A Novel B-Cell Epitope of Avian Infectious Bronchitis Virus N Protein

Abstract

This report describes the identification of a novel linear B-cell epitope at the N-terminus of the avian infectious bronchitis virus (IBV) nucleocapsid (N) protein. A monoclonal antibody designated 2D2 was prepared against the IBV N protein, and a series of 23 partially overlapping, tagged fragments of the IBV N gene were expressed. These peptides and five heterogeneous IBV strains were used to identify the epitope recognized by 2D2 using enzyme-linked immunosorbent assay (ELISA) and Western blotting analysis. The linear motif ¹¹DSPAPIIKLGG²¹, located at the N-terminus of the N protein, was identified as the epitope bound by 2D2. ELISA and Western blotting also showed that this epitope was recognized by IBV-positive chicken serum. We propose that this motif is a linear B-cell epitope of N protein, and is the core sequence for reactivity, as demonstrated by binding of 2D2 to the truncated peptides and different IBV strains. Alignment and comparison of the 2D2-defined epitope with other coronavirus sequences showed that the epitope is conserved among avian coronaviruses. The identified epitope might be useful for clinical applications and as a tool for further study of the structure and function of the IBV N protein.

Introduction

T he family Coronaviridae, order Nidovirales contains large enveloped RNA viruses of medical and veterinary importance. They principally cause respiratory or enteric diseases, but may also be involved in neurological illnesses or hepatitis (11,29). Coronaviruses are classified into three groups based on the genetic and antigenic relationships between the species of different groups (11,29). The prototype of the Coronaviridae is infectious bronchitis virus (IBV) (3), whose three major structural proteins are spike (S), membrane (M), and the phosphorylated nucleocapsid (N) protein. The S protein is cleaved by a trypsin-like host protease into two polypeptides, S1 and S2, which carry virus-neutralizing and serotype-specific determinants (2). The M glycoprotein is involved in virion envelope structure (29).

The N protein, which is the most abundant viral structural protein, is associated with the viral RNA genome (29). Although its primary function is formation of the viral ribonucleoprotein complex, several studies indicate that it is multifunctional. Its intracellular localization suggests that it is a likely component of the coronavirus replication and transcription complex. Although one study found that N is not involved in immune protection (12), it can induce high titers of cross-reactive antibodies and induce cell-mediated immunity that protects chickens from acute infection (12,38,44), so it is used as a target protein in designing infectious bronchitis (IB) vaccines (45). The N protein is highly conserved, showing 91.0–96.5% similarity among different IBV strains (47). It is abundantly expressed during infection. These features make the IBV N protein a frequent target of diagnostic applications (9,33).

To understand antigenicity and virus-antibody interactions at the molecular level for vaccine design and other clinical applications, the location of viral protein epitopes must be identified. However, few B-cell epitopes associated with the above functions have been mapped in the IBV N protein. Seah et al. (37) expressed the full-length N protein as 12 overlapping fragments in Escherichia coli (E. coli), and found that seven contained B-cell epitopes, with the most antigenic regions between amino acids 175–241, 310–409, and 360–409. Ignjatovic and Sapats (13) recently identified a conformation-independent epitope (amino acid residues 72–86) that induced a delayed-type hypersensitivity response, but in spite of being antigenic, it did not confer protection against IBV. All epitopes identified in IBV N protein have not been finely mapped, and the core sequences of the identified and other epitopes need to be investigated.

Monoclonal antibodies (mAbs) are widely used as powerful tools for identifying linear epitopes, or for mimicking epitopes of a variety of infectious agents (8,18). In this study, we prepared a mAb against N protein from the IBV strain CK/CH/LDL/97I, and used it to screen for linear B-cell epitopes. The results provided important information for vaccine design, the development of specific serological diagnostics of IBV infection, and for better understanding of the antigenic structure of N protein.

Materials and Methods

Virus propagation in specific pathogen-free embryonated eggs

IBV strain CK/CH/LDL/97I (25) was used for N gene cloning and for preparation and identification of the mAb. This IBV strain is a novel IBV strain type isolated in 1997 from the swollen proventricular tissues of infected chickens in Dalian, Liaoning province, China. It has been associated with some IB outbreaks in recent years in China (25). For Western blotting, five heterogeneous IBV strains composed of four field strains and one commercially available vaccine strain were used to represent different IBV types (Table 1) (24,26). The five heterogeneous IBV strains were used to determine if the identified epitope was conserved among the different IBV serotypes circulating in China. All IBV strains were propagated once in 9- to 11-day-old specific pathogen-free (SPF) embryonated chicken eggs, and the presence of viral particles in the allantoic fluid of inoculated eggs was confirmed with a negative contrast electron microscope as previously described (23).

Table 1.

Background Information of the Five Heterogeneous IBV Strains Used in This Study

IBV strain	Country ^a	Year ^b	Type	GenBank accession number/reference
H120	Vaccine	—	Mass	AY856349
tl/CH/LDT3/03	China (Guangdong)	2003	tl/CH/LDT3/03	AY702975/26
CK/CH/LSD/05I	China (Shandong)	2005	Variant	EU637854/24
CK/CH/LHLJ/04V	China (Heilongjiang)	2004	LX4	FJ821744/25
Australia-T	Australia	—	Nephropathogenicity	U52596/25

Country (province) where the viruses were isolated.

Year when the viruses were isolated.

Fertile white Leghorn SPF embryonated chicken eggs were obtained from the Laboratory Animal Center, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, China.

Generation of mAbs

Two 8-week-old BALB/c female mice were immunized subcutaneously with condensed IBV CK/CH/LDL/97I virus-infected allantoic fluids (48) mixed with Freund's complete adjuvant, followed by two booster immunizations. Protocols used for the preparation of mAbs and ascetic fluids were as previously described (36,46,48). All hybridomas were cloned by at least three rounds of limiting dilution. Primary screening of hybridomas was by enzyme-linked immunosorbent assay (ELISA) using IBV CK/CH/LDL/97I virus particles as coating antigen. mAb class and subclass were determined using an SBA Clonotyping System/HRP kit (Southern Biotechnology Associates, Birmingham, AL).

Construction of expression vectors and expression of fusion proteins

The N gene and all truncated N gene fragments (Fig. 1) were amplified from the IBV CK/CH/LDL/97I strain as previously described (25). Genes and gene fragments were cloned into the pGEX-6P-1 vector (Pharmacia, Brussels, Belgium) using EcoR I and Hind III sites that were introduced into the sense and negative-sense primers, respectively. A collection of expression clones corresponding to the entire N gene or truncated fragments was constructed and sequenced. Sequences and locations of primers are shown in Table 2.

FIG. 1.

Schematic diagram showing the truncated fragments from the IBV CK/CH/LDL/97I N protein and their relative positions. Letters represent the amino acid positions. The names of the peptides are shown in Table 2. Bars represent truncated N peptides. Peptides that were negative by Western blotting with mAb 2D2 are in dark grey, and peptides that were positive are in light grey.

Table 2.

Sequences of the Primers Used in This Study

	Primer sequences (5′-3′) ^a
Fragment	Sense	Negative-sense	Position in N gene ^b	Size of amplified (bp)
NP	GGATCCATGGCGAGCGGTAAAGCA	GTCGACTTACAACTCATTCTCTCCAAG	1–1230	1230
NP1	GGATCCATGGCGAGCGGTAAAGCA	GTCGACTTATCCTGTTCCAGTGTAATAGAA	1–297	297
NP2	GGATCCATGAAAGGCGGAAGAAAACCAGTC	GTCGACTTACAGAGGAATGAAGTCCCA	241–481	240
NP3	GGATCCATGTCAGATGGAGGACCTGAT	GTCGACTTAATCACCAAAATTACCCTC	433–763	330
NP4	GGATCCATGTATAGAGTAGATCAAGTT	GTCGACTTAATCACAAATTTTTACATA	706–966	260
NP5	GGATCCATGACTACTGTGGTGCCTAGA	GTCGACTTACAACTCATTCTCTCCAAG	907–1230	323
NP1-1	GCAATGGATCCATGGCGAGCGGTAAA	GCAATGTCGACTTATGGTTTAGGGCCTCC	1–72	72
NP1-2	GCAATGGATCCATGCCAATCATCAAACTA	GCAATGTCGACTTACTTCTTGGCCTTTAG	43–129	87
NP1-3	GCAATGGATCCATGTCTTGGTTTCAAGCC	GCAATGTCGACTTATTTAAGATTTTCATT	100–189	90
NP1-4	GCAATGGATCCATGAGCGGTGTTCCTGAT	GCAATGTCGACTTAGCCTTTACTTGGCTT	160–246	87
NP1-5	GCAATGGATCCATGCGCCAAGCTAGGTAT	GCAATGTCGACTTATCCAGTGTAATAGAA	217–298	81
NP1-1-1	GCAATGGATCCATGGCGAGCGGTAAA	GCAATGTCGACTTATGGCGCGGGGGAGTC	1–45	45
NP1-1-2	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTATGGTTTAGGGCCTCC	28–72	45
NP14	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTATTTAGGGCCTCCTAG	28–69	42
NP13	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTAAGGGCCTCCTAGTTT	28–66	39
NP12	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTAGCCTCCTAGTTTGAT	28–63	36
NP11	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTATCCTAGTTTGATGAT	28–60	33
NP10	GCAATGGATCCTCAGACTCCCCCGCG	GCAATGTCGACTTATAGTTTGATGATTGG	28–57	33
NP9	GCAATGGATCCGACTCCCCCGCGCCA	GCAATGTCGACTTAGCCTCCTAGTTTGAT	31–63	30
NP8	GCAATGGATCCTCCCCCGCGCCAATC	GCAATGTCGACTTAGCCTCCTAGTTTGAT	34–63	30
NP7	GCAATGGATCCCCCGCGCCAATCATC	GCAATGTCGACTTAGCCTCCTAGTTTGAT	37–63	27
NP6	GCAATGGATCCGCGCCAATCATCAAA	GCAATGTCGACTTAGCCTCCTAGTTTGAT	40–63	24
NP5	GCAATGGATCCCCAATCATCAAACTA	GCAATGTCGACTTAGCCTCCTAGTTTGAT	43–63	21

Underlined letters indicate additional restriction enzyme sites (Bam HI and Sal I) introduced into each primer. The boxed ATGs were the start codon of the IBV CK/CH/LHLJ/04V M gene, and the TTAs were the stop codon of the N gene or additions introduced into the negative-sense primers of the N fragments.

The nucleotide positions correspond to those in the sequence of the IBV CK/CH/LDL/97I N gene (GenBank accession no. EF602445).

Each recombinant expression construct was transformed into E. coli BL21 (DE3) (Novagen, Gibbstown, NJ). A series of fusion proteins with the expected molecular weights were induced by IPTG as previously described (48), and stained with Coomassie blue after SDS-PAGE, also as previously described (48). For preparation of purified proteins, inclusion body proteins were separated by SDS-PAGE, the proteins of interest were excised, and gel slices were crushed and added to an appropriate volume of sterilized PBS. The extracted proteins were used for Western blotting and ELISA.

SDS-PAGE and Western blotting

The specificity and reactivity of the mAbs were determined by Western blotting using recombinant N protein, IBV strain CK/CH/LDL/97I, and the five heterogeneous strains (Table 1). Purified recombinant N protein and condensed IBV infectious allantoic fluids were separated by denaturing SDS-PAGE. For Western blotting, the proteins were transferred onto nitrocellulose membranes, and detected as previously described (48). Purified GST protein and the sterilized allantoic fluids of SPF eggs were used as negative antigen controls. SPF chicken sera were used as a negative serum control.

Indirect ELISA

The specificity of the mAb was determined by indirect ELISA using IBV CK/CH/LDL/97I virus particles as the coating antigen as previously described (48). A commercial total antibody ELISA (IDEXX Corp., Westbrook, ME) was used with some modifications to the manufacturer's instructions, specially, the tested mAb replaced the serum samples, and HRP-conjugated sheep anti-mouse IgG was used to replace the goat anti-chicken IgG. Antibodies against IBV were the positive control, and SPF sera were the negative control. All assays were performed in triplicate. The reactivity of the mAbs with different truncated recombinant N proteins was determined by ELISA, as previously described (48). All assays were performed in triplicate and the serum-to-positive ratios (S/P ratios) were calculated as previously described (39,40,41).

Comparison of the epitope-containing sequence with other coronaviruses

The sequences containing the epitope were assembled, aligned, and compared with coronavirus strains using the MEGALIGN program in DNAStar. The sequences of the reference coronaviruses were from the GenBank database, with the GenBank accession number in Fig. 2.

FIG. 2.

Alignment of the epitope motif in 20 group 3 coronaviruses. Epitope sequences are underlined and amino acid residues in the epitope region that are shared by different coronaviruses are in grey. Deleted amino acid residues are represented by dashes (TCoV, turkey coronavirus). GenBank accession numbers are in parentheses.

Results

Expression of recombinant proteins

The strategy for expressing IBV N and truncated N fragments is shown in Fig. 1. The entire N gene and truncated fragments were expressed as GST fusion proteins in E. coli BL21 (DE3). All the proteins were successfully expressed and examined by SDS-PAGE of cell lysates after induction with IPTG. The recombinant N protein reacted with a chicken antibody against IBV by both ELISA (Fig. 3A) and Western blotting (Fig. 3B).

FIG. 3.

Reactivity of recombinant N protein with chicken antibody against IBV by ELISA (A) and Western blotting (B). Recombinant N protein was used as coated antigen in the ELISA test, and IBV strain CK/CH/LDL/97I was used as a positive control in A. Chicken antibody against IBV was used to react with recombinant N protein and CK/CH/LDL/97I virus. SPF chicken sera were used as negative antibody controls. Dashes show the S/P ratios, calculated as described in the materials and methods section. Serum samples with S/P ratios equal to or above the dashes were considered positive, and those below were considered negative. In the Western blotting, only recombinant N protein was used to react with chicken antibody against IBV, and SPF chicken sera was used a negative control.

Production of IBV N mAb 2D2

The hybridoma 2D2 was found to secrete mAbs against the IBV CK/CH/LHLJ/04V N protein. The produced mAbs recognized both recombinant N protein and native IBV CK/CH/LDL/97I antigen by Western blotting (Fig. 4A). The reactivity and specificity of mAb 2D2 were confirmed using both a commercial ELISA and an ELISA in which whole IBV CK/CH/LHLJ/04V virus particles were used as the coating antigen (Fig. 4B). The mAb 2D2, which was determined to be IgG₁ (κ), was used for additional studies.

FIG. 4.

Reactivity of mAb 2D2 with IBV strain CK/CH/LDL/97I and recombinant N protein by Western blotting (A) and ELISA (B). In Western blotting, mouse serum was used as a negative antibody control when IBV strain CK/CH/LDL/97I was used to react with mAb 2D2, and recombinant GST protein was used as a negative antigen control when recombinant N-GST protein was probed with mAb 2D2. By ELISA, the commercially available IBV-coated plates and IBV CK/CH/LDL/97I particles, and recombinant N-GST protein-coated plates were used as antigens to test mAb 2D2. Recombinant GST protein was used as antigen control. Mouse sera were negative antibody controls. Dashes show the S/P ratios, calculated as described in the materials and methods section. Serum samples with S/P ratios equal to or above the dashes were considered positive, and those below were considered negative.

Localization of the mAb 2D2-defined epitope

The GST-fusion proteins were used for fine mapping of the epitope of the IBV CK/CH/LDL/97I antigen that is recognized by 2D2 (Fig. 1). Western blotting showed that the minimal recognition sequence appeared to be ¹⁰SDSPAPIIKLGG²¹, because deletion of S¹⁰ or G²¹ destroyed the binding of mAb 2D2 to the GST-fusion peptides (Fig. 5A). Therefore, by Western blotting the linear epitope recognized in the N protein of IBV strain CK/CH/LHLJ/04V by 2D2 was ¹⁰SDSPAPIIKLGG²¹. However, the minimal sequence identified by ELISA was ¹⁰SDSPAPIIKLGGP²², using the truncated peptides as coating antigens (Fig. 5B). Thus the linear B-cell epitope in the N protein of IBV recognized by mAb 2D2 appeared to be localized within ¹⁰SDSPAPIIKLGGP²¹.

FIG. 5.

Fine localization of the mAb 2D2 epitope. Reactivity of mAb 2D2 with truncated recombinant N proteins by Western blotting (A) and ELISA (B). Names of the proteins are shown in Table 2. GST was used as a negative control in both assays. In Western blotting, + and − represent positive and negative, respectively. The protein molecular markers are indicated by the arrows. By ELISA, the dashed line indicates the S/P ratio, calculated as described in the Materials and Methods section. Serum samples with S/P ratios equal to or above the dashes were considered positive, and those below were considered negative. The black columns represent the reactivity of the truncated recombinant N proteins with mAb 2D2, and the grey columns show the reactivity of truncated recombinant N proteins with mouse sera (negative controls).

Localization of 2D2-bound epitope by cross-reactivity of heterogeneous IBV strains

We examined the cross-reactivity of mAb 2D2 with five IBV strains, representing five different serotypes. As illustrated in Fig. 6, all heterogeneous IBV strains cross-reacted with mAb 2D2, with Western blotting of infected allantoic fluids showing a pronounced band of the expected molecular weight except CK/CH/LHLJ/04V, which had an additional small band. The sequence consistently shared by the CK/CH/LDL/97I strain and the five heterogeneous IBV strains was ¹¹DSPAPIIKLGG²¹, as indicated in Fig. 6. Thus the linear B-cell epitope in the IBV N protein recognized by mAb 2D2 appeared to be precisely localized within ¹¹DSPAPIIKLGG²¹, which is located at the N-terminus of the IBV N protein.

FIG. 6.

Reactivity of mAb 2D2 with five heterogenous IBV strains by Western blotting, and alignment of the epitope motif with the five strains. Epitope sequences are underlined and amino acid residues in the epitope region that are shared by different coronaviruses are in grey. Deleted amino acid residues are represented by dashes. The GenBank accession numbers are as shown in Table 1.

Reactivity of the identified epitope with anti-IBV antibody

The peptide ¹¹DSPAPIIKLGG²¹, which corresponded to the epitope defined for mAb 2D2, was used as the coating antigen in ELISA assays, which demonstrated that this peptide was also recognized by a chicken anti-IBV antibody (Fig. 7A). The peptide showed similar reactivity by Western blotting analysis (Fig. 7B), further confirming the reactivity of this epitope.

FIG. 7.

Reactivity of the identified epitope (¹¹DSPAPIIKLGG²¹) with antibodies against IBV. The peptide corresponding to the mAb 2D2-defined epitope was the coating antigen for ELISA, and NP12 and NP8 were used as the positive and negative controls, respectively. Anti-IBV chicken antibody was the primary antibody, and SPF chicken sera were the negative controls (A). The peptide showed similar reactivity by Western blotting analysis (B).

Alignment of the 2D2-defined sequence with other coronaviruses

Only a limited number of heterogeneous IBV strains could be used in 2D2 cross-reactivity tests, and no other group 3 coronavirus strains were available in our laboratory. Therefore, we aligned and compared the regions containing the sequence DSPAPIIKLGG from 11 heterogeneous strains, representing 11 additional IBV serotypes from different global regions, and 9 other group 3 coronaviruses that infect three different hosts. The results showed that 9 of the 11 residues in the mAb 2D2-defined sequence were highly conserved among chicken, turkey, pheasant, and pigeon group 3 coronaviruses (Fig. 2). This indicated that the ¹¹DSPAPIIKLGG²¹ sequence represents a relatively conserved epitope on the avian coronaviruses' N proteins. Sequences from other coronaviruses from different groups or subgroups were used for comparison, but no sequences corresponding to the 2D2-defined epitope were found (data not shown).

Discussion

The three major coronavirus structural proteins are the S and M glycoproteins, and the nucleocapsid N protein (29). These are the main targets for vaccine design, and for the development of immunity-based prophylactic, therapeutic, and diagnostic techniques for controlling coronavirus. To date, identification of B-cell antigenic epitopes for the IBV S, N, and M proteins has been limited, although some of the epitopes induce the production of virus-neutralizing antibodies, and provide protection against virulent viruses (1,12,13,15,17,19,20,21,30,34,37,38,48). In this study, we discovered a novel linear B-cell epitope at the N-terminus of the IBV N protein.

In this study, we generated the mAb 2D2, and found that it reacted specifically against native IBV CK/CH/LDL/97I particles, as well as against recombinant N protein. However, an additional small band was also observed by Western blotting analysis using recombinant N protein to react with both mAb 2D2 and anti-IBV antibody, which may be cleaved by bacterial cellular proteases (4,7,31,32,42). To study the specificity in more detail and to finely map the epitope bound by mAb 2D2, a series of 23 partially overlapping fragments covering the N gene of IBV CK/CH/LDL/97I were expressed with a GST tag, and used to screen for the minimal epitope. Five heterogenous IBVs were also used to identify the minimal epitope sequence by Western blotting and ELISA. ELISA using recombinant proteins as coating antigens showed that the core sequence was ¹⁰SDSPAPIIKLGGP²², while Western blotting indicated that the minimal sequence was ¹⁰SDSPAPIIKLGG²¹. This discrepancy may be attributed to the sensitivity of the methods (27,28). Interestingly, we found that mAb 2D2 reacted with five heterogenous IBVs by Western blotting, although the proteins recognized by the mAb 2D2 in most of the viruses produced very faint bands. The bound sequence shared by CK/CH/LDL/97I and the five heterogenous IBV strains was ¹¹DSPAPIIKLGG²¹, which was one amino acid shorter than the sequence recognized using the truncated recombinant N proteins as antigens. This may be because the recombinant N protein expressed in E. coli had lower antigenicity compared to the native protein in the IBV particles. In addition, the N-terminal GST moiety might interfere with binding of mAb 2D2 to the recombinant protein. Compared to our previous reports (43,48), the positive ELISA test values using recombinant proteins as coating antigens were slightly lower (not more than 0.5) (Fig. 5B). Taken together, we conclude that the core sequence of the epitope defined by mAb 2D2 in the IBV N protein is ¹¹DSPAPIIKLGG²¹.

To date, the identified linear and conformation-independent B-cell epitope regions of IBVs have been at amino acid positions 72–86, 175–241, 310–409, and 360–409 (13,37). In this study, mAb 2D2 identified a novel linear B-cell epitope at positions 11–21. To our knowledge, this is the first finely-mapped B-cell epitope in the IBV N protein. Furthermore, we found that this epitope is highly conserved among avian coronaviruses. The coronaviruses isolated from different avian species (chicken: IBV; turkey: TCoV; pheasant: PhCo; and pigeon: pigeon coronavirus) have been proposed to be distinct species (6). In different avian species, the S gene of coronaviruses does not have more than 57% identity. However, the N genes show higher identity among coronaviruses of avian species (5,10,16), and little has been known about antigenic epitopes within the structural proteins of avian coronaviruses, except for the IBVs. The conserved epitope shared by the avian coronaviruses' N proteins is important, not only because the avian coronaviruses have economic impact on the poultry industry, but also because they also show antigenic and biological similarities to other coronaviruses.

Viral upper respiratory diseases such as IBV (23), Newcastle disease (ND) (22), subtype H9 avian influenza virus infection (14), and infectious laryngotracheitis (35) are a serious problem in the field farms of China. Detection of IBV infection in poultry flocks is a major challenge because of the difficulty in differentiating this condition from other upper respiratory diseases. Appropriate diagnostic methods are needed and are an important tool for taking appropriate preventive steps. Another problem complicating IBV detection and diagnosis is the existence of at least nine IBV types co-circulating in vaccinated and non-vaccinated chicken flocks (23). The mAb 2D2 and its epitope identified in this study will be useful for clinical applications, and as a tool for further study of IBV detection and diagnosis. Since epitopes were mapped via expression in prokaryotes, the subclones allowed rapid screening of large numbers of mAbs, and more precise definition of the epitope's location. The truncated recombinant proteins generated in this study may be useful tools for mapping other epitopes on IBV N proteins in future studies.

Footnotes

Acknowledgment

This work was funded by a grant from the National Key Technology R&D Program of the Ministry of Science and Technology of the People's Republic of China (no. 2006BAD06A03).

Author Disclosure Statement

No competing financial interests exist.

References

Boots

AMH

, Kusters

, van Noort

, Zwaagstra

, Rijke

, van der Zeijst

, Hensen

. Localization of a T-cell epitope within the nucleocapsid protein of avian coronavirus. Immunology, 1991; 74:8–13.

Bosch

, Van Der Zee

, De Haan

, Rottier

. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J Virol, 2003; 77:8801–8811.

Boursnell

, Brown

, Foulds

, Green

, Tomley

, Binns

. Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus. J Gen Virol, 1987; 68:57–77.

Breslin

, Smith

, Guy

. Baculovirus expression of turkey coronavirus nucleocapsid protein. Avian Dis, 2001; 45:136–143.

Cavanagh

, Mawditt

, Welchman

, Britton

, Gough

. Coronaviruses from pheasants (Phasianus colchicus) are genetically closely related to coronaviruses of domestic fowl (infectious bronchitis virus) and turkeys. Avian Pathol, 2002; 31:81–93.

Cavanagh

. Coronaviruses in poultry and other birds. Avian Pathol, 2005; 34:439–448.

Cheley

, Anderson

. Cellular synthesis and modification of murine hepatitis virus polypeptides. J Gen Virol, 1981; 54:301–311.

Deng

, Gao

, Qi

, Cheng

, Wang

. Antigenic structure analysis of VP3 of infectious bursal disease virus. Virus Res, 2007; 129:35–42.

Gibertoni

, Montassier

Mde F

, Sena

, Givisiez

, Furuyama

, Montassier

. Development and application of a Saccharomyces cerevisiae-expressed nucleocapsid protein-based enzyme-linked immunosorbent assay for detection of antibodies against infectious bronchitis virus. J Clin Microbiol, 2005; 43:1982–1984.

10.

Gomaa

, Barta

, Ojkic

, Yoo

. Complete genomic sequence of turkey coronavirus. Virus Res, 2008; 135:237–246.

11.

González

, Gomez-Puertas

, Cavanagh

, Gorbalenya

, Enjunes

. A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. Arch Virol, 2003; 148:2207–2235.

12.

Ignjatovic

, Galli

. The S1 glycoprotein but not N or M proteins of avian infectious bronchitis virus induces protection in vaccinated chickens. Arch Virol, 1994; 138:117–134.

13.

Ignjatovic

, Sapats

. Identification of previously unknown antigenic epitopes on the S and N proteins of avian infectious bronchitis virus. Arch Virol, 2005; 150:1813–1831.

14.

, Jiang

, Liu

et al. Characterization of the hemagglutinin gene of subtype H9 avian influenza viruses isolated in 2007–2009 in China. J Virol Methods 2009 Sep 23[Epub ahead of print].

15.

Johnson

, Pooley

, Ignjatovic

, Tyack

. A recombinant fowl adenovirus expressing the S1 gene of infectious bronchitis virus protects against challenge with infectious bronchitis virus. Vaccine, 2003; 21:2730–2736.

16.

Jonassen

, Kofstad

, Larsen

, Lovland

, Handeland

, Follestad

, Lillehang

. Molecular identification and characterization of novel coronaviruses infecting greylag geese (Anser anser), feral pigeons (Columba livia) and mallards (Anas platyrhynchos) J Gen Virol, 2005; 86:1597–1607.

17.

Kant

, Koch

, van Roozelaar

, Kusters

, Poelwijk

FAJ

, van der Zeijst

BAM

. Location of antigenic sites defined by neutralising monoclonal antibodies on the S1 avian infectious bronchitis virus glycopolypeptide. J Gen Virol, 1992; 73:591–596.

18.

Kaverin

, Rudneva

, Govorkova

et al. Epitope mapping of the hemagglutinin molecule of a highly pathogenic H5N1 influenza virus by using monoclonal antibodies. J Virol, 2007; 81:12911–12917.

19.

Koch

, Hartog

, Kant

, van Roozelaar

. Antigenic domains on the peplomer protein of avian infectious bronchitis virus: correlation with biological functions. J Gen Virol, 1990; 71:1929–1935.

20.

Kusters

, Jager

, Lenstra

, Koch

, Posthumus

WPA

, Meloen

, van der Zeijst

BAM

. Analysis of an immunodominant region of infectious bronchitis virus. J Immunol, 1989; 143:2692–2698.

21.

Lenstra

, Kusters

, Koch

, van der Zeijst

BAM

. Antigenicity of the peplomer protein of infectious bronchitis virus. Mol Immunol, 1989; 26:7–15.

22.

Liu

, Wang

, Sun

, Zheng

, Wu

. Characterization of Newcastle disease virus isolated from waterfowl in China. Avian Dis, 2008; 52:150–155.

23.

Liu

, Kong

. A new genotype of nephropathogenic infectious bronchitis virus circulating in vaccinated and non-vaccinated flocks in China. Avian Pathol, 2004; 33:321–327.

24.

Liu

, Wang

, Ma

et al. Identification of a newly isolated avian infectious bronchitis coronavirus variant in China exhibiting affinity for the respiratory tract. Avian Dis, 2008; 52:306–314.

25.

Liu

, Zhang

, Chen

et al. Genetic diversity of avian infectious bronchitis coronavirus strains isolated in China between 1995 and 2004. Arch Virol, 2006; 151:1133–1148.

26.

Liu

, Chen

et al.

Isolation of avian infectious bronchitis coronavirus from domestic peafowl (Pavo cristatus) and teal (Anas)

J Gen Virol, 2005; 86:719–725.

27.

Manterola

, Cuadra

, Muñoz

, Sanhueza

, Bustos

, Vial

, Fonseca

. In a diagnostic test study the validity of three serodiagnostic tests was compared in patients with liver echinococcosis. J Clin Epidemiol, 2005; 58:401–406.

28.

Marangoni

, Sparacino

, Mondardini

et al. Comparative evaluation of two enzyme linked immunosorbent assay methods and three Western Blot methods for the diagnosis of culture-confirmed early Lyme borreliosis in Italy. New Microbiol, 2005; 28:37–43.

29.

Masters

. The molecular biology of coronaviruses. Adv Virus Res, 2006; 66:193–292.

30.

Moore

, Jackwood

, Hilt

. Identification of amino acids involved in a serotype and neutralisation specific epitope within the S1 subunit of avian infectious bronchitis virus. Arch Virol, 1997; 142:2249–2256.

31.

Mountcastle

, Compans

, Caliguiri

, Choppin

. Nucleocapsid protein subunits of simian virus 5, Newcastle disease virus, and Sendai virus. J Virol, 1970; 6:677–684.

32.

Mountcastle

, Compans

, Cackland

, Choppin

. Proteolytic cleavage of subunits of nucleocapsid of the paramyxovirus simian virus. J Virol, 1974; 14:1253–1261.

33.

Ndifuna

, Waters

, Zhou

, Collisson

. Recombinant nucleocapsid protein is potentially an inexpensive, effective serodiagnostic reagent for infectious bronchitis virus. J Virol Methods, 1998; 70:37–44.

34.

Niesters

HGM

, Bleumink-Pluym

NMC

, Osterhaus

ADME

, Horzinek

, van der Zeijst

BAM

. Epitopes on the peplomer protein of infectious bronchitis virus strain M41 as defined by monoclonal antibodies. Virology, 1987; 161:511–519.

35.

Pang

, Wang

, Girshick

, Xie

, Khan

. Development and application of a multiplex polymerase chain reaction for avian respiratory agents. Avian Dis, 2002; 46:691–699.

36.

Ruf

, Carayon

, Sarles-Philip

, Kourilsky

, Lissitzky

. Specificity of monoclonal antibodies against human thyroglobulin; comparison with autoimmune antibodies. EMBO J, 1983; 2:1821–1826.

37.

Seah

, Yu

, Kwang

. Localisation of linear B-cell epitopes on infectious bronchitis virus nucleocapsid protein. Vet Microbiol, 2000; 75:11–16.

38.

Seo

, Wang

, Smith

, Collisson

. The carboxyl-terminal 120-residue polypeptide of infectious bronchitis virus nucleocapsid induces cytotoxic T lymphocytes and protects chickens from acute infection. J Virol, 1997; 71:7888–7894.

39.

Snyder

, Marquardt

, Mallinson

, Russek

. Rapid serological profiling by enzyme linked immunosorbent assay. I. Measurement of antibody titer against Newcastle disease virus in a single serum dilution. Avian Dis, 1983; 27:161–170.

40.

Snyder

, Marquardt

, Russek

. Rapid serological profiling by enzyme linked immunosorbent assay. II. Comparison of computational methods for measuring antibody titer in a single serum dilution. Avian Dis, 1983; 27:474–484.

41.

Snyder

, Marquardt

, Mallinson

, Savage

, Allen

. Rapid serological profiling by enzyme-linked immunosorbent assay. III. Simultaneous measurements of antibody titers to infectious bronchitis, infectious bursal disease and Newcastle disease viruses in a single serum dilution. Avian Dis, 1984; 28:12–24.

42.

Stern

, Burgess

, Sefton

. Structural analysis of virion proteins of the avian coronavirus infectious bronchitis virus. J Virol, 1982; 42:208–219.

43.

Sun

, Feng

, Shi

et al. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet Microbiol, 2008; 131:73–81.

44.

Tang

, Wang

, Zhou

, Tian

. Enhancement of the immunogenicity of an infectious bronchitis virus DNA vaccine by a bicistronic plasmid encoding nucleocapsid protein and interleukin-2. J Virol Methods, 2008; 149:42–48.

45.

Tian

, Wang

, Lu

, Zhang

, Wang

, Kang

. The immunoreactivity of a chimeric multi-epitope DNA vaccine against IBV in chickens. Biochem Biophys Res Commun, 2008; 377:221–225.

46.

Vilella

, Yague

, Vives

. Monoclonal antibody against HLA-Aw32 + A25. Is HLA-Aw32 an allele with no unique antigenic determinant? Hum Immunol, 1983; 6:53–62.

47.

Wang

, Sneed

. Comparative analyses of the nucleocapsid genes of several strains of infectious bronchitis virus and other coronaviruses. Virus Res, 1992; 25:213–222.

48.

Xing

, Liu

, Han

, Shao

, Li

, Kong

. Identification of a novel linear B-cell epitope in the M protein of avian infectious bronchitis coronaviruses. J Micobiol, 2009; 47:589–599.