Association of IL-17,IL-21,and IL-23R Gene Polymorphisms with HBV Infection in Kidney Transplant Patients

Abstract

Inflammatory cytokine gene polymorphisms may influence the hepatic and extrahepatic HBV-related disease in transplant patients. In this study, the association between IL-17, IL-23R, and IL-21 gene polymorphisms with hepatitis B virus (HBV) infection was evaluated in kidney transplant patients. In total, 220 kidney transplant patients were enrolled in this cross-sectional study between years 2007 and 2011. The genomic HBV DNA was identified using an HBV PCR detection Kit according to the manufacturer's instruction. The cytokine gene polymorphisms, including IL-17 197 A/G (rs2275913), IL-21 +1472 G/T (rs2055979), IL-21 5250 C/T (rs4833837), and IL-23R C/A (rs10889677) were evaluated by PCR-RFLP and ARMS-PCR protocols. The serum levels of IL-17 and IL-21 were analyzed in HBV infected and noninfected transplant patients by ELISA methods according to manufacturer's instructions. 70 of 220 (35%) transplant patients experienced acute rejection. HBV DNA was detected in 52 of 220 (23.64%) transplant patients. 16 of 52 (30.8%) HBV-infected kidney transplant patients experienced acute rejection. A significant higher frequency of C allele of IL-23R (rs10889677) polymorphism, a higher frequency of AG heterozygote genotype and A allele of IL-17-G197A (rs2275913) polymorphism, a higher frequency of TT homozygote genotype and T allele of IL-21-G1472T (rs2055979) polymorphism, and a higher frequency of CC homozygote genotype and C allele of IL-21-C5250T (rs4833837) polymorphism were found in HBV-infected kidney transplant patients with acute rejection. Diagnosis of the higher frequency of the IL-17, IL-21, and IL-23R cytokine genotypes and allele polymorphisms in HBV-infected kidney transplant patients who experienced acute rejection, illustrates the importance of Th17-related cytokine genetic patterns. A better evaluation of HBV infection in kidney transplant patients is needed.

Introduction

S everal kinds of cytokines have antiviral actions, both directly through inhibition of viral replication and indirectly through evaluation of the multiple patterns of host response (1,14). Its importance is best demonstrated in hepatitis B virus (HBV) infection, which is one of the common causes of clinical complications in kidney graft recipients (1). The cytokines released by T CD4+ and T CD8+ cells downregulate HBV replication and may control viral infection without the death of the infected cells. On the other hand, HBV becomes chronic when the presence of an ongoing suboptimal inflammatory response activates the process of liver disease (19,22). Recently, emerging evidence presents a subset of T helper cells, the T helper 17 (Th17) cells, which contribute to the pathogenesis of HBV disease (24). The target cells and mechanisms of the Th17 cell-secreted cytokines, including IL-17 and IL-21 in HBV-infected livers, were subsequently evaluated. Th17 cell-associated inflammation is also positively regulated by the IL-23 cytokine produced by antigen-presenting cells (31,34). Th17 cells are significantly increased in chronic HBV-infected patients, triggering liver damage (34). Th17 cells have a positive association with serum alanine aminotransferase in chronic HBV-infected patients (8,30,32,34). IL-21 stimulates T and B cell responses and plays a role in the control of chronic HBV viral infections and in transplant patients (3,9). Serum IL-21 levels might be a biomarker for HBeAg seroconversion, and may contribute to antiviral therapy in HBeAg-positive patients with chronic HBV infection (3,9,18). The frequency of IL-21 in patients with HBV infection was found to be higher than in healthy controls (5). Several reports have focused on the function of IL-21 in HBV clearance and its relationship to the severity of chronic HBV infection (23). These observations suggest that IL-21 plays a key role in age-dependent response to HBV clearance (7,23). IL-23 regulates the function of IL-17-producing cells against intracellular pathogens (25). Also, the IL-21 secreting TCD4+ cells were higher in HBV-infected patients with acute and chronic liver failure (10). IL-23 plays an important role in autoimmune tissue inflammation and induces the generation of not fully characterized effector cells that mediate protection against microorganisms (2,25). In chronic HBV-infected patients or HBV-associated acute and chronic liver failure, the serum levels of both IL-23 and IL-17 were significantly elevated (28). It has been proposed that HBV antigens are the initiative factor for enhancement of IL-23 expression in HBV-infected liver, as HBcAg can stimulate dendritic cells to secrete high levels of IL-23 (31,34). However, the precise mechanisms underlying the effects of the IL-23/IL-22 and IL-23/IL-21 axes on hepatitis B pathogenesis have not yet been elucidated (11). Genetic polymorphisms in IL-23R have been linked to genetic susceptibility to a number of human autoimmune diseases (12,14,22). Literature reports cite the presence of IL-23R gene polymorphism that is located on chromosome 1p31.3 (8,12). The relationship between IL-23R genetic polymorphism and kidney transplant outcomes was examined, showing that IL-23R polymorphism may have a potential role in long-term allograft outcome (12). Therefore, in this study the association between IL-17, IL-23R, and IL-21 genetic polymorphisms with HBV infection was evaluated in kidney transplant recipients.

Patients and Methods

Patients and samples

In this study, a total of 220 patients who underwent kidney transplantation in transplant ward at Namazi Hospital affiliated to Shiraz University of Medical Sciences, Shiraz, Iran were evaluated between the years 2007 and 2011. All of the studied patients were Iranian; non-rejected transplant patients were considered as controls. One EDTA-treated blood sample was collected from each studied transplant patient. The kidney graft outcome and acute rejection episode were evaluated for early 2 month period post-transplantation. Donors were selected on the basis of ABO blood group compatibility; all were negative for cross matches. In this study, transplant patients were divided into two studied groups according to the presence or absence of acute rejection episodes. Rejection episodes were identified by an expert nephrology team based on the approved clinical diagnostic criteria and invariably confirmed by needle biopsy, as well as elevated serum creatinine and blood urea nitrogen levels. The standard immunosuppressive regimen for all 220 recipients included cyclosporine (5 mg/kg initially, a maintenance dose of 2–2.5 mg/kg; cyclosporine level was 50–150 ng/mL), prednisolone (120 mg/day initially, tapering to 10 mg/day), and mycophenolate mofetil (1000 mg twice daily). Acute rejection was initially treated with intravenous steroids and steroid-resistant rejection was treated with OKT3 monoclonal antibody (4).

DNA extraction for HBV DNA and cytokine genotyping

The buffy coats and plasma of EDTA-treated whole blood samples from kidney transplanted patients were available from the sample bank affiliated with the Shiraz Transplant Research Center. Genomic DNA was extracted from buffy coats (cytokine genotyping) and plasma (HBV DNA) using a DNP^™ Kit (CinnaGen, Iran) as follows: Pre-warm kit to room temperature before use and pre-warm lysis solution by placing in 37⁰C for 20 min and softly shake. Mix 100 μL of each buffy coats (for cytokine genotyping) and plasma (for HBV DNA) samples with 400 μL of lysis solution and vortex for 15–20 sec. Add 300 μL of precipitation solution, mix by vortex for 3–5 sec and place in −20°C for 20 min. Then centrifuge at 12,000 g for 10 min. Decant by gently inverting of tube and placing the tube on tissue paper for 2–3 sec. Add 1 mL wash buffer to pellet, mix for 3–5 sec and centrifuge at 12,000 g for 5 min, then decant. Pour off the wash buffer completely and dry pellet at 65⁰C for 5 min.

PCR-based molecular protocols

HBV PCR

The genomic HBV DNA was identified in patient samples using specific primers to amplify a fragment of the surface gene by a qualitative hepatitis B virus PCR detection Kit (CinnaGen, Iran) according to the manufacturer's instruction.

Cytokine genotyping

IL-17, IL-23R, and IL-21 cytokine genetic polymorphisms were evaluated by PCR-based protocols. IL-17 (A197G) and IL-21(G1472T) genetic polymorphisms were analyzed by in-house PCR-RFLP protocols (Tables 1 and 2). The PCR products were digested by Xag1 and NlaIII restriction enzymes (Fermentas, Lithuania). The IL-23R and IL-21C5250T genetic polymorphisms were evaluated using in-house ARMS-PCR protocols (Tables 1 and 2). A beta globin gene primer was used as an internal control. The PCR primers and PCR mix and thermocycling conditions are presented with detail in Tables 1 and 2, respectively. The amplified products were monitored by agarose gel electrophoresis and ethidium bromide staining.

Table 1.

Primers and Types of PCR Protocols for the IL-17, IL-23R, IL-21, and Internal Control

SNP	Primers	Method
IL-17(-197 A/G)	Forward primer: 5′GCAGCTCTGCTCAGCTTCTAA3′	PCR-RFLP
rs2275913	Reverse primer: 5′TTCAGGGGTGACACCATTTT3′
IL-21(G1472T)	Forward primer: 5′GCTCTGAACCCAAACACTCTC3′	PCR-RFLP
rs2055979	Reverse primer: 5′ACAGCCAGGAAACTCTGGAA3′
	Forward primer: 5′TTAGTTGGGCCTTCTGAAAG3′	ARMS-PCR
IL-21(C5250T)	Reverse primer: 5′TTAGTTGGGCCTTCTGAAAA3′
rs4833837	Common: 5′TGTAATGCACGACATTGCAG3′
IL-23R (C/A)	Forward primer: 5′TTTTAGCCATTCTTCTGCCTC3′	ARMS-PCR
rs10889677	Reverse primer: 5′TTTTAGCCATTCTTCTGCCTA3′
	Common: 5′CGCCTGGCCTAATGATTCTA3′
Beta globins	Forward : 5′ACACAACTGTGTTCACTAGC3′	ARMS-PCR (Internal Control)
	Reverse: 5′CAACTTCATCCACGTTCACC3′

SNP, single nucleotide polymorphism.

Table 2.

The PCR Mix and Thermocycling Conditions for the IL-17, IL-23R, and IL-21 Gene Polymorphisms

SNP	PCR thermocycling condition	PCR mix condition
IL-17PCR-RFLP	94°C, 5 min; 57°C, 30 sec; 72°C, 30 sec; 30 cycle	Total volume of 8 μL, with 2 μL genomic DNA, 1 μL of primers, 1 μL buffer(baq), 0.15 μL of dNTP, and 0.05 μL Taq DNA polymerase
IL-21(G1472T)PCR-RFLP	94°C, 5 min; 64°C, 30 sec; 72°C, 30 sec; 30 cycle	Total volume of 8 μL, with 2 μL genomic DNA, 1 μL of primers, 1 μL buffer(baq), 0.15 μL of dNTP, and 0.05 μL Taq DNA polymerase
IL-21(C5250T)ARMS-PCR	94°C, 5 min; 64°C, 30 sec; 72°C, 30 sec; 30 cycle	Total volume of 6 μL containing 0.15 μL dNTPs, 1 μL of Forward primers, 1 μL of common primer, 0.9 μL of inner primers, 1 μL of buffer (baq), 0.05 μL Taq DNA polymerase, and 4 μL genomic DNA.
IL-23RARMS-PCR	94°C, 5 min; 63°C, 30 sec; 72°C, 30 sec; 30 cycle	Total volume of 6 μL containing 0.15 μL dNTPs, 1 μL of external primers 1 μL of common primer,0.7 μL of inner primers, 1 μL of buffer (baq), 0.05 μL Taq DNA polymerase, and 4 μL genomic DNA

Cytokine level measurement

The case group consisted of 22 patients with acute rejection and the control group included 22 patients without rejection. Plasma samples were isolated immediately and stored at −80°C until required for an analysis by an ELISA Kit (eBioscience, USA).

The levels of IL-17 and IL-21 were evaluated by ELISA methods in all 44 persons with or without HBV infection, respectively. Each patient and control groups contained 11 females and 11 males with ages ranged from 20–58 and 20–53 years, respectively. The plasma samples were collected from each kidney transplant groups immediately and stored at −80°C until using ELISA Kits (eBioscience, USA), according to the manufacturer's instructions.

Statistical analysis

Allele and genotype frequencies were calculated in kidney transplant patients and controls by direct gene counting. Statistical evaluation was carried out using SPSS software, version 16. The frequency of the alleles/genotypes was compared in patients and controls by Chi-square test and Fisher's exact test. Odds ratios (OR) and 95% confidence intervals (CIs) for relative risks were calculated. P<0.05 was considered as statistically significant. Haplotypes were evaluated using Arlequin version 3.11.

Results

The age range of kidney transplant patients was between 1 and 79 years old. The 130 of 220 (59.1%) kidney transplant recipients were male and 90 of 220 (40.90%) were female with a mean±SD age of 31.79±35.37 years. The 60 of 220 (27.28%) transplant patients showed acute rejection and 160 of 220 (72.73%) patients did not. Acute rejection was confirmed in 35 of 130 (27%) male and 25 of 90 (27.8%) female patients.

HBV infection and kidney transplantation

The genomic HBV DNA was detected in 52 of 220 (23.64%) kidney transplant patients and the rest of patients (168 of 220; 76.34%) did not show the history of HBV molecular infection. Sixteen of 52 (30.8 %) HBV infected and 44 of 168 (26.2%) HBV uninfected transplant patients experienced acute graft rejection. HBV infection was found in 9 of 35 (25.7%) and in 7 of 25 (28%) male and female patients with acute allograft rejection, respectively. Twenty seven of 111 (24.3%) patients who received transplants from cadavers and 25 of 109 (23%) who received transplants from living donors showed HBV infection. HBV infection was found in 10 of 27 (37%) acute rejected transplant patients received kidney from cadaver and the rest of them (17 of 27; 53%) did not experience acute rejection. HBV infection was also found in 6 of 25 (20%) acute rejected transplant patients received kidney from living donors and the rest of them (19 of 25;80%) received the graft from living donors.

HBV infection and cytokine polymorphisms

The frequency of alleles and genotypes of cytokine genes including: IL-17-A197G (rs2275913), IL-21-G1472T (rs2055979), IL-21-C5250T (rs4833837), and IL-23R (rs10889677) were determined in 52 HBV-infected and 168 HBV-noninfected kidney transplant recipients.

The significantly higher frequency of C allele of IL-23R (rs10889677) polymorphism was found in HBV infected kidney transplant patients experiencing acute rejection (p=0.03, OR=0.41, 95% CI=0.17–1.01, study power=58%). The frequency of AG heterozygote genotype and A allele of IL-17-G197A (rs2275913) polymorphism was also higher in HBV-infected kidney transplant patients experienced acute rejection. The higher frequency of TT homozygote genotype and T allele of IL-21-G1472T (rs2055979) polymorphism and higher frequency of CC homozygote genotype and C allele of IL-21-C5250T (rs4833837) polymorphism were found in HBV infected kidney transplant patients with acute rejection (Table 3). The haplotype 2 was the most frequent haplotype in the acute rejected and nonacute rejected patients with HBV infection. The frequency of haplotypes 1 was significantly higher in the nonacute rejected patients compared with the acute rejected group (p=0.02). The haplotype 4 was not found in the acute rejected group of patients (Table 4).

Table 3.

The Frequency of Cytokine Gene Polymorphism and HBV Infection in Acute Rejected Kidney Transplant Patients

SNP	Genotype	HBV+Acute Rejected % (N)	HBV-Acute Rejected % (N)	P value	OR	95%CI
IL-17(-197 A/G)rs2275913	AA	12.5 % (2)	6.82 % (3)	0.68	1.48	.15–12.86
	AG	43.75 % (7)	27.28 % (12)	0.22	2.07	0.54–8.01
	GG	43.75 % (7)	65.91 % (29)	0.12	0.40	0.11–1.49
	A allele	34.38 % (11)	20.46 % (18)	0.11	2.04	0.76–5.45
	G allele	65.63 % (21)	79.55 % (70)
IL-23R (C/A)rs10889677	AA	18.75 % (3)	40.91 % (18)	0.11	0.33	0.06–1.53
	AC	43.75 % (7)	43.19 % (19)	0.96	1.02	0.28–3.75
	CC	37.5 % (6)	15.91 % (7)	0.07	3.17	0.37–14.04
	A allele	40.63 % (13)	62.5 % (55)	0.03^*	0.41	0.17–1.01
	C allele	59.38 % (19)	37.5 % (33)
IL-21(G1472T)rs2055979	TT	18.75 % (3)	9.1% (4)	0.30	2.31	0.35–14.77
	TG	56.25 % (9)	45.46 % (20)	0.45	1.54	0.42–5.70
	GG	25 % (4)	45.46 % (20)	0.15	0.40	0.09–1.65
	T allele	46.88 % (15)	31.82 % (28)	0.12	1.89	0.76–4.68
	G allele	53.13 % (17)	68.19 % (60)
IL-21(C5250T)rs4833837	CC	(68.75%) 11	(50%) 22	0.19	2.20	0.57–8.82
	CT	(31.25%) 5	(36.37%) 16	0.71	0.80	0.20–3.12
	TT	0 (0%)	(13.64%) 6	0.11	0.00	0.00–20.65
	C allele	(84.38%) 27	(68.19%) 60	0.07	2.52	0.81–8.37
	T allele	(15.63%) 5	(13.82%) 28

HBV+, HBV Infected; HBV-, HBV Noninfected; N, number; P value<0.05=significant; OR, Odds Ratio; 95%CI=95% Confidential Interval.

Table 4.

The Frequencies of IL-21 Haplotypes in HBV-infected and Noninfected Kidney Transplant Patients

Haplotype ID number	Haplotype distribution	HBV+ (acute rejected)	HBV+ (nonacute rejected)	P Value
1	GC	5 (15%)	17 (23.5%)	0.02^*
2	TT	15 (47%)	32 (44.5%)	0.93
3	GT	12 (38%)	18 (25%)	0.19
4	TC	0 (0%)	5 (7%)	0.12

referes to statistically significant associations.

HBV infection and cytokine levels

IL-17 and IL-21 were both found in 2 of 11 (18.2%) and 4 of 11 (36.4%) of HBV-infected and HBV-noninfected kidney transplant female patients, respectively. IL-17 was also found in 1 of 11 (9.1%) and 7 of 11 (63.6%) of HBV-infected and HBV-noninfected kidney transplant male patients, respectively. The IL-21 was found in 1 of 11 (18.2%) and 6 of 11 (54.6%) of HBV-infected and HBV-noninfected kidney transplant male patients, respectively (Table 5).

Table 5.

The Level of IL-17 and IL-21 in Acute Rejected in Comparing with Nonacute Rejected HBV Infected Kidney Transplant Patients

	Acute rejected		Nonacute rejected
Patients Cytokines	Female	Male	Female	Male
IL-17	2 of 11 (18.2%)	1 of 11 (9.1%)	4 of 11 (36.4%)	7 of 11 (63.6%)
IL-21	2 of 11 (18.2%)	1 of 11 (9.1%)	4 of 11 (36.4%)	6 of 11 (54.6%)

Discussion

HBV clinical manifestation in kidney transplant patients is primarily affected by immunosuppression, which may lead to end-stage liver disease. Kidney transplant patients who received long-term immunosuppression experience severe HBV infections. Extrahepatic clinical manifestation of HBV may lead to membranous nephropathy and lower frequency of membranoproliferative glomerulonephritis. Severity of HBV-related glomerulonephritis is more relentless, and slowly progresses to kidney failure, need for dialysis, and receiving kidney transplantation (1). Th17 and its compartments may have a role in inflammatory and pro-inflammatory responses against viral infections (1, 14). Genotypic and phenotypic characteristics of Th17 relate cytokines including: IL-17 and IL-21 were recently studied in immunovirology-based researches (11,29,33). Its importance is best demonstrated in HBV infection (6,8,29,34). Therefore, a possible association between IL-17, IL-23R, and IL-21 genetic polymorphisms with HBV infection and outcomes was studied in kidney transplant patients.

IL-17 as a pro-inflammatory cytokine has two peripheral and intrahepatic forms increased in patients with HBV infection, correlated with the severity of liver injuries in infected patients (11,13,23,33,34). IL-17 is able to activate and stimulate monocytes and myeloid dendritic cells to produce a variety of proinflammatory cytokines, leading to immune-related liver damage (30,34). IL-17 can mobilize, recruit, and activate neutrophils and cause massive tissue inflammation and extensively involves in the pathogenesis of chronic HBV liver disease and antiviral immunity (13,15,16,28,31). Xu et al. showed the higher level of serum IL-17 and the higher expression level of IL-17 mRNA in patients with HBV infections in comparing with healthy control (30). Niu et al. also demonstrated that intrahepatic IL-17+T cells play important roles in development of chronic HBV (20). In another report, Ge et al. suggested the potential role of peripheral Th17 cells in the immune activation of chronic HBV infection (8). Zhang et al. showed that both peripheral blood and liver of patients with chronic HBV infection are highly enriched with Th17 cells (34). The various important roles of IL-17 and IL-17-producing cells in the progression of HBV-related chronic liver damages were described by Wang et al. (27).Ye et al. showed IL-17-mediating liver neutrophil recruitment as a potential mechanism of liver injury in patients with HBV infection (31). Similar to other reports, in this study diagnosis of the higher frequency of AG genotype and A allele of IL-17-G197A genotype was found in HBV-infected acute rejected kidney transplant patients, especially females.

IL-21 is another cytokine related functionally to Th17. Several earlier studies focused on the key role of IL-21 in HBV clearance and especially to the severity of chronic infection. IL-21 may be a part of an effective primary hepatic immune response to HBV (7,23). The higher level of IL-21 transcript was expressed particularly in the blood samples of infected adults who were previously cleared of HBV. Totally, when the host–virus balance is broken, a remarkable increase in IL-21 and its producing Th17 cells would be expected. Recently, another research group found a higher frequency of IL-21- secreting CD4+ T cells in patients with acute and chronic liver failure and with severe chronic HBV infection than in patients with moderate chronic HBV infection and normal controls (10).This group also suggests the possible role of IL-21 in the severe liver inflammation (10). Baan et al. showed that blockade of the IL-21 pathway may provide a new perspective for the treatment of allogeneic responses in patient's post-transplantation (3). On the other hand, Hecker et al. demonstrated the induction of IL-21 expression in intravascular monocytes of patients receiving allogeneic transplantation (9). Finally, in another report, Ding et al. analyzed the level of IL-21 in TCD4+ cells of peripheral blood from different types of HBV-infected patients and declared the role of IL-21 in the HBV pathogenesis. The higher frequency of IL-21(+) TCD4+ cells in the patients with acute and chronic asymptomatic HBV infection was shown as compared to healthy controls and patients with severe chronic HBV infection. The level of IL-21 that is correlated to Th17 cells varied in different types of HBV infected patients (5). In this study, the higher frequency of TT genotype and T allele of IL-21-G1472T polymorphism and higher frequency of CC genotype and C allele of IL-21-C5250T polymorphism were found in HBV infected kidney transplant patients experiencing acute rejection.

IL-23 is a heterodimeric cytokine that plays a critical role in the development of autoimmune diseases and modulating subpopulations of T helper cells (2,17). Earlier reports enforced on the linkage between IL-23R gene polymorphisms located on chromosome 1p31.3 and genetic susceptibility to a number of human autoimmune diseases (2,26). These results suggest the role of IL-23: IL- 23R pathway in development of many immune related diseases (2,28). HBV liver disease is an inflammation-related disorder characterized by significant dysfunctions in the IL-23/IL-17 signaling pathway. Obvious elevation of serum IL-17 and IL-23 was found in HBV infected patients (28,31,34). HBV antigens (HBcAg) are the initiative factor for enhancement of IL-23 expression in HBV-infected liver (31,34). IL-17 significantly upregulates the expression of IL-23 in monocytes and myeloid dendritic cells of patients with chronic HBV infection (5). Therefore, research emphasized the relationship between increases of the IL-23 after expression of IL-17 and suggested a functional IL- 23/IL-17 axis in HBV-infected liver. The inducing role of IL-6 and IL-21in expression of IL-23R was also presented (11,33).

Tsai et al. examined an association between IL-23R polymorphisms with kidney transplant outcomes. These results demonstrated that IL-3R polymorphism may have a potential immunoregulatory role in long-term allograft outcomes (26). In another report, Riol et al. established the essential role of IL-23R in the host immune response against intracellular microbial pathogens and its role in regulation of the function of IL-17(25). Similarly, in this study the significant higher frequency of C allele of IL-23R polymorphism was found in HBV-infected kidney transplant patients experiencing acute rejection. The significant higher frequency of A allele of IL-23R polymorphism was found in kidney transplant female patients with acute rejection.

Conclusion

Diagnosis of the higher frequency of the IL-17, IL-21 cytokines and IL-23R polymorphisms in HBV infected kidney transplant patients with and without experiencing acute rejection and also finding of a significant association between IL-23R polymorphisms with HBV infection in acute rejected transplant recipients open a way to study the importance of Th17-related cytokine genetic pattern to define HBV pathogenesis in transplant patients.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

References

Arjmandi

, Yaghobi

, Ravanshad

et al. Laboratory effect of HBV infection in kidney transplant recipients and donors. Transplant Proc, 2011; 43:554–556.

Awasthi

, Riol-Blanco

, Jäger

et al. Cutting edge: IL23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J Immunol, 2009; 182:5904–5908.

Baan

, Balk

, Dijke

et al. Interleukin-21: An interleukin-2 dependent player in rejection processes. Transplantation, 2007; 83:1485–1492.

Solez

, Colvin

, Racusen

et al. Banff 07 classification of renal allograft pathology: updates and future directions. Am J Transplant, 2008; 8:753–760.

Ding

, Zhang

, Lian

et al. The induced IL-21 levels in CD4(+) T cells of peripheral blood from the different clinical types of patients infected with hepatitis B virus. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi, 2011; 27:304–306.

Dubin

, Kolls

. Th17 cytokines and mucosal immunity. Immunol Rev, 2008; 226:160–171.

Franks

. Viral hepatitis: Interleukin 21 has a key role in age-dependent response to HBV. Nat Rev Gastroenterol Hepatol, 2011; 8:243.

, Wang

, Meng

et al. Implication of Th17 and Th1 cells in patients with chronic active hepatitis B. J Clin Immunol, 2010; 30:60–67.

Hecker

, Kaufmann

, Hecker

et al. Expression of interleukin-21, interleukin-21 receptor alpha and related type I cytokines by intravascular graft leukocytes during acute renal allograft rejection. Immunobiology, 2009; 214:41–49.

10.

, Ma

, Huang

et al. Interleukin-21 is upregulated in hepatitis B-related acute-on-chronic liver failure and associated with severity of liver disease. J Viral Hepat, 2011; 18:458–467.

11.

Huang

, van Velkinburgh

et al. Pivotal roles of the interleukin-23/T helper 17 cell axis in hepatitis B. Liver Int, 2012; 32:894–901.

12.

Hue

, Ahern

, Buonocore

et al. Interleukin-23 drives innate and T cell-mediated intestinal inflammation. J Exp Med, 2006; 203:2473–2483.

13.

Infante-Duarte

, Horton

, Byrne

, Kamradt

. Microbial lipopeptides induce the production of IL-17 in Th cells. J Immunol, 2000; 165:6107–6115.

14.

Koyama

, Ishii

, Coban

et al. Innate immune response to viral infection. Cytokine, 2008; 43:336–341.

15.

Lafdil

, Miller

, Ki

et al. Th17 cells and their associated cytokines in liver diseases. Cell Mol Immunol, 2010; 7:250–254.

16.

Langrish

, Chen

, Blumenschein

et al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med, 2005; 201:233–240.

17.

Lupardus

, Garcia

. The structure of interleukin-23 reveals the molecular basis of p40 subunit sharing with interleukin-12. J Mol Biol, 2008; 382:931–941.

18.

, Huang

, Li

et al. High serum IL-21 levels after 12 weeks of antiviral therapy predict HBeAg seroconversion in chronic hepatitis B. J Hepatol, 2012; 56:775–781.

19.

Maini

, Boni

, Lee

et al. The role of virus-specific CD8 (+) cells in liver damage and viral control during persistent hepatitis B virus infection. J Exp Med, 2000; 191:1269–1280.

20.

Niu

, Liu

, Yin

et al. The balance between intrahepatic IL-17(+) T cells and Foxp3 (+) regulatory T cells plays an important role in HBV-related end-stage liver disease. BMC Immunol, 2011; 19:12–47.

21.

Park

, Li

, Yang

et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol, 2005; 6:1133–1141.

22.

Phillips

, Chokshi

, Riva

et al. CD8 (+) T cell control of hepatitis B virus replication: Direct comparison between cytolytic andnoncytolytic functions. J Immunol, 2010; 184:287–295.

23.

Publicover

, Goodsell

, Nishimura

et al. IL-21 is pivotal in determining age-dependent effectiveness of immune responses in a mouse model of human hepatitis B. J Clin Invest, 2011; 121:1154–1162.

24.

Rehermann

. Intrahepatic T cells in hepatitis B: Viral control versus liver cell injury. J Exp Med, 2000; 191:1263–1268.

25.

Riol-Blanco

, Lazarevic

, Awasthi

et al. IL-23 receptor regulates unconventional IL-17-producing T cells that control bacterial infections. J Immunol, 2010; 184:1710–1720.

26.

Tsai

, Yang

, Wu

et al. Association between interleukin 23 receptor polymorphism and kidney transplant outcomes: A 10-year Taiwan cohort study. Clin Chim Acta, 2011; 412:958–962.

27.

Wang

, Chen

, Xu

. IL-17 expression is correlated with hepatitis B-related liver diseases and fibrosis. Int J Mol Med, 2011; 27:385–392.

28.

Wang

, Zheng

, Huang

et al. Activated IL-23/IL-17 pathway closely correlates with increased Foxp3 expression in livers of chronic hepatitis B patients. BMC Immunol, 2011; 14:12–25.

29.

, Li

, Chen

et al. Circulating Th17 cells frequency is associated with the disease progression in HBV infected patients. J Gastroenterol Hepatol, 2010; 25:750–757.

30.

, DU

, Qin

et al. Expression of interleukin-17 in hepatitis B related liver fibrosis. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi, 2009; 25:133–135.

31.

, Xie

, Yu

et al. Involvement of Th17 and Th1 effector responses in patients with hepatitis B. J Clin Immunol, 2010; 30:546–555.

32.

Zhang

, Yao

, Yuan

et al. Elevated IL-6 receptor expression on CD4+ T cells contributes to the increased Th17 responses in patients with chronic hepatitis B. Virol J, 2011; 3:270–280.

33.

Zhang

, Song

, Shi

et al. Decreased ratio of Treg cells to Th17 cells correlates with HBV DNA suppression in chronic hepatitis B patients undergoing entecavir treatment. PLoS One, 2010; 5:13869.

34.

Zhang

, Zhang

, Lin

et al. Interleukin-17-producing CD4 (+) T cells increase with severity of liver damage in patients with chronic hepatitis B. Hepatology, 2010; 51:81–91.