Human Cytomegalovirus Impact on mir-146a Expression Levels in Kidney Transplant Patients

Abstract

It is known that several viruses can alter or modulate the transcriptional and translational activity of host cells to obtain a rapid and efficient replication. In particular, Human Cytomegalovirus (HCMV) can interact with host cell at multiple levels, even modulating the expression of small signaling molecules called microRNAs. Especially, human miRNA mir-146a expression seems to be downregulated by HCMV infection in vitro. The aim of this study was to evaluate mir-146a expression in kidney transplant patients during HCMV infection. Sixty-four serum samples from 22 kidney transplant patients were analyzed and subdivided in three groups (high viral load, low viral load, and absent viral load). Mir-146a expression for each sample has been evaluated by a specific stem-loop Real Time polymerase chain reaction, and a statistical analysis was performed. Expression levels of mir-146a were similar among the three groups tested showing no statistical significant difference. Results obtained did not confirm data previously reported in literature, but the change of mir-146a expression levels has to be more clearly defined as it could not be directly caused by virus replication.

Introduction

The interaction between virus and host cell is trivial for viral replication. It is known that several viruses can alter or modulate the transcriptional and translational activity of host cells to obtain a rapid and efficient replication.

Among the viruses able to redirect the normal cellular activity, the most important is the Herpesvirus family, which during the coevolution with human kind has refined its infectious approach up to the point of being mostly asymptomatic and developing a latent stage of infection, that ensures the opportunity to be safely inside the organism and spread whenever the immune defense decreases.

Recently, it has been observed that Herpesvirus family interacts with host cell at multiple levels, modulating the expression of small signaling molecules called microRNAs (miRNAs). The role of these short-length, double-strand genome-encoded RNAs is to repress posttranscriptionally cellular mRNA expression by the hybridization of miRNA with a complementary region on the target gene; this bond is the starting signal that leads to the cleavage of target gene mRNA and its consequent downregulation (6). For what concerns Herpesvirus family, miRNA modulation seems to contribute to infection, affecting mRNAs involved in biological pathways important during the infectious process, such as ERK/MAP and PI3K/AKT pathways, prostaglandin synthesis, and oxidative stress signaling (2). Among the members of Herpesvirus family, Human Cytomegalovirus (HCMV) represents one of the most studied viruses for its responsibility in many pathologies in immunocompromised patients, such as transplant patients. HCMV is a member of β-Herpesvirus subfamily and is widely diffused in human population, with a worldwide prevalence ranging from 50% to 90%. As other members of its family, it is recently described for its capability to avoid host immune response by viral miRNA production (3) or through the modulation of cellular pathways related to PI3K/AKT signaling, ERK/MAPK signaling, prostaglandin synthesis, oxidative stress signaling, and pathways involved in endocytic viral entry that are all important during HCMV infection (5).

As reported in a study by Wang et al. (8), several host cellular miRNAs are modulated during HCMV infection. In particular, mir-146a, together with mir-155 and other miRNAs that negatively regulate innate immune response (7), resulted in downregulated in vitro.

In the following study, 64 serum samples from 22 transplanted patients were analyzed by a stem-loop Real Time polymerase chain reaction (PCR) approach to estimate expression levels of mir-146a and compare them to HCMV viral load on serum, to point out a possible negative regulation due to HCMV active infection.

Material and Methods

Study population

Eleven Twenty-two kidney transplant patients (13/9 M/F, mean age 57 ± 12.6 years) afferent to Ospedale Maggiore della Carità (Novara, Northern Italy) were enrolled in this study from 1 to 8 years posttransplantation. Informed consent from all individual participants was obtained. The immunosuppressive treatment was based of tacrolimus and mycophenolate mofetil and ganciclovir in presence of CMV infection. Sixty-four serum samples were obtained from all the patients and divided in three categories, based on CMV viral load: (i) samples with no CMV viral load; (ii) samples with a low viral load ranging from 110 to 1,560 copies/mL, and (iii) samples with a high viral load (2,070–690,000 copies/mL).

Test design

The Primer and Minor Groove Binder (MGB) probe design was performed using Primer Express 3.0 (Life Technologies, Carlsbad, CA). Forward primers and MGB probes were designed specifically for mir-146a and RNU43 detection. The primers and probes are listed in Table 1.

Table 1.

Primers and Probe List

Target	RNU43
Sequence	GAACUUAUUGACGGGCGGACAGAAACUGUGUGCUGAUUGUCACGUUCUGAUU
SLP	GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAATCAG
Forward	TGACGGGCGGACAGAAA
Probe MGB fam	TGTGTGCTGATTGTCA

Target	mir-146
Sequence	UGAGAACUGAAUUCCAUGGGUU
SLP	GGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCA
Forward	CGCAGTGAGAACTGAATTCCAT
Probe MGB fam	GGGTTGGCTCTGG

All the sequences are written in 5′–3′ direction.

MGB, minor groove binder; SLP, stem-loop primer.

DNA extraction

Starting from 1 mL of serum sample, to which 10 μL of CPE-DNA (Q-CMV Real Time Complete Kit; ELITech Group, Puteaux, France) was added, the DNA extraction was performed using automatic extractor easyMAG (Biomérieux, Marcy l'Etoile, France) according to the manufacturer's instruction. A final elution in a 25 μL final volume was carried out.

HCMV real time PCR

HCMV viral load quantification was performed by Real Time PCR, adding 5 μL of elute DNA to 20 μL of amplification mix (Q-CMV Real Time Complete Kit; ELITech Group, Puteaux, France). The amplification reaction was executed on ABI 7500 Real Time PCR system (Life technologies) with the following thermal profile: 50°C 2′, 95°C 10′, 45 cycles of 95°C 15", and 60°C 1′. The viral quantification was reported as copies/mL with an inferior detection limit set as 110 copies/mL.

RNA extraction

RNA extraction was achieved starting from 400 μL of thawed serum samples and following an RNAzol extraction protocol modified by Bergallo et al. (1).

Reverse transcription

RNA reverse transcription was obtained starting from 500 ng of total RNA. The GeneAmp RNA PCR Kit (Life technologies) was used, including some protocol modifications as follows: 50 U of MMLV RT, 1 mM dNTPs, 5 mM MgCl₂, 1 U RNase Inhibitor, 1× PCR Buffer II, and 0.5 μg of mir-155 mir-146 stem-loop primer (SLP). The reaction was carried out as follows: an initial incubation at 16°C for 30 min, a second one at 42°C for 1 h, and a final incubation at 99°C for 5 min. Primer and probe used in this article were previously described (1).

RNA quality and integrity evaluation

NanoDrop ND-2000 (Thermo Fisher Scientific, Wilmington, DE) was used to evaluate RNA purity and concentration by spectrophotometry. 260/230 and 260/280 Absorbance ratios were checked to assess the presence of contaminants: peptides, phenols, aromatic compounds, or carbohydrates and proteins.

mir-146a expression evaluation

An asymmetric PCR with 300 nM of specific forward primer (Table 1), 0.1 U of GoTaq^® Hot Start polymerase (Promega, Bergamo, Italy), 4 μL of 5× Colorless GoTaq Flexi Buffer, and 2 μL of cDNA, in a final volume of 20 μL, was carried out. The thermal profile was the following: 95°C for 2 min; 30 cycles of 94°C for 15 sec, 55°C for 30 sec, and 72°C for 20 sec.

Five microliters of enriched cDNA (ccDNA) was added to 35 μL of reaction mix containing the following: 800 nM of forward primer, 1,000 nM of universal reverse primer, 200 nM of MGB probe, and 1× TaqMan Universal PCR Master Mix (P/N: 4324018; Life technologies). The amplifications were all performed on ABI 7500 Real Time PCR system (Life technologies) in a 96-well plate at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Each sample was run in triplicate.

The level of mir-146a expression was estimated using the Cq (cycle quantification) value, the fractional cycle number at which fluorescence from amplification exceeds the background fluorescence.

The determination of miRNA expression was obtained using the 2^−ΔCq method for relative quantification. ΔCq was calculated subtracting the Cq value of RNU43 RNA from the Cq value of the mir-146a. RNU43 Cq values were obtained by a parallel, asymmetric, and Real Time amplification with specific forward primer, probe, and universal primer at same conditions of mir-146a amplification.

The normalized expression levels of mir-146a were calculated using the equation: Expression Levels = 2^−ΔCq.

A negative control with ddH₂O was included in the reaction to avoid false positive results.

Statistical analyses

To compare two population means that come from the same population, we analyzed the results by Mann–Whitney and p-values calculated by GraphPad Prism 5 (GraphPad Software, La Jolla, CA). In all analyses, p < 0.05 was taken to indicate statistical significance. Spearman's test was used to correlate two series of data. A p-value of <0.05 was considered significant.

Results

A total number of 64 serum samples from 22 kidney transplant patients were included in this study. On all the samples, a Real Time PCR test for HCMV detection was performed, following the medical guidelines for transplant patients' healthcare. A total of 42 samples were positive to HCMV acute infection, 21 with a low viral load between 110 and 1,600 copies/mL and 21 with a high viral load above 1,600 copies/mL. The remaining 22 samples were negative to the test (Table 2).

Table 2.

Patient Groups Subdivided by Viral Load

	CMV viral load
NEGATIVE
1	NEG
2	NEG
3	NEG
4	NEG
5	NEG
6	NEG
7	NEG
8	NEG
9	NEG
10	NEG
11	NEG
12	NEG
13	NEG
14	NEG
15	NEG
16	NEG
17	NEG
18	NEG
19	NEG
20	NEG
21	NEG
HIGH
22	117100
23	12780
24	2490
25	4200
26	60500
27	31760
28	3960
29	690000
30	4630
31	4270
32	48500
33	7700
34	41000
35	49240
36	17900
37	11000
38	15920
39	10350
40	2070
41	2810
42	3700
LOW
43	1540
44	960
45	600
46	430
47	110
48	250
49	420
50	1560
51	470
52	840
53	310
54	1070
55	1440
56	320
57	455
58	1390
59	290
60	440
61	230
62	520
63	1380
64	610

Viral load is expressed in copies/mL.

A stem-loop Real Time PCR was performed on RNA extracted after an enrichment step by an asymmetric PCR on both mir-146a and RNU43 target RNAs. The values obtained were subjected to a relative quantification to compare and determine mir-146a normalized expression levels. As observable in Figure 1, mir-146a levels from each single serum sample were grouped depending on HCMV load of the sample itself, obtaining three groups that were analyzed and compared two by two with Mann–Whitney test.

FIG. 1.

mir-146a expression level comparison. mir-146a expression levels of samples with a HCMV viral load higher than 2070 (A), between 110 and 1560 (B), or negative to HCMV (C) were compared to each other. Mean and standard error of mean bars are displayed. HCMV, human cytomegalovirus.

The comparison of mir-146a levels among the three groups did not show any statistically significant difference, nor considering the group with a higher viral load versus the group with an absent viral load, nor considering both the groups with a quantifiable viral load versus the remaining one.

The mir-146a expression levels, evaluated by stem-loop Real time PCR analysis, in sera, plotted against HCMV viral load. Spearman's test demonstrated no correlation between the mir-146a and HCMV viral load (Fig. 2).

FIG. 2.

Correlation analysis. Spearman's Correlation analysis between mir-146a expression and HCMV viral load. p = 0.7818 and p = 0.4733 were obtained comparing high and low viral load with mir-146a expression, respectively.

Discussion

Recent findings showed that HCMV alters directly or indirectly the normal expression of host cell miRNAs, to enhance its replication and survival maintaining growth, metabolic, and antiapoptotic functions (2). A study by Wang et al. (7) showed, through a microarray analysis of miRNAs from HCMV-infected MRC5 cells, a noteworthy expression level change of 49 cellular miRNAs at least 48 h post infection. As the infection proceeded, a progressive reduction or increase of cellular miRNA levels was observable, suggesting a possible role of HCMV replication and viral load in this level change. Considering miRNAs analyzed in Wang's work, mir-146a levels were found reduced with a higher than twofold decrease. This miRNA seems to be responsible for a negative feedback that could regulate Toll-like receptor and cytokine receptor signaling by the posttranslational repression of targets such as IL-1 receptor-associated kinase 1(IRAK1) and TNF receptor-associated factor 6 (TRAF6) (8).

The aim of this work was to evaluate mir-146a level change in 64 serum samples from 22 kidney transplant patients with a HCMV-positive serostatus, to establish a possible correlation between target miRNA reduction and HCMV viral load and to possibly confirm the results found by Wang et al.

To establish a possible correlation between mir-146a level change and HCMV viral load, all the samples were first examined to evaluate HCMV load and, subsequently, subdivided into three categories according to the result obtained. The analysis of mir-146a levels was performed by a specific stem-loop Real Time PCR, and results were compared between the three groups to establish any significant difference.

As observable in Figure 1, mir-146a level comparison did not show any statistical difference. mir-146a expression, indeed, attained similar levels in the three groups examined, not confirming the results found by Wang et al. This comparable measure of mir-146a serum levels among the groups did not confirm the results from Wang's work. However, mir-146a decrease could be considered a controversial result itself.

Mir-146a, indeed, is responsible for immune system regulation and, in particular, seems to interact with TRAF6 and IRAK1 to turn off the response triggered by various microbial components and pro-inflammatory mediators (8). mir-146a level reduction by HCMV infection, in this case, represents a disadvantage for virus replication, because immune response negative modulation is not achieved. The reduction observed by Wang et al., could be caused, instead, by cell itself that, sensing viral replication, modulates negative mir-146a expression to respond effectively against virus infection.

The results of the present study demonstrated that mir-146a expression and HCMV viral load did not directly correlate. To our knowledge, this is the first article that directly correlates the HCMV viral load and mir-146a expression in vivo in renal transplant recipients. Wang et al., obtained different result on cell lines in vitro with different techniques. Actually, in the emergent field of interest such as miRNA regulation, there are several problems in comparing data. Wang et al., for example, used microarray and we used stem-loop retro transcription-PCR real time. Standardization and uniformities of the technique of molecular biology could resolve this problem.

Furthermore, it has been observed that another member of Herpesvirus family, the Epstein Barr Virus, acts in the opposite way, increasing mir-146a levels during infection (4). However, mir-146a detection approaches in literature are different, leading to possible differences that make comparison between methods not easy. Considering all this data and our results, it is uncertain the impact of HCMV infection on mir-146a expression levels and further studies are needed to explain this difference observed in vivo.

Footnotes

Acknowledgments

The authors thank the members of the Department of Public Health and Pediatrics and gratefully acknowledge the Director A. Cuffini.

Author Disclosure Statement

No competing financial interests exist.

References

Bergallo

, Gambarino

, Martino

, et al. Comparison of two available RNA extraction protocols for microRNA amplification in serum samples. J Clin Lab Anal, 2015; 71:278–282.

Dhuruvasan

, Sivasubramanian

, and Pellett

. Roles of host and viral microRNAs in human cytomegalovirus biology. Virus Res, 2011; 157:180–192.

Huang

, Chen

, He

, et al. Hcmv-miR-UL112 attenuates NK cell activity by inhibition type I interferon secretion. Immunol Lett, 2015; 163:151–156.

Mrázek

, Kreutmayer

, Grässer

, Polacek

, and Hüttenhofer

. subtractive hybridization identifies novel differentially expressed ncRNA species in EBV-infected human B cells. Nucleic Acids Res, 2007; 35:e73.

Santhakumar

, Forster

, Laqtom

, et al. Combined agonist–antagonist genome-wide functional screening identifies broadly active antiviral microRNAs. Proc Natl Acad Sci USA, 2010; 107:13830–13835.

Scherr

, and Eder

. Gene silencing by small regulatory RNAs in mammalian cells. Cell Cycle, 2007; 6:444–449.

Wang

, Weber

, Croce

, et al. Human cytomegalovirus infection alters the expression of cellular microRNA species that affect its replication. J Virol, 2008; 82:9065–9074.

Taganov

, Boldin

, Chang

, and Baltimore

. NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA, 2006; 103:12481–12486.