1 min, and extension at 72°C for 10 s. Samples with cutoffs below 40 Ct (cycle threshold) and when the threshold was 0.10101 were considered positive. Bartonella-positive samples were tested further in two PCRs using a set of genus-specific primers targeting the 795 bp fragment of the RNA polymerase β-subunit (rpoB) gene (Renesto et al. 2001) and primers targeting the 16S-23S rRNA gene intergenic spacer (ITS) region (0.9–1.6 kb) (Jensen et al. 2000, Kaewmongkol 2012).

A nested PCR that targeted the partial gltA gene (338 bp fragment) (Miťková et al. 2015) was used for amplification of Rickettsia spp. The primer sequences and target genes used in this study are presented in Table 1. Negative (dH2O) and positive controls (DNA of Bartonella-infected rodents and the DNA of Rickettsia-infected ticks, confirmed by sequencing) were included in real-time PCR, conventional PCR, and nested PCR runs. Products of amplification were identified in 1.5% agarose gel after undergoing electrophoresis under standard conditions and staining with ethidium bromide solution (2 μg/mL) and then visualized using the UV transilluminator (EASY Win32; Herolab, Germany).

Table 1.

Primers and Probes Used for Real-Time PCR, Conventional PCR, and Nested PCR

Primer or probe	Sequence (5′–3′)	Target in assay	Reference
ssrA-F1	AGTTGCAAATGACAACTATGCGG	Bartonella spp. ssrA gene	Mardosaitė-Busaitienė et al. (2019), Diaz et al. (2012)
ssrA-R1	AAGGCTTCTGTTGCCAGGYG
ssrA-P1^a	HEX-ACCCCGCTTAAACCTGCGACGGTT-BHQ1
RpoB-F	CGCATTGGYTTRCTTCGTATG	Bartonella spp. rpoB gene	Renesto et al. (2001)
RpoB-R	GTRGAYTGATTRGAACGYTG	Bartonella spp. rpoB gene	Renesto et al. (2001)
WITS-F^b	ACCTCCTTTCTAAGGATGAT	Bartonella spp. ITS region	Jensen et al. (2000), Kaewmongkol (2012)
WITS-R^b	CTCTTTCTTCAGATGATGATCC
Bh311-332F^c	CTCTTTCTTCAGATGATGATCC
Bh473-452R^c	AACCAACTGAGCTACAAGCCCT
Rick F1	TGCMGAYCATGAGCACAATGCTTC	Rickettsia spp. gltA gene	This study
Rick R1	CCCAAAGTGAKGCAATACCCGT
Rick P1^a	FAM-TGCCGGCTCATCYGGAGCTAACCC-BHQ1
RpCS.877p^b	GGGGACCTGCTCACGGCGG	Rickettsia spp. gltA gene	Miťková et al. (2015)
RpCS.1258n^b	ATTGCAAAAAGTACAGTGAACC
RpCS.896p^c	GGCTAATGAAGCAGTGATAA
RpCS.1233n^c	GCGACGGTATACCCATAGC

Probe.

External primers.

Internal primers.

Representative positive PCR products were extracted from the agarose gel and purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Lithuania) according to the manufacturer's instructions. The sequencing was performed by Macrogen (Macrogen Europe, Netherlands). The obtained sequences were edited, aligned with one other, and compared with the sequence data available from the NCBI GenBank, using the Mega X program and the NCBI BLAST^® blastn suite applet. The most appropriate model of nucleotide substitution for each alignment data set was determined according to the Bayesian information criterion. Phylogenetic trees were constructed using the maximum-likelihood method with the Tamura–Nei model. Bootstrap support was calculated by means of 1000 replicates.

Bartonella and Rickettsia sequences obtained in this study were deposited in the GenBank database under the accession numbers MT840662–MT840520 (Bartonella ITS region), MT876371–MT876377, MT833866 (Bartonella rpoB gene), and MT876378–MT876382 (Rickettsia gltA gene).

Statistical analysis

The prevalence of pathogens in lice was calculated as a minimum infection rate (MIR) with 95% confidence intervals (CIs). The MIR was calculated as the ratio of the number of positive pools to the total number of lice tested. The underlying MIR assumption was that only one infected individual exists in a positive pool (Weidong et al. 2003).

Results

A total of 1074 lice belonging to seven species (28 Hoplopleura acanthopus, 732 Hoplopleura affinis, 1 Hoplopleura edentula, 7 Hoplopleura sp., 225 Polyplax serrata, 79 Polyplax spinulosa, and 2 Polyplax sp.) were collected from 216 small rodents representing six species (Apodemus agrarius n = 151, Apodemus flavicollis n = 35, Microtus arvalis n = 13, Microtus subterraneus n = 2, Myodes glareolus n = 11, and Rattus norvegicus n = 4). Both sexes of lice and larvae were found on the rodents (Table 2).

Table 2.

Presence of Bartonella spp. and Rickettsia spp. in Lice Collected from Different Species of Small Rodents in Slovakia

Rodents species	Hoplopleura affinis			Hoplopleura edentula			Hoplopleura acanthopus			Hoplopleura sp.			Polyplax serrata			Polyplax spinulosa			Polyplax sp.
Rodents species	No. of positive pools/no. of pools (no. of lice in pools); MIR % [95% CI]			No. of positive pools/no. of pools (no. of lice in pools); MIR % [95% CI]			No. of positive pools/no. of pools (no. of lice in pools); MIR % [95% CI]			No. of positive pools/no. of pools (no. of lice in pools) %; MIR [95% CI]			No. of positive pools/no. of pools (no. of lice in pools) %; MIR [95% CI]			No. of positive pools/no. of pools (no. of lice in pools); MIR % [95% CI]			No. of positive pools/no. of pools (no. of lice in pools); MIR % [95% CI]
Bartonella spp.	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀
Apodemus agrarius	3/6 (24)	2/41 (246)	12/78 (418)	—	—	—	—	0/1 (1)	—	0/4 (4)	—	—	0/16 (82)	3/18 (36)	3/38 (79)	—	0/1 (1)	—	0/2 (2)	—	—
Apodemus flavicollis	1/1 (2)	1/6 (16)	3/7 (16)	—	—	—	—	—	—	1/1 (1)	—	—	0/3 (3)	0/3 (3)	1/10 (19)	—	0/1 (1)	0/2 (2)	—	—	—
Microtus arvalis	—	—	—	—	—	—	0/2 (4)	0/5 (9)	0/4 (13)	0/1 (1)	—	—	—	—	0/1 (1)	—	—	—	—	—	—
Microtus subterraneus	—	—	0/1	—	—	—	—	—	—	0/1 (1)	—	—	—	—	—	—	—	—	—	—	—
Myodes glareolus	—	1/5 (6)	1/3 (3)	—	—	0/1 (1)	—	—	0/1 (1)		—	—		0/2 (2)	—	—	0/1 (2)	—	—	—	—
Rattus norvegicus	—	—	—	—	—	—	—	—	—		—	—	—	—	—	0/1 (8)	0/2 (20)	0/5 (45)	—	—	—
Total	4/7 (26); 15.4 [4.4–34.9]	4/52 (268); 1.5 [0.4–3.8]	16/89 (438); 3.7 [2.1–5.9]	—	—	0/1 (1)	0/2 (4)	0/6 (10)	0/5 (14)	1/7 (7); 14.3 [0.4–57.9]	—	—	0/19 (85)	3/23 (41); 7.3 [1.5–19.9]	4/49 (99); 4.0 [1.1–10.0]	0/1 (8)	0/5 (24)	0/7 (47)	0/2 (2)	—	—

Rickettsia spp.	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀	L	♂	♀
A. agrarius	0/6 (24)	1/41 (246)	3/78 (418)	—	—	—	—	0/1 (1)	—	0/4 (4)	—	—	0/16 (82)	1/18 (36)	1/38 (79)	—	0/1 (1)	—	0/2 (2)	—	—
A. flavicollis	0/1 (2)	0/6 (16)	0/7 (16)	—	—	—	—	—	—	0/1 (1)	—	—	0/3 (3)	0/3 (3)	0/10 (19)	—	0/1 (1)	0/2 (2)	—	—	—
M. arvalis	—	—	—	—	—	—	0/2 (4)	0/5 (9)	0/4 (13)	0/1 (1)	—	—	—	—	0/1 (1)	—	—	—	—	—	—
M. subterraneus	—	—	0/1	—	—	—	—	—	—	0/1 (1)	—	—	—	—	—	—	—	—	—	—	—
M. glareolus	—	0/5 (6)	0/3 (3)	—	—	0/1 (1)	—	—	0/1 (1)		—	—		0/2 (2)	—	—	0/1 (2)	—	—	—	—
R. norvegicus	—	—	—	—	—	—	—	—	—		—	—	—	—	—	0/1 (8)	0/2 (20)	0/5 (45)	—	—	—
Total	0/7 (26)	1/52 (268); 0.4 [0.0–2.1]	3/89 (438); 0.7 [0.1–2.0]	—	—	0/1 (1)	0/2 (4)	0/6 (10)	0/5 (14)	0/7 (7)	—	—	0/19 (85)	1/23 (41); 2.4 [0.0–17.8]	1/49 (99); 1.0 [0.0–4.9]	0/1 (8)	0/5 (24)	0/7 (47)	0/2 (2)	—	—

CI, confidence interval; MIR, minimum infection rate.

Bartonella infection in lice

Based on real-time PCR analysis, a total of 32 pools (11.6%; 32/275 pools) were found to be positive for Bartonella spp. with an overall MIR of 3.0% (32/1074; 95% CI: 2.0–4.2%) and 6 pools were positive for Rickettsia spp. (2.2%; 6/275 pools) with an overall MIR of 0.6% (6/1074; 95% CI: 0.2–1.2%) (Table 2). Positive samples had Ct values of between 18 and 39.

Bartonella DNA was detected in H. affinis (collected from A. agrarius, A. flavicollis, and M. glareolus), P. serrata (collected from A. agrarius), and Hoplopleura sp. (collected from A. flavicollis). All three live stages of lice were found to be infected with Bartonella spp.: larvae (13.2% positive pools out of 38), males (8.1% out of 86), and females (13.3% out of 151). A higher prevalence of Bartonella spp. was detected in H. affinis (16.2% positive pools out of 148; MIR of 3.3%, 24/732; 95% CI: 2.1–4.8%), followed by P. serrata (7.7% positive pools out of 91; MIR of 3.1%, 7/225; 95% CI: 1.3–6.3%). One single specimen of Hoplopleura sp. out of seven tested was positive.

Bartonella-positive PCR products of good quality were subjected to sequence analysis. A total of 14 good quality sequences of Bartonella rpoB (n = 8) gene and ITS region (n = 6) were obtained and analyzed. The ITS region sequences of Bartonella derived from lice were 100% identical to each other and 98–100% identical to Bartonella coopersplainsensis and Bartonella tribocorum sequences deposited in GenBank (Fig. 1).

FIG. 1.

ML phylogenetic tree for the partial ITS region of Bartonella spp. The phylogenetic tree was created using the Tamura–Nei model and bootstrap analysis of 1000 replicates. Samples sequenced in the present study are marked. A. agr, Apodemus agrarius; A. fla, Apodemus flavicollis; AU, Australia; F, female; FI, Finland; FR, France; IT, Italy; KR, South Korea; L, larva; LT, Lithuania; M, male; M. gla, Myodes glareolus; ML, maximum-likelihood; R. leu, Rattus leucopus; R. rat, Rattus rattus; USA, United States of America.

Sequences (samples MT840662, MT840663, and MT840664) derived from H. affinis (two pools of females and one pool of larvae collected from two A. agrarius) were 100% identical to each other, 100% identical to B. coopersplainsensis sequences detected in A. agrarius from Lithuania (GenBank: MH547343), and 98% identical to B. coopersplainsensis sequences detected in rats from Italy (GenBank: MK562489) and Australia (GenBank: EU111770) (Fig. 1). Sequences (samples MT840518, MT840519, and MT840520) derived from H. affinis (two different pools of females collected from a single A. flavicollis and a single M. glareolus) and P. serrata (one pool of males collected from a single A. agrarius) were 100% identical to each other and to B. tribocorum sequences detected in A. agrarius from Lithuania (GenBank: MH687379) and South Korea (GenBank: JN810856) (Fig. 1).

The rpoB gene sequences (samples MT876371, MT876372, MT876373, MT876374, MT876375, MT876376, and MT876377) derived from H. affinis (five pools of females and two pools of larvae from A. agrarius [n = 3]) were 100% identical to each other and to B. coopersplainsensis sequences detected in A. agrarius from Lithuania (GenBank: MH547343). These sequences showed 98% identity to B. coopersplainsensis sequences detected in rats from Australia (GenBank: EU111792) and Thailand (GenBank: MF105907) (Fig. 2). One Bartonella rpoB sequence (sample MT833866) derived from H. affinis (one pool of females from a single A. flavicollis) was 100% identical to the Bartonella taylorii strain detected in A. flavicollis from Turkey (GenBank: MH932636) (Fig. 2).

FIG. 2.

ML phylogenetic tree for the partial rpoB gene of Bartonella spp. The phylogenetic tree was created using the Tamura–Nei model and bootstrap analysis of 1000 replicates. Samples sequenced in the present study are marked. M. agr, Microtus agrestis; TH, Thailand; TR, Turkey.

Rickettsia infection in lice

Four pools of H. affinis and two pools of P. serrata collected from A. agrarius (n = 6) were found to be positive for Rickettsia spp. Rickettsia spp. were detected in males (2.3% positive pools out of 86) and females (2.7% out of 151).

A total of five good quality sequences of Rickettsia gltA gene were obtained and analyzed. Sequence analysis of the partial gltA gene revealed the presence of two Rickettsia species: Rickettsia helvetica (n = 4) and unrecognized Rickettsia sp. (n = 1). Rickettsia sequences (samples MT876379, MT876380, MT876381, and MT876382) derived from H. affinis (three pools of females) and P. serrata (one pool of males) shared 99% identity (with one nucleotide difference) and were 100% identical to the gltA sequence of R. helvetica detected in A. flavicollis from Lithuania (GenBank: MF491764) and R. helvetica sequences detected in one flea from Slovakia (GenBank: MN276064) and in Ixodes ricinus ticks from Slovakia (GenBank: MK85717), Poland (GenBank: EY779822), and Italy (GenBank: MN226407) (Fig. 3).

FIG. 3.

ML phylogenetic tree for the partial gltA gene of Rickettsia spp. The phylogenetic tree was created using the Tamura–Nei model and bootstrap analysis of 1000 replicates. Samples sequenced in the present study are marked. AF, Africa; CN, China; GR, Greece; PL, Poland; RU, Russia; SK, Slovakia.

The Rickettsia sequence (sample MT876378) isolated from H. affinis (one pool of males) was 100% identical to the closely phylogenetically related sequences deposited in GenBank for Rickettsia raoultii (GenBank: MN550895, MH064450, MK875750, and MK792599), Rickettsia aeschlimannii (GenBank: JF803905), and Rickettsia heilongjiangensis (GenBank: JX945522) (Fig. 3).

Discussion

Phylogenetic analysis based on the Bartonella rpoB gene and ITS region and the Rickettsia gltA gene revealed the presence of B. tribocorum, B. coopersplainsensis, B. taylorii, R. helvetica, and Rickettsia sp. in rodent lice.

In this study, B. taylorii was detected in H. affinis lice collected from A. flavicollis. In previous studies, B. taylorii has been confirmed in the small mammals A. agrarius, A. flavicollis, M. glareolus, M. arvalis, and Talpa europaea in Slovakia (Kraljik et al. 2016, Špitalská et al. 2017). Bartonella taylorii strains in small mammals and their ectoparasites have also been reported in several studies conducted in Europe, including in England (Bown et al. 2004), Slovenia (Knap et al. 2007), Poland (Welc-Falęciak et al. 2008), Spain (Gil et al. 2010), Lithuania (Lipatova et al. 2015, Mardosaitė-Busaitienė et al. 2019), and Germany (Silaghi et al. 2016).

Bartonella taylorii can infect several sympatric woodland rodents at a given site. A high diversity of B. taylorii strains is frequently found in Apodemus mice and in Myodes and Microtus voles (Buffet et al. 2013). The pathogenic potential of B. taylorii is as yet unknown (Bown et al. 2004, Lipatova et al. 2015).

In this study, B. tribocorum infection was detected in P. serrata and H. affinis lice collected from A. flavicollis, A. agrarius, and M. glareolus. This Bartonella species is pathogenic to humans (Buffet et al. 2013). Previous studies have strongly supported the association of B. tribocorum with rats of the genus Rattus. Bartonella tribocorum has been detected in rats and their fleas in Thailand (Klangthong et al. 2015), and Bartonella strains closely related to B. tribocorum have been detected in one louse specimen (adult P. spinulosa) collected from rats in Egypt (Reeves et al. 2006). In the striped field mouse A. agrarius, B. tribocorum was detected for the first time in South Korea (Ko et al. 2016) and closely related strains were later confirmed in A. agrarius from Slovakia (Kraljik et al. 2016) and Lithuania (Mardosaitė-Busaitienė et al. 2019).

The present study is the first to detect the B. coopersplainsensis infection in Slovakia in H. affinis lice collected from A. agrarius. Previously, B. coopersplainsensis has been isolated from rats from Australia (Gundi et al. 2009) and New Zealand (Helan et al. 2018) and from one louse pool (Hoplopleura spp.) collected from rats in Thailand (Klangthong et al. 2015). Bartonella coopersplainsensis has also been reported in A. agrarius in Lithuania (Mardosaitė-Busaitienė et al. 2019). There is a lack of information on B. coopersplainsensis; therefore, the public health impact of this bacteria is unknown (Helan et al. 2018).

The present study is also the first to demonstrate the presence of R. helvetica and Rickettsia sp. in lice collected from rodents in Slovakia. Two R. helvetica strains were detected in H. affinis and P. serrata lice collected from A. agrarius. Rickettsia helvetica are considered to be agents of human rickettsioses (Gajda et al. 2017). In recent studies conducted in Slovakia, R. helvetica has been identified in rodents and in fleas, mites, and ticks collected from rodents (Miťková et al. 2015, Špitalská et al. 2015, 2020, Minichová et al. 2017, Heglasová et al. 2018, 2020). Rickettsia helvetica has also been reported in rodents and their ectoparasites in other European countries, such as the Netherlands (Sprong et al. 2009), Hungary (Hornok et al. 2015), Germany (Obiegala et al. 2016), Poland (Gajda et al. 2017), and Lithuania (Radzijevskaja et al. 2018, Mardosaitė-Busaitienė et al. 2018).

Based only on sequence analysis of the gltA gene, the Rickettsia sp. detected in this study in H. affinis pools collected from A. agrarius was not identified to species level.

The presence of Bartonella spp. and Rickettsia spp. in lice may result from the acquisition of these bacteria via blood meals from infected rodents (Klangthong et al. 2015). It is still not clear if lice can transmit the detected pathogens, eventually can be their reservoirs or infection in them was detected only due to acquisition of infected blood meals. The results of the study may suggest that these facts as majority of infected lice were collected from uninfected rodents. The physical contact between rodents may also promote exchange of infected ectoparasites.

Some SFG rickettsiae are thought to circulate in enzootic or epizootic cycles between wild vertebrates and arthropod vectors. Despite many studies conducted, the role of wild rodents as hosts of R. helvetica is still not clear. In Europe, R. helvetica has been detected in five rodent species (A. flavicollis, Apodemus sylvaticus, A. agrarius, M. glareolus, and Mus musculus) (Minichová et al. 2017, Mardosaitė-Busaitienė et al. 2018). High prevalence of R. helvetica was reported in small rodents from the Netherlands (Sprong et al. 2009), Germany (Obiegala et al. 2016), and Lithuania (Mardosaitė-Busaitienė et al. 2018). However, in some countries such as Slovakia and Hungary, R. helvetica was confirmed only in a low proportion of wild rodents (Hornok et al. 2015, Miťková et al. 2015, Minichová et al. 2017).

The rodents from which the lice were collected have previously been tested for the presence of Bartonella and Rickettsia pathogens (Kraljik et al. 2016, Špitalská et al. 2015, 2017, 2020, Heglasová et al. 2018, 2020). However, almost all the Bartonella- and Rickettsia-infected lice were derived from noninfected rodent hosts (except for two specimens of A. agrarius; data not shown). In this case, lice could become infected by parasitizing on other infected hosts. Small rodents infested with lice also harbor other ectoparasites species such as mites, fleas, and I. ricinus ticks (Špitalská et al. 2015, 2020, Heglasová et al. 2020).

The presence of Bartonella pathogens in lice may also result from acquisition pathogens by co-feeding with Bartonella-infected fleas. Fleas are the main vectors for the maintenance and transmission of Bartonella grahamii, B. taylorii, and Bartonella rochalimae among populations of small mammals (Buffet et al. 2013). Bartonella tribocorum has been detected in fleas and B. coopersplainsensis in ticks and lice (Klangthong et al. 2015).

Lice that infest rodents could acquire Rickettsia spp. by co-feeding with infected I. ricinus ticks, fleas, and mites. Horizontal transmission through a shared blood meal has been demonstrated for some rickettsial pathogens (Brown et al. 2015). In a previous study conducted in Slovakia, Rickettsia spp. was detected in four species of mites, I. ricinus ticks, and four flea species, with an overall prevalence of 9.3%, 17.2%, and 3.5%, respectively (Špitalská et al. 2020).

Conclusions

To the best of the authors' knowledge, this is the first report on the occurrence and diversity of Bartonella spp. and Rickettsia spp. in lice collected from small rodents in Europe. Thus, future studies should be performed to determine the specific roles of different species of lice parasitizing small rodents in the transmission of bacteria to estimate the potential risks for other mammals (e.g., cats) and humans.

Footnotes

Acknowledgments

The authors would like to thank Dr. L. Mošanský, Dr. J. Kraljik, Dr. L. Blaňarová, Dr. D. Miklisová, and Mrs. M. Onderová for their assistance in the field and in the laboratory. We are grateful to Dr. Maksim Bratchikov for his help with the methodology and design of primers for real-time PCR.

Author Disclosure Statement

No conflicting financial interests exist.

Funding Information

The study was supported by the project VEGA 1/0084/18 and APVV-15-0134.

References

Blaňarová. L, Stanko M, Carpi G, Miklisová D, et al. Distinct Anaplasma phagocytophilum genotypes associated with Ixodes trianguliceps ticks and rodents in Central Europe. Ticks Tick Borne Dis, 2014; 5:928–938.

Bown

, Bennet

, Begon

. Flea-borne Bartonella grahamii and Bartonella taylorii in bank voles. Emerg Infect Dis, 2004; 10:684–687.

Breitschwerdt

, Kordick

. Bartonella infection in animals: Carrier ship, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clin Microbiol Rev, 2000; 13:428–438.

Brown

, Christofferson

, Banajee

, Del Piero

, et al. Cofeeding intra- and interspecific transmission of an emerging insect-borne rickettsial pathogen. Mol Ecol, 2015; 24:5475–5489.

Buffet

, Kosoy

, Vayssier-Taussat

. Natural history of Bartonella-infecting rodents in light of new knowledge on genomics, diversity and evolution. Future Microbiol, 2013; 8:1117–1128.

Diaz

, Bai

, Malania

, Winchell

, et al. Development of a novel genus-specific real-time PCR assay for detection and differentiation of Bartonella species and genotypes. J Clin Microbiol, 2012; 50:1645–1649.

Dong

, Song

, Jin

, Guo

, et al. Fragmented mitochondrial genomes of the rat lice, Polyplax asiatica and Polyplax spinulosa: Intra-genus variation in fragmentation pattern and a possible link between the extent of fragmentation and the length of life cycle. BMC Genomics, 2014; 15:44.

Gajda

, Hildebrand

, Sprong

, Buńkowska-Gawlik

, et al. Spotted fever rickettsiae in wild-living rodents from south-western Poland. Parasit Vectors, 2017; 10:413.

Gil

, García-Esteban

, Barandika

, Peig

, et al. Variability of Bartonella genotypes among small mammals in Spain. Appl Environ Microbiol, 2010; 76:8062–8070.

10.

Gundi

, Taylor

, Raoult

, La Scola

. Bartonella rattaustraliani sp. nov., Bartonella queenslandensis sp. nov. and Bartonella coopersplainsensis sp. nov., identified in Australian rats. Int J Syst Evol Microbiol, 2009; 59:2956–2961.

11.

Gutiérrez

, Krasnov

, Morick

, Gottlieb

, et al. Bartonella infection in rodents and their flea ectoparasites: An overview. Vector Borne Zoonotic Dis, 2015; 15:27–39.

12.

Heglasová. I, Víchová B, Kraljik J, Mošanský L, et al. Molecular evidence and diversity of the spotted-fever group Rickettsia spp. in small mammals from natural, suburban and urban areas of Eastern Slovakia. Ticks Tick Borne Dis, 2018; 9:1400–1406.

13.

Heglasová. I, Víchová B, Stanko M. Detection of Rickettsia spp. in fleas collected from small mammals in Slovakia, Central Europe. Vector Borne Zoonotic Dis, 2020; 20:652–656.

14.

Helan

JVG

, Grinberg

, Gedye

, Potter

, et al. Molecular detection of Bartonella coopersplainsensis and B. henselae in rats from New Zealand. N Z Vet J, 2018; 66:257–260.

15.

Hornok

, Földvári

, Rigó K, Meli ML, et al. Synanthropic rodents and their ectoparasites as carriers of a novel haemoplasma and vector-borne, zoonotic pathogens indoors. Parasit Vectors, 2015; 8:27.

16.

Hornok

, Hofmann-Lehmann

, de Mera

, Meli

, et al. Survey on blood-sucking lice (Phthiraptera: Anoplura) of ruminants and pigs with molecular detection of Anaplasma and Rickettsia spp. Vet Parasitol, 2010; 174:355–358.

17.

Jensen

, Fall

, Rooney

, Kordick

, et al. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol, 2000; 38:1717–1722.

18.

Kaewmongkol

Detection and characterization of Bartonella species in Western Australia (Thesis of Doctor of Philosophy). School of Veterinary and Biomedical Sciences, Faculty of Health Sciences, Murdoch University, Perth, Western Australia, 2012.

19.

Klangthong

, Promsthaporn

, Leepitakrat

, Schuster

, et al. The distribution and diversity of Bartonella species in rodents and their ectoparasites across Thailand. PLoS One, 2015; 10:e0140856.

20.

Knap

, Duh

, Birtles

, Trilar

, et al. Molecular detection of Bartonella species infecting rodents in Slovenia. FEMS Immunol Med Microbiol, 2007; 50:45–50.

21.

, Kang

, Kim

, Klein

, et al. Prevalence, isolation and molecular characterization of Bartonella species in Republic of Korea. Transbound Emerg Dis, 2016; 63:56–67.

22.

Kraljik

, Paziewska-Harris

, Miklisová D, Blaňarová L, et al. Genetic diversity of Bartonella genotypes found in the striped field mouse (Apodemus agrarius) in Central Europe. Parasitology, 2016; 143:1437–1442.

23.

Light

, Smith

, Allen

, Durden

, et al. Evolutionary history of mammalian sucking lice (Phthiraptera: Anoplura). BMC Evol Biol, 2010; 10:292.

24.

Lipatova

, Paulauskas

, Puraitė I, Radzijevskaja J, et al. Bartonella infection in small mammals and their ectoparasites in Lithuania. Microbes Infect, 2015; 17:884–888.

25.

Mardosaitė-Busaitienė. D, Radzijevskaja J, Balčiauskas L. Bratchikov M, et al. Prevalence and diversity of Bartonella species in small rodents from coastal and continental areas. Sci Rep, 2019; 9:12349.

26.

Mardosaitė-Busaitienė. D, Radzijevskaja J, Balčiauskas L, Paulauskas A. First detection of Rickettsia helvetica in small mammals in Lithuania. New Microbes New Infect, 2018; 22:19–23.

27.

Martinů. J, Hypša V, Štefka J. Host specificity driving genetic structure and diversity in ectoparasite populations: Coevolutionary patterns in Apodemus mice and their lice. Ecol Evol, 2018; 8:10008–10022.

28.

Minichová. L, Hamšíková Z, Mahríková L, Slovák M, et al. Molecular evidence of Rickettsia spp. in ixodid ticks and rodents in suburban, natural and rural habitats in Slovakia. Parasit Vectors, 2017; 10:158.

29.

Miťková. K, Berthová L, Kalúz S, Kazimírová M, et al. First detections of Rickettsia helvetica and R. monacensis in ectoparasitic mites (Laelapidae and Trombiculidae) infesting rodents in south-western Slovakia. Parasitol Res, 2015; 114:2465–2472.

30.

Obiegala

, Oltersdorf

, Silaghi

, Kiefer

, et al. Rickettsia spp. in small mammals and their parasitizing ectoparasites from Saxony, Germany. Vet Parasitol, 2016; 5:19–24.

31.

Parola

, Paddock

, Socolovschi

, Labruna

, et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin Microbiol Rev, 2013; 26:657–702.

32.

Radzijevskaja

, Kaminskienė E, Lipatova I. Mardosaitė-Busaitienė D, et al. Prevalence and diversity of Rickettsia species in ectoparasites collected from small rodents in Lithuania. Parasit Vectors, 2018; 11:375.

33.

Reeves

, Szumlas

, Moriarity

, Loftis

, et al. Louse-borne bacterial pathogens in lice (Phthiraptera) of rodents and cattle from Egypt. J Parasitol, 2006; 92:313–318.

34.

Renesto

, Gouvernet

, Drancourt

, Roux

, et al. Use of rpoB gene analysis for detection and identification of Bartonella species. J Clin Microbiol, 2001; 39:430–437.

35.

Rijpkema

, Golubić D, Molkenboer M, Verbeek-De Kruif N, et al. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp Appl Acarol, 1996; 20:23–30.

36.

Silaghi

, Pfeffer

, Kiefer

, et al. Bartonella, rodents, fleas and ticks: A molecular field study on host-vector-pathogen associations in Saxony, Eastern Germany. Microb Ecol, 2016; 72:965–974.

37.

Smetana

. Lice from the territory of Czechoslovakia, in Czech. Acta Rerum Naturalium Musei Nationalis Slovaci Bratislava1965;, 11:30–82.

38.

Špitalská. E, Boldiš V, Mošanský L, Sparagano O, et al. Rickettsia species in fleas collected from small mammals in Slovakia. Parasitol Res, 2015; 114:4333–4339.

39.

Špitalská. E, Kraljik J, Miklisová D, Boldišová E, et al. Circulation of Rickettsia species and rickettsial endosymbionts among small mammals and their ectoparasites in Eastern Slovakia. Parasitol Res, 2020; 119:2047–2057.

40.

Špitalská. E, Minichová L, Kocianová E, Škultéty L, et al. Diversity and prevalence of Bartonella species in small mammals from Slovakia, Central Europe. Parasitol Res, 2017; 116:3087–3095.

41.

Sprong

, Wielinga

, Fonville

, Reusken

, et al. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species. Parasit Vectors, 2009; 2:41.

42.

Stanko

, Fričová J, Miklisová D, Khokhlova IS, et al. Environment-related and host-related factors affecting the occurrence of lice on rodents in Central Europe. Parasitology, 2015; 142:938–947.

43.

Wang

, Weaver

, Song

, Durden

, et al. A new species of sucking louse Hoplopleura villosissima n. sp. (Psocodea: Phthiraptera: Hoplopleuridae) and a new host record of the spiny rat louse Polyplax spinulosa Burmeister, 1839 (Psocodea: Phthiraptera: Polyplacidae) from the long-haired rat Rattus villosissimus Waite (Rodentia: Muridae) in Australia. Parasit Vectors, 2018; 11:476.

44.

Wegner

. Keys for determinations insects of Poland. Lice—Anoplura. Czesc XVI. Warsaw,, 1972:90.

45.

Weidong

, Lampman

, Robert

, Novak

. Problems in estimating mosquito infection rates using minimum infection rate. J Med Entomol, 2003; 40:595–596.

46.

Welc-Falęciak

, Paziewska

, Bajer

, Behnke

, et al. Bartonella spp. infection in rodents from different habitats in the Mazury Lake District, Northeast Poland. Vector Borne Zoonotic Dis, 2008; 8:467–74.