A Promising Trigene Recombinant Human Adenovirus Vaccine Against Classical Swine Fever Virus

Abstract

Classical swine fever (CSF) vaccine based on HAdV-5 had achieved an efficient protection in swine. Both classical swine fever virus (CSFV) E0 glycoprotein and E2 glycoprotein were the targets for neutralizing antibodies and related to immune protection against CSF. Interleukin-2 (IL2), as an adjuvant, also had been used in CSF vaccine research. In this study, coexpression of the CSFV E0, E2, and IL2 genes by HAdV-5 (rAdV-E0-E2-IL2) was constructed and immunized to evaluate its efficacy. Three expressed genes had been sequentially connected with foot-and-mouth disease virus 2A (FMDV 2A). The vaccine was administered by intramuscular inoculation to CSFV-free pigs (10⁸ TCID₅₀) twice at triweekly intervals. No adverse clinical signs were observed in any of the pigs after vaccination. The vaccine induced strong humoral and cellular responses that led to complete protection against clinical signs of lethal CSFV infection, viremia, and shedding of challenge virus. The rAdV-E0-E2-IL2 is a promising, efficient, and safe marker vaccine candidate against CSFV.

Introduction

Classical swine fever (CSF) is a highly contagious disease of domestic pigs and wild boar, and its causative virus, classical swine fever virus (CSFV), is a member of the genus Pestivirus of the family Flaviviridae (17). Both CSFV E0 glycoprotein (19) and E2 glycoprotein (31) were the targets for neutralizing antibodies (13) and related to immune protection against CSF (21), especially the E2 protein was the main component of marker vaccine (viral-vectored vaccines, subunit vaccines, DNA vaccine, etc.) (13,15,20,24,26,30). CSF vaccine based on HAdV-5 had achieved an efficient protection in swine (25,26). Coexpression of E0 and E2 genes of CSFV by HAdV-5 could completely protect pigs against virulent challenge (26), however, the vaccine needs double application and, in fact, its immune effect was lower than conventional vaccines. To optimize the efficacy further, combination with cytokines (e.g., interleukin-2 [IL2]) has been adopted as a strategy in vaccine design.

IL2 as an adjuvant has been proven to enhance the antigen-specific humoral and cellular immunities by promoting lymphocyte proliferation and activation in lots of reports (2,10,11,18). In current CSF vaccine research, porcine IL2 could enhance the immunogenicity of an alphavirus replicon-based DNA vaccine by coinjecting (29). In addition, rabbits immunized with CSF-vectored vaccine based on HAdV-5, which coexpressed E2 and IL2, could be completely protected against CSFV C strain and induced higher the CEFV E2-specific antibody titer compared to the rAdV-E2 expressing only the E2 glycoprotein in our previous study (8).

On this basis, coexpression of the CSFV E0, E2, and porcine IL2 genes by HAdV-5 (rAdV-E0-E2-IL2) was constructed and immunized to evaluate its efficacy in this study. The results suggest that the vaccine induced strong humoral and cellular responses that led to complete protection from lethal CSFV challenge.

Materials and Methods

Reagents, cells, and viruses

The rAdVs were packaged, propagated, and titrated in human embryonic kidney (HEK) 293 cells. The virulent CSFV Shimen strain was provided by the Control Institute of Veterinary Bioproducts and Pharmaceuticals. CSFV C-strain vaccine (lot No. 2014005) is a commercially available vaccine manufactured by LvFang Biotech Co.

Construction of the rAdVs

The CSFV E0, E2 genes (a and b) (GenBank: AY77517 8.2) and IL2 gene (GenBank: AY775178.2) were amplified by polymerase chain reaction (PCR) using the specific primers CSFV E0 F/R, E2 F1/R1, E2 F2/R2, and porcine IL2 F/R, respectively (Table 1). The E0-E2 and E2-IL2 were obtained by overlap extension PCR (E0 and E2a, E2b and IL2), digested by the restriction enzymes BglII (amino acids 525–530 at full-length E2 gene), and then ligated by T4 DNA ligase. The obtained fragment E0-E2-IL2 was cloned into the adenoviral shuttle vector rAdTrack-CMV (SalI and NotI sites) to obtain plasmid rAd-Track-E0-E2-IL2.The plasmid was homologous recombined with rAdEasy-1 in AdEasier-1 host bacteria BJ5183 and then was packaged in HEK293 cells. The positive plasmid was identified by PCR, restriction enzyme digestion analysis, and sequencing. Subsequently, the plasmid was linearized with the Pac I restriction endonucleases and transfected into HEK293 cells for viral amplification and package. The rAdV-E0-E2-IL2 was propagated and titrated in HEK293 cells. CSFV E0 and E2 protein expressed by rAdV-E0-E2-IL2 infected 293 cells determined by Western blot and IL2 expression was detected by a porcine IL2-specific ELISA (Hailan).

Table 1.

Primer Sequences for the rAdVs Constructing

Primers	Oligonucleotide sequences
CSFV E0 F	5′-ACGCGTCGACATGGAAAATATAACTCAAT-3′
CSFV E0 R	5′- GACGTCTCCCGCAAGCTTAAGAAG GTCAAAATTCAACAGCTG GGCATAGGCGCCAAAC-3′
CSFV E2 F1	5′- CTTCTTAAGCTTGCGGGAGACGTC GAGTCCAACCCTGGGCCC ATG AGGGGACAGATCGTGCAT-3′
CSFV E2 R1	5′-GC TCTAGA ACCAGCGGCGAGTTGTTCTGTTAG-3′
CSFV E2 F2	5′-CGG GGTACCATGCGGCTAGCCTGCAAGGAAG-3′
CSFV E2 R2	5′- GACGTCTCCCGCAAGCTTAAGAAG GTCAAAATTCAACAGCTG GGCGAGTTGTTCTGTTAG-3′
Porcine IL2 F	5′- CTTCTTAAGCTTGCGGGAGACGTC GAGTCCAACCCTGGGCCC ATGTACAGGATGCAACTCCTGTCTT-3′
Porcine IL2 R	5′-AAGGAAAAAAGCGGCCGCAGTCAGTGTTGAGATGATGCTT-3′

The restriction sequences of SalI (GTCGAC), XbaI (TCTAGA), KpnI (GGTACC), and NotI (GCGGCCGC) are underlined. The 2A sequences of FMDV are italicized. The overlapping 2A sequences of FMDV on primers are bold and italicized.

CSFV, classical swine fever virus; IL, interleukin.

Immunization and challenge

According to the Guidelines for the Care and Use of Animals of Northwest A & F University, this study was carried out, and animal experiments were approved by Care and Use of Animals Center, Northwest A & F University.

Fifteen CSFV-free cross-bred piglets, which were 6–7 weeks old, were double confirmed to be free to CSFV-specific serum antibodies and antigens using the IDEXX HerdChek* CSFV Antibody Test Kit and real-time reverse transcription (RT-PCR), respectively, and were randomly divided into five groups (A, B, C, D, and E) with three animals in each group. Groups A, B, and C were vaccinated with a dose of 10⁸ TCID₅₀ of rAdV-E0-E2-IL2, rAdV-E0-E2, and rAdV-E2-IL2 by intramuscular (i.m.) inoculation, respectively. All pigs were given a booster immunization at 21-day intervals. Group D was immunized with one-dose CSFV C-strain vaccine and served as the positive control. Group E was injected with Dulbecco's modified eagle medium (DMEM). Finally, all animals were challenged with 1 × 10³ TCID₅₀ of CSFV Shimen strain by intramuscular injection at 21 days after the second vaccination. Following the challenge, pigs were monitored daily for clinical signs (fever, anorexia, depression, shivering, hemorrhage, constipation, and diarrhea) of disease, and rectal temperatures were recorded. At 12 days postchallenge (DPC), all surviving pigs were euthanized.

Blocking ELISA and neutralization peroxidase-linked assay

Serum samples were collected from all pigs at 0, 7, 14, 21, 28, 35, and 42 days after immunization. CSFV-specific neutralizing antibodies in sera were tested by using the IDEXX HerdChek* CSFV Antibody Test Kit according to manufacturer's instructions and neutralization peroxidase-linked assay (NPLA) (28).

Lymphocyte proliferation assays and detection of swine interferon-γ

Cell-mediated immunity was evaluated by measuring lymphocyte proliferation with the WST-1 Cell Proliferation and Cytotoxicity Assay Kit (Beyotime) according to the manufacturer's instructions. T lymphocytes were stimulated with complete virus antigens of CSFV Shimen strain (MOI = 100), Concanavalin A (5 μg/mL; Sigma), or DMEM. The stimulation index (SI) = (the mean of OD_450nm for CSFV-stimulated cells)/(the mean of OD_450nm for medium-stimulated cells) was used to evaluate lymphocyte proliferation.

Swine interferon-γ (IFN-γ) was measured in serum by using ELISA kits (XinLe) following manufacturer's instructions 3 weeks after the booster immunization.

Swine IFN-γ gene expressions were assessed through real-time RT-PCR. Three weeks after the booster immunization, the whole blood samples of all pigs were collected. Total RNA was extracted from mixture, which had been mixed with equal amount of three samples in the group. The following two pairs of primers were used: forward, 5′-TGGTAGCTCTGGGAAACTGAATG-3′ and reverse, 5′-GGCTTTGCGCTGGATCTG-3′ for swine IFN-γ gene; forward, 5′-CAAGGACCTCTACGCCAACAC-3′ and reverse, 5′-TGGAGGCGCGATGATCTT-3′ for β-actin gene. PCR was performed using the SYBR ExScript™ RT-PCR Kit (Takara Bio) in iQ5 Real-Time PCR Detection System (Bio-Rad) with the following procedures: 95°C for 3 min followed by 35 cycles of 95°C for 10 sec; 60°C for 20 sec and 72°C for 20 sec. The tests were determined in triplicate. The β-actin was used as endogenous control to normalize the quantification of target genes. Data were assessed using 2^−ΔΔCt relative quantitative analysis according to the Ct value.

Virus isolation

Blood samples, as well as nasal and fecal swabs, were collected on day 0 after the challenge and every other day thereafter until pigs were euthanized. After freeze thawing thrice in phosphate-buffered saline, all samples were centrifuged at 8,000 g for 5 min, and the supernatant was used for viral isolation in PK15 cells. After 96 h, the monolayer cells were air dried, fixed for 2 h, and then incubated with anti-CSFV sera (diluted 1:100). After washing, the cells were incubated with Rabbit Anti-pig IgG/HRP antibody (diluted 1:200; BIOSS). Immunoreactivity of stained foci of cells was detected by a light microscope. If a negative result was identified, the supernatant was blind passaged thrice in cells and again subjected to CSFV detection.

CSFV RNA detected by real-time RT-PCR

The presence of CSFV in different tissues and organs was analyzed by the one-step quantitative real-Time RT-PCR assay as described previously (14). One-step Prime Script RT-PCR kit (Takara) and the primers: forward, 5′-GTTCTGCGAGGTGACCAAAAG-3′, reverse, 5′-GATGCACACATAAGTATGGTAAAGC-3′, and Probe 5′-(FAM) TCCGTCGCTACCTGTCACCCTACCT (Eclipse)-3′ were used under the following conditions: 20 min at 42°C, 30 sec at 95°C, and 40 cycles of 15 sec at 95°C, 20 sec at 57°C, and 15 sec at 72°C. Data were analyzed according to the Ct method. According to the established standard curve, the following formula: copy number = (45.665 − CT value)/3.4692 was implemented to calculate the copy number of CSFV RNA.

Statistical analysis

Data are presented as mean ± SEM. Differences in each group were examined for statistical significance using Student's t-test of SPSS 13.0 software. Differences of p < 0.05 were considered statistically significant.

Results

The package and identification of rAdV-E0-E2-IL2

The rAdV-E0-E2-IL2 was typically generated at day 9 and exhibited fluorescence in 293 cells. Cytopathogenic effects appeared in the 293 cells 24 h following infection with the obtained rAdV-E0-E2-IL2. The titer of rAdV-E0-E2-IL2 was maintained above the 10⁸ TCID₅₀/mL after five passages. The CSFV E0 and E2 protein expressed in 293 cells infected with rAdV-E0-E2-IL2 were confirmed by Western blot with the use of anti-CSFV serum (Fig. 1). Approximately 45- and 50-kDa-specific bands were clearly visible in the rAd-E0-E2-IL2-infected cell extracts. According to molecular weight of the above bands, the predicted proteins were CSFV E0 and E2, respectively. No specific bands were observed in the cell lysates of mock group and rAdV empty vector-infected group. In addition, IL2 expression in the supernatant of infected cells was confirmed by a porcine IL2-specific ELISA. The results showed that three proteins could be expressed correctly and independently in vitro.

FIG. 1.

Western blot analysis of the E0 and E2 protein expression in rAdV-E0-E2-IL2 infected 293 cells. Lane 1, lysates of 293 cells infected by rAdV-E0-E2-IL2; lane 2, lysates of 293 cells infected by rAdV empty vector; lane 3, normal 293 cells lysates. The arrows indicate the bands of protein. The anti-CSFV sera (diluted 1:100) and Rabbit anti-swine IgG (diluted 1:1,000; Sigma) were used as the first antibody and the secondary antibody, respectively. Porcine GAPDH protein was determined by using a mouse anti-porcine GAPDH antibody (LifeSpan Biosciences). CSFV, classical swine fever virus; IL, interleukin.

Antibody production

After vaccinating, the CSFV E2-specific antibodies in the sera of all pigs were measured by NPLA and blocking ELISA. As shown in Table 2, the pigs immunized with rAdV-E0-E2-IL2, rAdV-E0-E2, and rAdV-E2-IL2 developed detectable antibody titers 2 weeks after the prime immunization. CSFV E2-specific antibodies were markedly increased after booster immunization. The CSFV E2-specific antibody titer of group A was higher than that in the groups B and C after the booster immunization. However, the CSFV E2-specific antibody titer of group A was lower than that in the group D after the booster immunization. The pigs immunized with DMEM (group E) did not develop detectable antibody titers (<4) during the experiment.

Table 2.

Serum Antibody Titers in Immunized Pigs Detected by Neutralization Peroxidase-Linked Assay

			Days post vaccine
Groups	Vaccines	Pig No.	0 ^a	7	14	21 ^b	28	35	42 ^c
A	rAdV-E0-E2-IL2	A1	0	4	16	64	256	512	512
		A2	0	4	8	16	128	128	256
		A3	0	8	16	32	128	256	512
	Mean		0	5.3	13.3	37.3	170.7	298.7	426.7
B	rAdV-E0-E2	B1	0	4	16	64	128	256	512
		B2	0	4	8	16	64	128	256
		B3	0	4	16	32	128	256	256
	Mean		0	4	13.3	37.3	106.7	213.3	341.3
C	rAdV-E2-IL2	C1	0	0	4	8	32	64	128
		C2	0	8	16	64	128	256	256
		C3	0	4	8	16	64	128	128
	Mean		0	4	9.3	29.3	74.7	149.3	170.7
D	CSFV C strain	D1	0	8	32	64	128	256	512
		D2	0	4	16	32	256	512	512
		D3	0	8	32	64	256	512	512
	Mean		0	6.7	26.7	53.3	213.3	426.7	512
E	DMEM	E1	0	<4	<4	<4	<4	<4	<4
		E2	0	<4	<4	<4	<4	<4	<4
		E3	0	<4	<4	<4	<4	<4	<4
	Mean		0	<4	<4	<4	<4	<4	<4

NPLA titers are expressed as the reciprocal of the serum dilution that neutralized 200 TCID₅₀ of the CSFV “Shimen” strain in 50% of the replicate cultures.

First vaccination.

Second vaccination.

Challenge.

DMEM, dulbecco's modified eagle medium; NPLA, neutralization peroxidase-linked assay.

As shown in Table 3, the mean antibody blocking rate of the group A, B, C, D, and E was 56.7%, 52.0%, 45.3%, 63.0%, and 6.2%, 3 weeks after the booster immunization, respectively. According to the cutoff of the assay (40%), CSFV E2-specific antibodies were detected in the groups of A (3/3), B (3/3), C (3/3), D (3/3), and E (0/3), respectively. The mean antibody blocking rate of the groups A, B, C, and D increased gradually, especially the group D in which all pigs seroconverted at 35 days after immunization.

Table 3.

Serum Antibody Blocking Rate Detected by Blocking ELISA

			Antibody blocking rates (%)
Groups	Vaccines	Pig No.	0 ^a	7	14	21 ^b	28	35	42 ^c
A	rAdV-E0-E2-IL2	A1	4	15	20	38	44	55	55
		A2	6	10	23	26	35	42	53
		A3	5	9	13	35	41	51	62
	Mean		5	11.3	18.7	33	40	49.3	56.7
B	rAdV-E0-E2	B1	4	14	21	35	43	50	54
		B2	6	8	16	23	37	41	45
		B3	5	11	17	36	42	46	57
	Mean		5	11	18	31.3	40.7	45.7	52
C	rAdV-E2-IL2	C1	5	7	16	24	29	37	41
		C2	3	6	21	26	35	40	50
		C3	7	11	22	28	37	41	45
	Mean		5	8	19.7	26	33.7	39.3	45.3
D	CSFV C strain	D1	5	27	36	48	59	67	65
		D2	3	12	24	31	37	48	55
		D3	6	19	34	42	53	60	69
	Mean		5.8	18.4	29.8	39.4	47	56.2	63
E	DMEM	E1	5	4	7	3	8	5	5
		E2	3	7	5	8	4	6	6
		E3	6	3	8	7	7	9	9
	Mean		5	4.4	6.2	6.8	5.8	6.2	6.2

All serum samples were collected weekly and tested the anti-CSFV antibodies with the IDEXX HerdChek^* CSFV Antibody Test Kit.

First vaccination.

Second vaccination.

Challenge.

Cell-mediated immune response

Cell-mediated immunity in immunized pigs was evaluated through CSFV-specific lymphocyte proliferation 3 weeks after the booster immunization. Lymphocyte proliferative responses were observed in groups A, B, C, and D. Cell-mediated immunity was the highest in group D, followed by group A and C. No CSFV-specific proliferation was observed in group E. Significant differences in SI were observed between the groups A and B (p < 0.01), or groups A and C (p < 0.05), whereas no significant difference in SI was observed between the groups A and D (p > 0.05) (Fig. 2).

FIG. 2.

SI of the group rAdV-E0-E2-IL2. Significant differences in SI were observed between the rAdV-E0-E2-IL2 and rAdV-E0-E2 immunization groups (**p < 0.01), or rAdV-E2-IL2 immunization groups (*p < 0.05), whereas no significant difference in SI was observed between rAdV-E0-E2-IL2 and CSFV C strain immunization groups (p > 0.05). SI, stimulation index.

The level of antigen-specific IFN-γ production can be used as an indicator of cellular immunity. Swine IFN-γ content in the immunized pig sera was measured by using ELISA kits 3 weeks after booster immunization. We observed that there were significant differences in swine IFN-γ between the groups A and B (p < 0.01), or groups A and C (p < 0.05). However, we found no significant differences in swine IFN-γ content between the group A and D (p > 0.05) (Fig. 3).

FIG. 3.

Content of the Swine IFN-γ in the sera of experimental piglets. There were significant differences in swine IFN-γ content between the rAdV-E0-E2-IL2 and rAdV-E0-E2 (**p < 0.01), or rAdV-E2-IL2 immunization groups (*p < 0.05).

Swine IFN-γ gene expression was assessed in whole blood by using real-time RT-PCR. Figure 4 shows that after vaccination, the highest relative swine IFN-γ mRNA fold was detected in group D compared with the groups A, B, and C, 3 weeks after the booster immunization. Between the groups A and B, or C, there were significant differences in relative swine IFN-γ mRNA fold in the blood (p < 0.05). However, between the groups A and D, the differences in relative swine IFN-γ mRNA fold in the blood were unremarkable (p > 0.05) (Fig. 4).

FIG. 4.

The relative swine IFN-γ mRNA fold in the whole blood of experimental piglets. Between the rAdV-E0-E2-IL2 and rAdV-E0-E2, or rAdV-E2-IL2, the difference in relative swine IFN-γ mRNA fold in the blood was also remarkable (*p < 0.05).

Protection of immunized pigs from virulent challenge

Twenty-one days after the booster immunization with rAdV-E0-E2-IL2 or rAdV-E2-IL2 (day 42 p.i.), all experimental pigs were inoculated intramuscularly with CSFV Shimen strain (10³ TCID₅₀). Protective immunity was assessed through clinical signs, including body temperature. After challenge with virulent CSFV, no clinical signs were observed in pigs immunized with rAdV-E0-E2-IL2, rAdV-E0-E2, rAdV-E2-IL2, or CSFV C-strain. However, all pigs in Group E developed a high fever (rectal temperature above 40°C) from 2 DPC and gradually displayed the typical clinical signs of CSF (inappetence, apathy, chill, prostration, incoordination, and constipation, followed by diarrhea, locomotor ataxia, and posterior paresis). Finally, all the pigs died within 10 DPC.

The viruses were readily detected in all samples of group E between 4 to 10 DPC. However, the pigs immunized with rAdV-E0-E2-IL2, rAdV-E0-E2, rAdV-E2-IL2, or CSFV C-strain did not show any virus after lethal challenge.

All the survived pigs were euthanized and gross lesion of pigs was examined at 12 DPC. The pigs immunized with rAdV-E0-E2-IL2, rAdV-E0-E2, rAdV-E2-IL2, and CSFV C-strain did not present any gross lesion. The pigs in group E presented severe pathological changes of typical CSF (hemorrhages with necrotic foci in the tonsils, enlargement and hemorrhage of the lymph nodes, infarcts in the spleen, extensive petechiae in the kidney and bladder, and button-like ulcers in the ileocecal valve). Moreover, CSFV was detected from various organs (blood, spleen, kidney, intestines, lymphonodi mesenterici, and tonsil) of the pigs through real-time PCR. No viral RNA was noted in pigs immunized with rAdV-E0-E2-IL2, rAdV-E0-E2, rAdV-E2-IL2, or CSFV C-strain. CSFV RNA was also detected in all pigs vaccinated with DMEM. The copy number of CSFV RNA was detected in group E and the amount of CSFV virions was different in different tissue (10^3–10⁶ copies/μL) of each pig. These results were consistent with gross lesion examination.

Discussion

In many countries, the morbidity and mortality of CSF were significantly reduced because of vaccination with live attenuated vaccine, which has been widely used. However, this vaccine was unable to discriminate naturally infected pigs from vaccine-injected pigs (Differentiating Infected from Vaccinated Animals [DIVA]) and unacceptable to “stamping-out” policy. Therefore, developing a new type of CSF marker vaccine is necessary. To achieve this, numerous candidate vaccines surrounding CSFV or its structural protein E2 and/or E^rns, which can induce virus-NAbs and offer protective immunity in the natural host, were investigated by various strategies and methods. Among them, HAdV-5 could provide an effective vaccine delivery of a variety of agents to swine and had been demonstrated. Although various vaccines with high efficacy have been developed, a more potent adjuvant with defined and appropriate properties is required to improve the immunogenicity of many antigens.

A variety of cytokines secreted by many cells (macrophages, T cells, etc) can be used as immune modulator proteins to enhance the normal immune response. IL2, which is an important regulator of immunity, can induce differentiation and proliferation of activated T cells (from G0 phase to S phase), enhances natural killer cell cytotoxicity and activates monocytes and macrophages, and can promote lymphocyte proliferation, activation, and the production of antibodies and cytokines (22,23). In addition, IL2 also stimulates proliferation of activated B lymphocytes and induces immunoglobulin (IgM and IgG) secretion (3). A number of results published to date have clearly shown that costimulation of plasmids encoding the IL2 gene with different kinds of vaccines results in enhancement of both humoral and cell-mediated immune responses in immunized animals and mostly favors Th1 cell differentiation (6,12,32). IL2 is a promising cytokine adjuvant for inactivated and subunit vaccines as well as DNA vaccines (1,2,9 –11,18). IL2 also had been used in CSF vaccine research (8,29) and increase CSFV-specific immune response. So, we combined this information with our previous research and further constructed CSF-vectored vaccine based on human adenovirus coexpressing the CSFV E0, E2, and porcine IL2 genes (rAdV-E0-E2-IL2). Three expressed genes had been linked by foot-and-mouth disease virus 2A (FMDV 2A) sequentially. FMDV 2A or 2A-like sequences have become an alternative method and had been devised to coexpress multiple proteins under the control of a single promoter. 2A mediates a cotranslational “ribosome skipping,” which allows translation of multiple proteins from a single mRNA and cleaves at its own C terminus between the last two amino acids during protein translation. Compared to internal ribosome entry site, the other most common coexpressing approach, 2A is particularly short and the activity of each protein expressed was completely independent (4,5,7,16,33). To date, many “2A-like” sequences have been used successfully and also were an effective strategy to express multiple glycoprotein genes in adenoviruses (27). Our results showed that three proteins could be proved to express correctly in vitro and could be separated during posttranslational self-cleavage of the 2A peptide linker.

The rAdV-E0-E2-IL2 with 10⁸ TCID₅₀ was intramuscularly administered twice to CSFV-free pigs at 21-day intervals. No adverse clinical reactions were observed in any of the pigs after the vaccination. Neither CSFV RNA nor pathological changes were detected in the tissues after the CSFV challenge. The pigs immunized with rAdV-E0-E2-IL2 could not detect any virus after lethal challenge, which indicated that the vaccine could effectively prevent virus shedding. Pigs immunized with rAdV-E0-E2-IL2 were completely protected against lethal challenge. There were some differences between rAdV-E0-E2-IL2 and rAdV-E0-E2 or rAdV-E2-IL2, although the three recombinant viruses provided complete protection to immunized pigs against the lethal CSFV challenge. CSFV E2-specific antibodies titer of rAdV-E0-E2-IL2 were markedly increased faster and higher than rAdV-E0-E2 or rAdV-E2-IL2 after booster immunization. The differences in CSFV E2-specific antibodies were statistically unremarkable, however, the cellular immunities of rAdV-E0-E2-IL2 were superior to that of rAdV-E0-E2 or rAdV-E2-IL2. Whatever the SI, swine IFN-γ content, or relation IFN-γ mRNA gene expression, significant differences were observed between the rAdV-E0-E2-IL2 and rAdV-E0-E2 groups, or rAdV-E0-E2-IL2 and rAdV-E0-E2 groups, whereas no significant difference was observed between the rAdV-E0-E2-IL2 and CSFV C strain groups (p > 0.05). These results demonstrated that the rAdV-E0-E2-IL2 was superior to rAdV-E2-IL2 in cell-mediated immune response. Based on the promising results of the above, rAdV-E0-E2-IL2 are still needed to comprehensively evaluate, such as, whether a single administering of the vaccines could protect pigs from CSFV challenge, what were the optimal dosage, and schedule for immunization. So, considering the good immunization protection and the advantage of DIVA, rAdV-E0-E2-IL2 can be used as an alternative to the existing DIVA vaccine in controlling CSF and eradicating epidemic areas.

In summary, we introduced the CSFV E0, E2, and porcine IL2 into vectored vaccine based on HAdV-5 (rAdV-E0-E2-IL2) by coexpressing trigene linked by FMDV 2A for the first time. The vaccine induced strong humoral and cellular responses that led to complete protection from lethal CSFV challenge. The rAdV-E0-E2-IL2 is a promising, efficient, and safe marker vaccine candidate against CSFV.

Footnotes

Acknowledgments

This study was supported by the key scientific and technological innovation team project of Shaanxi Province (No. 2013KCT-28) and scientific and technological coordination, innovation, and plan projects of Shaanxi Province: genetic engineering vaccine research and development of major pig disease (No. 2014KTCQ02-02). The authors appreciate the help of staffs from the Yangling Lvfang Bio-engineering Co. Ltd. during pig managements and sample collection.

Author Disclosure Statement

The authors declare that they have no conflicts of interest.

References

Chen

, Lin

, Li

, et al. Enhancement of Helicobacter pylori outer inflammatory protein DNA vaccine efficacy by co-delivery of interleukin-2 and B subunit heat-labile toxin gene encoded plasmids. Microbiol Immunol, 2012; 56:85–92.

Chow

, Chiang

, Lee

, et al. Development of Th1 and Th2 populations and the nature of immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes. J Immunol, 1998; 160:1320–1329.

Collins

, and Oldham

. Recombinant human interleukin 2 induces proliferation and immunoglobulin secretion by bovine B-cells: tissue differences and preferential enhancement of immunoglobulin A. Vet Immunol Immunopathol, 1993; 36:31–43.

de Felipe

, Martin

, Cortes

, et al. Use of the 2A sequence from foot-and-mouth disease virus in the generation of retroviral vectors for gene therapy. Gene Ther, 1999; 6:198–208.

Gao

, Zhou

, Zhang

, et al. The silent point mutations at the cleavage site of 2A/2B have no effect on the self-cleavage activity of 2A of foot-and-mouth disease virus. Infect Genet Evol, 2014; 28:101–106.

Geissler

, Gesien

, Tokushige

, et al. Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines augmented with cytokine-expressing plasmids. J Immunol, 1997; 158:1231–1237.

Gullberg

, Polacek

, and Belsham

. Sequence adaptations affecting cleavage of the VP1/2A junction by the 3C protease in foot-and-mouth disease virus-infected cells. J Gen Virol, 2014; 95(Pt 11):2402–2410.

, Zhang

, Xu

, et al. [Construction and immunogenicity of a recombinant adenovirus co-expressing the E2 protein of classical swine fever virus and the porcine interleukin 2 in rabbits]. Bing Du Xue Bao, 2010; 26:385–391.

, Tao

, Wang

, et al. Enhancing immune responses against SARS-CoV nucleocapsid DNA vaccine by co-inoculating interleukin-2 expressing vector in mice. Biotechnol Lett, 2009; 31:1685–1693.

10.

Kim

, Yang

, Dang

, et al. Engineering enhancement of immune responses to DNA-based vaccines in a prostate cancer model in rhesus macaques through the use of cytokine gene adjuvants. Clin Cancer Res, 2001; 7(3 Suppl):882s–889s.

11.

Kim

, Yang

, Montaner

, et al. Coimmunization with IFN-gamma or IL-2, but not IL-13 or IL-4 cDNA can enhance Th1-type DNA vaccine-induced immune responses in vivo . J Interferon Cytokine Res, 2000; 20:311–319.

12.

Kuhnle

, Collins

, Scott

, et al. Bovine interleukins 2 and 4 expressed in recombinant bovine herpesvirus 1 are biologically active secreted glycoproteins. J Gen Virol, 1996; 77(Pt 9):2231–2240.

13.

Langedijk

, Middel

, Meloen

, et al. Enzyme-linked immunosorbent assay using a virus type-specific peptide based on a subdomain of envelope protein Erns for serologic diagnosis of pestivirus infections in swine. J Clin Microbiol, 2001; 39:906–912.

14.

, Wang

, Liang

, et al. Integrin beta3 is required in infection and proliferation of classical swine fever virus. PLoS One, 2014; 9:e110911.

15.

Lin

, Trottier

, Pasick

, et al. Identification of antigenic regions of the erns protein for pig antibodies elicited during classical swine fever virus infection. J Biochem, 2004; 136:795–804.

16.

Minskaia

, and Ryan

. Protein coexpression using FMDV 2A: effect of “linker” residues. Biomed Res Int, 2013; 291730:1–12.

17.

Moennig

, Floegel-Niesmann

, and Greiser-Wilke

. Clinical signs and epidemiology of classical swine fever: a review of new knowledge. Vet J, 2003; 165:11–20.

18.

Nobiron

, Thompson

, Brownlie

, et al. Cytokine adjuvancy of BVDV DNA vaccine enhances both humoral and cellular immune responses in mice. Vaccine, 2001; 19:4226–4235.

19.

Paton

, Ibata

, Edwards

, et al. An ELISA detecting antibody to conserved pestivirus epitopes. J Virol Methods, 1991; 31:315–324.

20.

Reimann

, Depner

, Trapp

, et al. An avirulent chimeric Pestivirus with altered cell tropism protects pigs against lethal infection with classical swine fever virus. Virology, 2004; 322:143–157.

21.

Rumenapf

, Stark

, Meyers

, et al. Structural proteins of hog cholera virus expressed by vaccinia virus: further characterization and induction of protective immunity. J Virol, 1991; 65:589–597.

22.

Siegel

, Sharon

, Smith

, et al. The IL-2 receptor beta chain (p70): role in mediating signals for LAK, NK, and proliferative activities. Science, 1987; 238:75–78.

23.

Smith

. Interleukin-2: inception, impact, and implications. Science, 1988; 240:1169–1176.

24.

Sun

, Li

H-Y

, Tian

D-Y

, et al. A novel alphavirus replicon-vectored vaccine delivered by adenovirus induces sterile immunity against classical swine fever. Vaccine, 2011; 29:8364–8372.

25.

Sun

, Liu

D-F

, Wang

Y-F

, et al. Generation and efficacy evaluation of a recombinant adenovirus expressing the E2 protein of classical swine fever virus. Res Vet Sci, 2010; 88:77–82.

26.

Sun

, Yang

, Zheng

, et al. Co-expression of Erns and E2 genes of classical swine fever virus by replication-defective recombinant adenovirus completely protects pigs against virulent challenge with classical swine fever virus. Res Vet Sci, 2013; 94:354–360.

27.

Tan

, Liang

, Chen

, et al. Coexpression of double or triple copies of the rabies virus glycoprotein gene using a ‘self-cleaving’ 2A peptide-based replication-defective human adenovirus serotype 5 vector. Biologicals, 2010; 38:586–593.

28.

Terpstra

, Bloemraad

, and Gielkens

. The neutralizing peroxidase-linked assay for detection of antibody against swine fever virus. Vet Microbiol, 1984; 9:113–120.

29.

Tian

, Sun

, Wai

, et al. Enhancement of the immunogenicity of an alphavirus replicon-based DNA vaccine against classical swine fever by electroporation and coinjection with a plasmid expressing porcine interleukin 2. Vaccine, 2012; 30:3587–3594.

30.

Voigt

, Merant

, Wienhold

, et al. Efficient priming against classical swine fever with a safe glycoprotein E2 expressing Orf virus recombinant (ORFV VrV-E2). Vaccine, 2007; 25:5915–5926.

31.

Weiland

, Ahl

, Stark

, et al. A 2nd envelope glycoprotein mediates neutralization of a pestivirus, hog-cholera virus. J Virol, 1992; 66:3677–3682.

32.

Wong

, Cheng

, Sin

, et al. A DNA vaccine against foot-and-mouth disease elicits an immune response in swine which is enhanced by co-administration with interleukin-2. Vaccine, 2002; 20:2641–2647.

33.

Yen

, and Scheerlinck

. Biological activity of ovine IL-23 expressed using a foot-and-mouth disease virus 2A self-cleaving peptide. Cytokine, 2013; 6:744–746.