Presence and Resistance Profile of Staphylococcus spp. Isolated from Slaughtered Pigs

Abstract

Background:

The objective of this study was to isolate Staphylococcus spp. and to characterize the resistance profile in nasal samples from pigs slaughtered for consumption.

Material and Methods:

Intranasal swabs were collected from 100 pigs immediately after bleeding in a slaughterhouse located in the largest pork production region in Brazil, these samples were cultured and isolated to identify Staphylococcus spp. in coagulase positive (CoPS) and coagulase negative (CoNS) and molecular identification of Staphylococcus aureus and then subjected to the disk-diffusion test to identify the bacterial resistance profile and search for the mecA gene.

Results:

Of the 100 samples collected, it was possible to isolate 79 Staphylococcus spp., of these, 72.15% were classified as CoNS and 27.85% of the isolates classified as CoPS. Among the CoPS isolates, 77.27% were identified as S. aureus. Through the disk-diffusion test, it was possible to verify isolates resistant to clindamycin and erythromycin (98.73%), chloramphenicol (93.67%), and doxycycline (89.87%). There was amplification of the mecA gene in 30.38% of Staphylococcus spp.

Conclusion:

The results of this study highlight the need for the careful use of antibiotics in swine production, in addition to aiming at continuous surveillance in relation to the rate of multiresistant microorganisms within these environments, focused on large industrial centers; such results also indicate the importance of understanding, through future studies, possible pathways to transmission of these microorganisms directly, or indirectly, through meat products derived from these pigs, which can be considered neglected diffusers of variants of Staphylococcus spp. resistant to antibiotics or carriers of important resistance genes related to One Health.

Introduction

The Staphylococcus genus is composed of species present in different places, from the environment to the skin and nasal fossa of humans and animals (Becker et al., 2014; Bhargava and Zhang, 2012; González-Martín et al., 2020); among the animals considered reservoirs are swine, animals that are correlated to the transmissibility of Staphylococcus spp. for humans, in direct ways, such as contact with animals that are still alive, and indirect, such as contact with their by-products and/or the environments in which they are present (Chanchaithong et al., 2019; Grøntvedt et al., 2016; Oppliger et al., 2012; Peeters et al., 2015; Santos et al., 2023; Santos et al., 2022; Voss et al., 2005).

Animal products are the main transmitters of pathogenic bacteria that cause food-borne disorders, mainly related to microorganisms such as Escherichia coli, different species of Salmonella and Campylobacter, Listeria monocytogenes, Staphylococcus spp., mainly Staphylococcus aureus, among other bacteria of great importance (Abebe et al., 2020; Thorns, 2000). Such bacteria are today considered zoonosis due to their transmissibility between farm animals and individuals in contact with them, or with their products and by-products, with emphasis on those belonging to the Staphylococcus genus, the main causes of foodborne infections (Abebe et al., 2020; Fetsch and Johler, 2018; Thorns, 2000).

The presence of different species of Staphylococcus spp. in pork and its by-products has been previously described in different studies (Kim et al., 2009; Watari et al., 2021; Zeaki et al., 2019; Zhang et al., 2019; Zhang et al., 2018). Another important factor related to Staphylococcus spp. is the profile of resistance to antimicrobials that they can present, making infections more difficult to treat (Caniça et al., 2019; Santos et al., 2022).

In this way, one should think about the probable contaminations that may have occurred during the production chain, including the slaughter of these animals (Santos et al., 2023; Santos et al., 2022). Anyway, only the presence of Staphylococcus spp. in pork should already be a concern, since this microorganism, when coming from pigs, can be linked not only to food-borne infections, but also to other types of human infections.

Owing to the importance of this microorganism for the unique health, the objective of this study was to isolate Staphylococcus spp. and to characterize the resistance profile in nasal samples from pigs slaughtered for consumption.

Materials and Methods

Ethics

This project was approved by the Research Ethics Committee Involving Animal Experimentation of UNIPAR (CEPEEA/UNIPAR) under the protocol number 99012/2021.

Sample collection

Intranasal swabs from 100 pigs between 163 and 170 days of age were collected through rotational movements, immediately after bleeding in a slaughterhouse with the Federal Inspection Service in northwestern Parana. These samples were collected using a sterile swab in Stuart transport medium (SP Labor, Presidente Prudente, São Paulo). Data related to the city to which the properties of origin of these pigs belonged were also collected.

To cover all batches slaughtered on the day, a systematic collection pattern was adopted, with the collection of the nasal swab carried out from one in every three animals slaughtered, following the order of the mat, the stipulated pattern, the swab was introduced until reaching the innermost nostrils and rotating movements performed in the nasal mucosa.

Isolation of samples and identification of isolates

Each sample was cultured in brain heart infusion for 24 h at 37°C and later seeded in Mannitol Salt agar and incubated at 37°C for a period of 24 to 48 h for the isolation of Staphylococcus spp. After this period, macroscopic and microscopic characteristics were verified and biochemical tests were carried out (catalase and coagulase) to differentiate Staphylococcus spp. in coagulase positive (CoPS) and coagulase negative (CoNS) (Quinn et al., 1994).

Molecular identification of S. aureus

DNA from the CoPS samples was extracted with the Purelink Genomic DNA Kit (Invitrogen) according to the manufacturer's information. The reactions were performed using primers Sa442-1 (59-AAT CTT TGT CGG TAC ACG ATA TTC TTC ACG-39; positions 5–34) and Sa442-2 (59-CGT AAT GAG ATT TCA GTA GAT AAT ACA ACA-39 at 10 μM). For the amplifications, the parameters described by Martineau et al. (1998) were used. The amplification of the products was visualized by electrophoresis in a 2% agarose gel stained with GelRed (Uniscience). Products were detected as a single 241 bp band.

Bacterial resistance profile

The CoPS and CoNS isolates were subjected to the disk-diffusion test, performed according to the Brazilian Committee on Antimicrobial Susceptibility Testing (2021), and the antibiotics were chosen based on the “Categorization of antibiotics for use in animals for prudent and responsible use” of the European Medicines Agency (EMA, 2019): amikacin (30 μg), amoxicillin (10 μg), amoxicillin+clavulanic acid (20/10 μg), cefoxitin (30 μg), ceftiofur (30 μg), clindamycin (2 μg), chloramphenicol (30 μg), doxycycline (30 μg), erythromycin (15 μg), meropenem (10 μg), norfloxacin (10 μg), oxacillin (1 μg), and rifampicin (5 μg).

Molecular diagnosis: research of the mecA gene

The DNA of all isolates was, then, extracted to carry out the PCR, using the primers mecA1 (AAAATCGATGGTAAAGGTTGG) and mecA2 (AGTTCTGCAGTACCGGATTTG) at 5 μM (Murakami et al., 1991).

Product amplification was visualized by 2% agarose gel electrophoresis stained with GelRed (Uniscience) and the products were visualized as a single band at 533 bp.

Results

Of the 100 samples collected, it was possible to isolate 79 (79%) Staphylococcus sp.: of these, 57 isolates were CoNS and 22 isolates were CoPS, totaling 72.15% and 27.85%, respectively.

Among the CoPS isolates, 17 S. aureus isolates were identified through PCR, 77.27% of which were isolated.

Regarding bacterial resistance defined by the disk-diffusion test, the antibiotics that had the highest percentages of resistant isolates were clindamycin and erythromycin with 78 isolated (98.73%), chloramphenicol with 74 (93.67%) isolated, and doxycycline with 71 (89.87%) isolated (Table 1).

Table 1.

Number of Antibiotic Resistant Isolates Tested Against Staphylococcus spp. of Nasal Samples from Pigs Slaughtered in a Slaughterhouse with the Federal Inspection Service Located in Northwestern Parana, Brazil, 2021

Antibiotics	No. of resistant samples	Percentage of resistant samples
Amikacin	44	55.70
Amoxicillin	44	55.70
Amoxicillin+clavulanic acid	44	55.70
Cefoxitin	44	55.70
Ceftiofur	5	6.33
Clindamycin	78	98.73
Chloramphenicol	74	93.67
Doxycycline	71	89.87
Erythromycin	78	98.73
Meropenem	44	55.70
Norfloxacin	66	83.54
Oxacillin	62	78.48
Rifampicin	28	35.44

All isolates were then subjected to PCR to search for the mecA gene, where 24 (30.38%) Staphylococcus spp. were positive for this gene (MRS) and, of these, 5 (28.83%) were identified as methicillin-resistant S. aureus (SARM). Another important finding is that one (4.16%) isolate was phenotypically classified as sensitive to oxacillin, and positive for the mecA gene. The presence of the mecA gene was identified in all slaughtered lots, categorized by city, where a higher number of MRSs (41.6%) were noted in the samples collected from swine from the city of Maripá (Fig. 1).

FIG. 1.

Density of Staphylococcus spp. positive for the presence of the mecA gene in cities in the western region of the state of Paraná isolated from nasal samples of pigs slaughtered in a slaughterhouse with the Federal Inspection Service located in northwestern Parana, Brazil, 2021. Source: Map created by the authors.

Discussion

Microorganisms of the Staphylococcus genus are of great importance when related to food quality, especially regarding meat products (Grispoldi et al., 2021; Hakim et al., 2020; Velasco et al., 2018; Zhang et al., 2018). The existence of infection cases after the consumption of pork and by-products is mainly correlated with the presence of pathogenic bacteria in the hands and noses of handlers, in the environment, and even in the animal itself (Watari et al., 2021; Zeaki et al., 2019).

The presence of Staphylococcus spp. in swine has been previously described by different authors such as Eom et al. (2019), Moon et al. (2019), Nsophor and Odom (2018), Santos et al. (2023), and Tanomsridachchai et al. (2021). However, differently from what is exposed in this study, these studies describe the CoPS, mainly the S. aureus, as being the highest percentage within their studies, whereas, in this study, only 27, 85%, of the isolates were identified as CoPS and, of these, 77.27% are S. aureus.

Another study wherein the number of CoNS isolates was greater than that of CoPS, corroborating the present result, was that of Lee and Yang (2021), in which 24 CoNS isolates were identified, totaling 83% of the isolates from these authors' study. The difference regarding the number of CoPS isolates between the present study and Lee and Yang (2021), with the above, can be attributed to different factors, such as management, proximity to their keepers and other workers in this production chain, the feeding of these animals, the use of antibiotics, either as prophylactic therapy or as growth promoters or even their disuse, in addition to the swine's own nasal microbiota (Correa-Fiz et al., 2019; Espinosa-Gongora et al., 2016; Lee and Yang, 2021; Maradiaga et al., 2014; Weese et al., 2014; Zeineldin et al., 2018).

The presence of Staphylococcus spp. in pigs should be considered an One Health problem given the importance of this microorganism in human and animal health (Cuny et al., 2015; Santos et al., 2022). Such microorganisms can contaminate animal products both during the processing of this meat and during the slaughter itself (Abebe et al., 2020), in addition, Staphylococci are involved in other infections that are important for both humans and other animal species (Cuny et al., 2015; Santos et al., 2022).

In this study, 98.73% of the isolates were resistant to clindamycin and erythromycin, this result corroborates those found by Conceição et al. (2017) wherein most of the 101 isolates were also resistant to clindamycin (97%) and erythromycin (96%), as well as the study by Dressler et al. (2012), wherein 56% (14) and 60% (15) of the isolates were resistant to erythromycin and clindamycin, respectively.

In contrast, 89.87% of the isolates in this study were resistant to doxycycline, with a much greater amount than that found by Osadebe et al. (2013), where 33.34% of the 12 isolates were resistant to doxycycline, whereas 30.76% were interpreted as having intermediate resistance to this antibiotic. Neeling et al. (2007) obtained a result very similar to the present study, wherein they found resistance to doxycycline in 100% of their samples.

The high rate of resistance to clindamycin and doxycycline has already been described in the study by Osadebe et al. (2013), isolates resistant to these antibiotics belonged to properties that frequently used these drugs prophylactically and as growth promoters. The same situation was found by Guo et al. (2018) in relation to erythromycin, who also attributes the high level of resistance to this antibiotic to the high level of antimicrobial use in the production of pork for consumption, a very common situation in the pork production chain, since this practice is still used today, widely used in animal production (Broom, 2017; Cromwell, 2002; Muurinen et al., 2021).

In this study, 93.67% of the isolates expressed phenotypic resistance to chloramphenicol, similar to the study by Ho et al. (2012), wherein 71% (169) of the isolates were also resistant, whereas Lopes et al. (2019) also showed bacterial resistance to this antibiotic in their study, however, in a smaller number, 52 (33%), than that expressed in the present study, which corroborates the findings of this study.

Chloramphenicol, a broad-spectrum antibiotic, highly effective and relatively inexpensive, is banned from use in the European Union, United States, Brazil (Brasil, 2003), and other countries due to its association with aplastic anemia, and its use in animals is significantly associated with an increased chance of bacterial resistance, which is commonly related to resistance genes (Li et al., 2013; Pezza et al., 2006); to elucidate resistance to this antibiotic in this study, other diagnostic tests, such as molecular tests that look for patterns of similarity between microorganisms of human and animal microbiota, or that perform molecular typing between them, need to be carried out, mainly due to the high number of isolates with this resistance.

In this study, five (6.33%) isolates were found resistant to ceftiofur, the only antibiotic for exclusive use in veterinary medicine tested in this study, whereas Rodríguez-López et al. (2020) described an index of bacterial resistance to ceftiofur in 48.28% of their samples, which corroborates the study of Parisi et al. (2019), where the SRMs were mostly resistant to this antibiotic and several other antibiotics.

As the antibiotic with the lowest resistance rate in this study is exclusively used in veterinary medicine, the possibility of transmission/sharing between pigs and humans who are directly related to these animals, therefore, it becomes valid to promote discussions related to the topic, these being essential at the One Health level, since the spread of resistant bacteria diseases can generate complications not only in the swine production chain, but in all aspects of animal and human health that make up the agricultural chain.

Staphyococcus spp. that have the mecA gene are characterized by their phenotypic resistance to different antibacterial agents, such as penicillin, cephalosporins, chloramphenicol, cefoxitin, and oxacillin, the latter being the focus of research when it comes to the search for methicillin-resistant Staphylococcus spp. (Algammal et al., 2020; Martins and Cunha, 2007). Within the present study, 62 isolates (78.48%) were resistant to oxacillin, corroborating the high numbers found in the studies by Neeling et al. (2007), Vishovan et al. (2020), Conceição et al. (2017), Pirolo et al. (2019), and Li et al. (2017), wherein 100% of the samples tested in these studies were resistant to oxacillin, and Bonvegna et al. (2021) and Parisi et al. (2019) who obtained, respectively, a total of 15 isolates (57.70%) and 247 isolates (59.10%) resistant to this drug.

The phenotypic expression of resistance to oxacillin and/or cefoxitin is considered a major indicator of the presence of the mecA gene in Staphylococcus spp., but there are reports of the presence of this gene even in samples considered phenotypically susceptible to oxacillin (OS-SRM) (Hososaka et al., 2007; Nair et al., 2021; Zhang et al., 2020), for this reason, this study searched for this gene in all 79 (100%) isolates and, among these, PCR confirmed the presence of the gene mecA in 24 (30.38%) isolates.

The presence of the mecA gene, a resistance gene located on SCCmec, a mobile staphylococcal chromosomal cassette on the chromosome, is responsible for resistance to β-lactams, carbapenems and quinolones in the SRM (Ito et al., 2014; Lima et al., 2018; Pournaras et al., 2013). The mecA gene has already had its presence confirmed in Staphylococcus spp. isolated from pigs for consumption in the studies by Bonvegna et al. (2021), Bouchami et al. (2020), Conceição et al. (2017), Ho et al. (2012), Kittl et al. (2020), Li et al. (2017), Tanomsridachchai et al. (2021), and Tulinski et al. (2012), among others.

The results of this study corroborate studies described in recent years, which evidence the importance of this gene in the bacterial resistance found in production animals and, consequently, in their by-products that will reach final consumers.

In this study, 12.5% of the isolates carrying the mecA gene were considered susceptible to oxacillin in phenotypic tests, which is a lower result than that found in the study by Cai et al. (2021), wherein all Staphylococcus spp. isolates from market-exposed pork were susceptible to oxacillin despite the confirmed presence of the mecA gene. Quijada et al. (2019) highlight in their study the importance of animal foods as neglected dispersers of Staphylococcus spp. resistant to different antimicrobials and/or resistance gene carriers, whereas Zhang et al. (2020) show in their review the presence of OS-SRM isolates associated with infection outbreaks worldwide.

In this study, the cities where the presence of the mecA gene was recorded are located in the western region of the state of Paraná, Brazil, this information is of great importance, mainly because it is an industrial pole of swine farming in the country, generating direct jobs and holder of a large part of imports from Paraná, which retained 21.10% of the national production and where the municipality with the largest swine herd in Brazil is located, Toledo, with 1.2 million animals, one of the cities where the mecA gene was present in this study (ABPA, 2021; CNA, 2020).

As they are bacteria collected from animals intended for food, the ability of these to remain in their by-products must be taken into account, and these can be disseminated throughout the pork consumption chain, from slaughter to the final consumer, in addition to importance of their antibiotic resistance profiles, being a serious unique health problem.

Conclusion

This study highlights the presence of Staphylococcus spp. resistant to different antibiotic agents and mecA resistance gene carriers, corroborating other studies from different parts of the world. The presence of these microorganisms in nasal samples of pigs destined for human consumption shows the origin of contaminants in their meat by-products. Another important piece of information raised by the findings of this study is that animals have in their nasal cavity microorganisms resistant to antibiotics widely used in human medicine, as in the case of clindamycin, chloramphenicol, doxycycline, and erythromycin, which may have been provided by the interaction between human and animal at some point in their production chain, a situation that culminates in the difficulty of treating diseases with antimicrobials.

The presence of a Staphylococcus spp. phenotypically resistant to oxacillin, but carrying the mecA gene, evidences the possible transmission and proliferation of these genes in isolates that may not be considered of clinical importance.

Therefore, the results of this study highlight the need for the judicious use of antibiotics in swine production, in addition to aiming at continuous surveillance in relation to the rate of multiresistant microorganisms within environments that require high levels of hygiene, as is the case of the production chain of pigs. Such results also indicate the importance of understanding the possible routes of transmission of these microorganisms through these animals, which can be considered neglected dispersers of Staphylococcus spp. resistant to different antibiotics or carrying important resistance genes related to One Health.

Footnotes

Acknowledgments

We are thankful to UNIPAR and the Araucária Foundation (CP 09/2016 Institutional Program for Basic and Applied Research—Protocol: 47661.491.48325.12122016 and CP 10/2018 Pro-Equipment Program—Protocol: 51176.543.48325.29102018) for funding this research, to CAPES for concession of the PROSUP school fee, CNPq (CP 09/2020), and the slaughterhouse for their constant collaboration.

Authors' Contributions

I.C.d.S. contributed to conceptualization, investigation, writing—original draft, writing—review and editing, and visualization. L.N.B. was involved in conceptualization, investigation, and writing—review and editing. P.H.S. carried out conceptualization and investigation. K.R.d.S. was in charge of conceptualization and investigation. E.T.C. took care of formal analysis and investigation. L.M.B.C. took charge of formal analysis and investigation. L.A.M. carried out supervision and project administration. D.D.G. was in charge of supervision, project administration, conceptualization, and writing—review and editing.

Author Disclosure Statement

No conflicting financial interests exist.

Funding Information

No funding was received for this article.

References

Abebe

, Gugsa

, Ahmed

. Review on major food-borne zoonotic bacterial pathogens. J Trop Med, 2020; 4674235; doi: 10.1155/2020/4674235

ABPA—Brazilian Association of Animal Protein. Annual Report 2021 [in Portuguese]. São Paulo; 2021. Available from: http://abpa-br.org/mercados/ [Last accessed: August 21, 2021 ].

Algammal

, Hetta

, Elkelish

, et al. Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist, 2020; 3:3255–3265; doi: 10.2147/IDR.S272733

Becker

, Heilmann

, Peters

. Coagulase-negative staphylococci. Clin Microbiol Rev, 2014; 4:870–926; doi: 10.1128/cmr.00109-13

Bhargava

, Zhang

. Multidrug-resistant coagulase-negative staphylococci in food animals. J Appl Microbiol, 2012; 5:1027–1036; doi: 10.1111/j.1365-2672.2012.05410.x

Bonvegna

, Grego

, Sona

, et al. Occurrence of methicillin-resistant coagulase-negative Staphylococci (MRCoNS) and methicillin-resistant Staphylococcus aureus (MRSA) from pigs and farm environment in Northwestern Italy. Antibiotics, 2021; 6:676; doi: 10.3390/antibiotics10060676

Bouchami

, Fraqueza

, Faria

, et al. Evidence for the dissemination to humans of methicillin-resistant Staphylococcus aureus ST398 through the pork production chain: A study in a Portuguese slaughterhouse. Microorganisms, 2020; 12:1892; doi: 10.3390/microorganisms8121892

Brazil. Ministry of Agriculture, Livestock and Supply. Normative Instruction No. 9. Prohibits the manufacture, manipulation, fractioning, commercialization, import and use of the active principles chloramphenicol and nitrofuran. Official Gazette of the Union, 2003. Available from: https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-9-de-27-de-junho-de-2003.pdf/@@download/file/instrucao-normativa-no-9-de-27-de-junho-de-2003.pdf [Last accessed: November 10, 2021 ].

Brazilian Committee on Antimicrobial Susceptibility Testing (BrCAST). Cut-off tables for interpretation of CIMs and halo diameters. 2021. Available from: http://brcast.org.br/documentos/ [Last accessed: November 4, 2021 ].

10.

Broom

. The sub-inhibitory theory for antibiotic growth promoters. Poult Sci, 2017; 9:3104–3108; doi: 10.3382/ps/pex114

11.

Cai

, Zheng

, Lu

, et al. Inducible resistance to β-lactams in oxacillin-susceptible mecA1-positive Staphylococcus sciuri isolated from retail pork. Front Microbiol, 2021; 12:721426; doi: 10.3389/fmicb.2021.721426

12.

Caniça

, Manageiro

, Abriouel

, et al. Antibiotic resistance in foodborne bacteria. Trends Food Sci Technol, 2019; 41–44; doi: 10.1016/j.tifs.2018.08.001

13.

Chanchaithong

, Perreten

, Am-In

, et al. Molecular characterization and antimicrobial resistance of livestock-associated methicillin-resistant Staphylococcus aureus isolates from pigs and swine workers in Central Thailand. Microb Drug Resist, 2019; 9:1382–1389; doi: 10.1089/mdr.2019.0011

14.

CNA—Confederation of Agriculture and Livestock of Brazil. Municipal Livestock Survey (PPM) 2019: Growth of All Activities Included in the Survey in Relation to 2018–Technical Announcement. Confederation of Agriculture and Livestock of Brazil: Brasilia; 2020; p. 9.

15.

Conceição

, De Lencastre

, Aires-De-Sousa

. Frequent isolation of methicillin resistant Staphylococcus aureus (MRSA) ST398 among healthy pigs in Portugal. PLoS One, 2017; 4:e0175340; doi: 10.1371/journal.pone.0175340

16.

Correa-Fiz

, Santos

JMG

, Illas

, et al. Antimicrobial removal on piglets promotes health and higher bacterial diversity in the nasal microbiota. Sci Rep, 2019; 1:6545; doi: 10.1038/s41598-019-43022-y

17.

Cromwell

. Why and how antibiotics are used in swine production. Anim Biotechnol, 2002; 1:7–27; doi: 10.1081/ABIO-120005767

18.

Cuny

, Wieler

, Witte

. Livestock-associated MRSA: The impact on humans. Antibiotics, 2015; 4(4):521–543; doi: 10.3390/antibiotics4040521

19.

Dressler

, Scheibel

, Wardyn

, et al. Prevalence, antibiotic resistance and molecular characterisation of Staphylococcus aureus in pigs at agricultural fairs in the USA. Vet Rec, 2012; 19:495; doi: 10.1136/vr.100570

20.

Eom

, Back

, Lee

, et al. Prevalence and characteristics of livestock-associated methicillin-susceptible Staphylococcus aureus in the pork production chain in Korea. J Vet Sci, 2019; 6:e69; doi: 10.4142/jvs.2019.20.e69

21.

Espinosa-Gongora

, Larsen

, Schønning

, et al. Differential analysis of the nasal microbiome of pig carriers or non-carriers of Staphylococcus aureus . PLoS One, 2016; 8:e0160331; doi: 10.1371/journal.pone.0160331

22.

European Medicines Agency (EMA). Categorisation of Antibiotics for Use in Animals for Prudent and Responsible Use. 2019. Available from: https://www.ema.europa.eu/en/documents/report/categorisation-antibiotics-use-animalsprudent-responsible-use_en.pdf [Last accessed: November 4, 2021 ].

23.

Fetsch

, Johler

. Staphylococcus aureus as a foodborne pathogen. Curr Clin Microbiol Rep, 2018; 2:88–96; doi: 10.1007/s40588-018-0094-x

24.

González-Martín

, Corbera

, Suárez-Bonnet

, et al. Virulence factors in coagulase-positive staphylococci of veterinary interest other than Staphylococcus aureus . Vet Q, 2020; 1:118–131; doi: 10.1080/01652176.2020.1748253

25.

Grispoldi

, Karama

, Armani

, et al. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital J Anim Sci, 2021; 1:677–690; doi: 10.1080/1828051X.2020.1871428

26.

Grøntvedt

, Elstrøm

, Stegger

, et al. Methicillin-resistant Staphylococcus aureus CC398 in humans and pigs in Norway: A “One Health” perspective on introduction and transmission. Clin Infect Dis, 2016; 11:1431–1438; doi: 10.1093/cid/ciw552

27.

Guo

, Liu

, Han

, et al. Phenotypic and molecular characteristics of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolated from pigs: Implication for livestock-association markers and vaccine strategies. Infect Drug Resist, 2018; 11: 1299–1307; doi: 10.2147/IDR.S173624

28.

Hakim

, Bakry

, Samy

, et al. Staphylococcus aureus a public health concern of retail pork and pork by-products with spot on Egyptian markets: Public health concern of retail pork. Xeno J Biomed Sci, 2020; 1:20–26.

29.

, O'donoghue

, Guardabassi

, et al. Characterization of methicillin-resistant Staphylococcus aureus isolates from pig carcasses in Hong Kong. Zoonoses Public Health, 2012; 6:416–423; doi: 10.1111/j.1863-2378.2012.01473.x

30.

Hososaka

, Hanaki

, Endo

, et al. Characterization of oxacillin-susceptible mecA-positive Staphylococcus aureus: A new type of MRSA. J Infect Chemother, 2007; 2:79–86; doi: 10.1007/s10156-006-0502-7

31.

Ito

, Kuwahara

, Hiramatsu

. Staphylococcal cassette chromosome mec (SCC mec) analysis of

MRSA

. In: Methicillin-Resistant Staphylococcus Aureus. (MRSA) Protocols. (Ji Y. ed.) Springer: New York, NY, USA; 2014.

32.

Kim

, Griffiths

, Fazil

, et al. Probabilistic risk model for staphylococcal intoxication from pork-based food dishes prepared in food service establishments in Korea. J Food Prot, 2009; 9:1897–1908; doi: 10.4315/0362-028X-72.9.1897

33.

Kittl

, Brodard

, Heim

, et al. Methicillin-resistant Staphylococcus aureus strains in Swiss pigs and their relation to isolates from farmers and veterinarians. Appl Environ Microbiol, 2020; 5:e01865-19; doi: 10.1128/AEM.01865-19

34.

Lee

, Yang

. Profiles of coagulase-positive and-negative staphylococci in retail pork: Prevalence, antimicrobial resistance, enterotoxigenicity, and virulence factors. Anim Biosci, 2021; 4:734; doi: 10.5713/ajas.20.0660

35.

, Jiang

, Ke

, et al. Characterization of pig-associated methicillin-resistant Staphylococcus aureus . Vet Microbiol, 2017; 183–187; doi: 10.1016/j.vetmic.2017.01.017

36.

, Shao

, Shen

, et al. Occurrence of chloramphenicol-resistance genes as environmental pollutants from swine feedlots. Environ Sci Technol, 2013; 6:2892–2897; doi: 10.1021/es304616c

37.

Lima

MFP

, Borges

, Parente

, et al. Staphylococcus aureus and nosocomial infections—Literature Review [in Portuguese]. Rev Uningá Rev, 2018; 1:32–39.

38.

Lopes

, Conceição

, Poirel

, et al. Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics. PLoS One, 2019; 11:e0225497; doi: 10.1371/journal.pone.0225497

39.

Maradiaga

, Zeineldin

, Aldridge

, et al. Influence of maternal microbial communities on the mucosal microbiome of neonatal pigs. AASV, 2014; 2014:1–39. Available from: https://www.aasv.org/foundation/research/2014_Lowe_CrossFostering.pdf

40.

Martineau

, Picard

, Roy

, et al. Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus . J Clin Microbiol, 1998; 3:618–623; doi: 10.1128/jcm.36.3.618-623.1998

41.

Martins

, Cunha

MLRS

. Methicillin resistance in Staphylococcus aureus and coagulase-negative staphylococci: Epidemiological and molecular aspects. Microbiol Immunol, 2007; 9:787–795; doi: 10.1111/j.1348-0421.2007.tb03968.x

42.

Moon

, Jeong

, Hyun

, et al. Prevalence and characteristics of methicillin-resistant Staphylococcus aureus isolates in pigs and pig farmers in Korea. Foodborne Pathog Dis, 2019; 4:256–261; doi: 10.1089/fpd.2018.2509

43.

Murakami

, Minamide

, Wada

, et al. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol, 1991; 10:2240–2244; doi: 10.1128/jcm.29.10.2240-2244.1991

44.

Muurinen

, Richert

, Wickware

, et al. Swine growth promotion with antibiotics or alternatives can increase antibiotic resistance gene mobility potential. Sci Rep, 2021; 1:1–13; doi: 10.1038/s41598-021-84759-9

45.

Nair

, Shashindran

, Kumar

, et al. Comparison of phenotypic MRSA detection methods with PCR for mecA Gene in the background of emergence of oxacillin-susceptible MRSA. Microb Drug Resist, 2021; 27:1190–1194; doi: 10.1089/mdr.2020.0361

46.

Neeling

, Van den Broek

MJM

, Spalburg

, et al. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol, 2007; 122:366–372; doi: 10.1016/j.vetmic.2007.01.027

47.

Nsofor

, Odom

. Distribution and antibiotics susceptibility pattern of Staphylococcus aureus isolated from pigs in Ahiara, Imo state Nigeria. MOJ Cell Sci Rep, 2018; 5:78–81; doi: 10.1540/6/mojcsr.2018.05.00120

48.

Oppliger

, Moreillon

, Charrière

, et al. Antimicrobial resistance of Staphylococcus aureus strains acquired by pig farmers from pigs. Appl Environ Microbiol, 2012; 78:8010–8014; doi: 10.1128/AEM.01902-12

49.

Osadebe

, Hanson

, Smith

, et al. Prevalence and characteristics of Staphylococcus aureus in Connecticut swine and swine farmers. Zoonoses Public Health, 2013; 60(3):234–243; doi:10.1128/AEM.01902-12

50.

Parisi

, Caruso

, Normanno

, et al. MRSA in swine, farmers and abattoir workers in Southern Italy. Food Microbiol, 2019; 82:287–293; doi: 10.1016/j.fm.2019.03.003

51.

Peeters

, Argudín

, Azadikhah

, et al. Antimicrobial resistance and population structure of Staphylococcus aureus recovered from pigs farms. Vet Microbiol, 2015; 180:151–156; doi: 10.1016/j.vetmic.2015.08.018

52.

Pexara

, Solomakos

, Govaris

. Occurrence, antibiotic resistance and enteroxigenicity of Staphylococcus spp. in tonsils of slaughtered pigs in Greece. Lett Appl Microbiol, 2020; 71:394–399; doi: 10.1111/lam.13342

53.

Pezza

, Ríos À, Nozal

, et al. Simultaneous determination of chloroamphenicol, thiamphenicol and florfenicol residues in bovine milk by micellar electrokinetic chromatography. Quim Nova, 2006; 29:926–931; doi: 10.1590/S0100-40422006000500008

54.

Pirolo

, Gioffrè

, Visaggio

, et al. Prevalence, molecular epidemiology, and antimicrobial resistance of methicillin-resistant Staphylococcus aureus from swine in southern Italy. BMC Microbiol, 2019; 19:1–12; doi: 10.1186/s12866-019-1422-x

55.

Pournaras

, Stathopoulos

, Tsakris

. Oxacillin-susceptible MRSA: Could it become a successful MRSA type?. Future Microbiol, 2013; 8:1365–1367; doi: 10.2217/fmb.13.118

56.

Quijada

, Hernández

, Oniciuc

, et al. Oxacillin-susceptible mecA-positive Staphylococcus aureus associated with processed food in Europe. Food Microbiol, 2019; 82:107–110; doi: 10.1016/j.fm.2019.01.021

57.

Quinn

, Carter

, Markey

, et al. Clinical Veterinary Microbiology. London: Wolfe, 1994.

58.

Rodríguez-López

, Filipello

, Di Ciccio

, et al. Assessment of the antibiotic resistance profile, genetic heterogeneity and biofilm production of methicillin-resistant Staphylococcus aureus (MRSA) isolated from the Italian swine production chain. Foods, 2020; 9:1141; doi: 10.3390/foods9091141

59.

Santos

, Barbosa

, Martins

, et al. Presence of antibiotic-resistant bacteria in pigs for consumption-one health challenge-literature review. Semina Ciêns Agrar, 2022; 43(6):2823–2844; doi: 10.5433/1679-0359.2022v43n6p2823

60.

Santos

, Barbosa

, Grossi

, et al. Presence of Staphylococcus spp. carriers of the mecA gene in the nasal cavity of piglets in the nursery phase. Res Vet Sci, 2023; 155:51–55; doi: https://doi.org/10.1016/j.rvsc.2023.01.006

61.

Tanomsridachchai

, Changkaew

, Changkwanyeun

, et al. Antimicrobial resistance and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from slaughtered pigs and pork in the Central Region of Thailand. Antibiotics, 2021; 10:206; doi: 10.3390/antibiotics10020206

62.

Thorns

. Bacterial food-borne zoonoses. Rev Sci Tech, 2000; 19:226–239; doi: 10.2050/6/rst.19.1.1219

63.

Tulinski

, Fluit

, Wagenaar

, et al. Methicillin-resistant coagulase-negative staphylococci on pig farms as a reservoir of heterogeneous staphylococcal cassette chromosome mec elements. Appl Environ Microbiol, 2012; 78:299–304; doi: 10.1128/AEM.05594-11

64.

Velasco

, Vergara

, Bonilla

, et al. Prevalence and characterization of Staphylococcus aureus strains in the pork chain supply in Chile. Foodborne Pathog Dis, 2018; 15:262–268; doi: 10.1089/fpd.2017.2381

65.

Vishovan

, Ushkalov

, Kepple

, et al. Antimicrobial resistance and biological properties of Staphylococcus spp. isolated from pigs. One Health Risk Manag, 2020; 1; doi: 10.5281/zenodo.3701192

66.

Voss

, Loeffen

, Bakker

, et al. Methicillin-resistant Staphylococcus aureus in pig farming. Emerg Infect Dis, 2005; 11:1965; doi: 10.3201/eid1112.050428

67.

Watari

, Tachibana

, Okada

, et al. A review of food poisoning caused by local food in Japan. J Gen Fam Med, 2021; 22:15–23; doi: 10.1002/jgf2.384

68.

Weese

, Slifierz

, Jalali

, et al. Evaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus (MRSA) carriage. BMC Vet Res, 2014; 10:1–10; doi: 10.1186/1746-6148-10-69

69.

Zeaki

, Johler

, Skandamis

, et al. The role of regulatory mechanisms and environmental parameters in staphylococcal food poisoning and resulting challenges to risk assessment. Front Microbiol, 2019; 10:1307; doi: 10.3389/fmicb.2019.01307

70.

Zeineldin

, Aldridge

, Blair

, et al. Microbial shifts in the swine nasal microbiota in response to parenteral antimicrobial administration. Microb Pathog, 2018; 121:210–217; doi: 10.1016/j.micpath.2018.05.028

71.

Zhang

, Miao

, Zhou

, et al. Characterization of oxacillin-susceptible mecA-positive Staphylococcus aureus from food poisoning outbreaks and retail foods in China. Foodborne Pathog Dis, 2020; 17:728–734; doi: 10.1089/fpd.2019.2774

72.

Zhang

, Wang

, Cai

, et al. Prevalence of enterotoxin genes in Staphylococcus aureus isolates from pork production. Foodborne Pathog Dis, 2018; 15:437–443; doi: 10.1089/fpd.2017.2408