Induction of Profibrotic Microenvironment via TLR4 MyD88-Dependent and -Independent Inflammatory Signaling in Chronic Hepatitis C Virus Infection

Abstract

Hepatitis C virus (HCV) is a well-known pathogen to establish chronic infection leading to end-stage liver disease. The destruction of liver tissues takes its roots under chronic inflammation and proinflammatory signaling in liver microenvironment. The viral proteins interact with certain pattern recognition receptors, including Toll-like receptors, activating the innate immune system to clear the virus. HCV achieves immune evasion through other mechanisms and induce a continuous inflammatory microenvironment via Kupffer cells and Hepatic Stellate cells. This promotes disease progression. The current study aims to elucidate that the role of Toll-like receptor 4 (TLR4) induced innate immune response in chronic inflammation in patients chronically infected with HCV. For this purpose, changes in downstream signaling cascade of TLR4 during chronic HCV infection using peripheral blood mononuclear cells of chronic HCV patients were studied. We found significant increase in expression levels of proinflammatory and profibrotic genes induced by TLR4 Myeloid differentiation factor 88 (MyD88)-dependent pathway between treatment naive and healthy controls, while no significant difference between the expressions of genes involved in TLR4 signaling was found between treatment responders and healthy controls. Interestingly, both TLR4 MyD88-dependent and -independent pathways were found to be operational in nonresponders to interferon treatment. This further strengthens the involvement of innate immune signaling as a leading factor in HCV-mediated liver disease progression and the role of TLR4 MyD88-dependent and -independent pathway in ensuring the conditions for chronic inflammation.

Introduction

Hepatitis C virus (HCV), a notorious member of the family Flaviviridae, has been estimated to have infected about 3% population of the world with ∼4 million new infections arising each year (31). With the high rates of associated morbidity and mortality, it is the single most common indication for liver transplants (11) and costs billions of dollars annually exerting huge burden on public and private sector health care.

In Pakistan, an estimated of around 9.4 million people (about 5.4% of the population) are infected by HCV (3,20,25,24). The immune-based therapy for viral elimination is effective in about 50% cases of genotype 1, 4, 5, and 6 and about 80% cases of genotype 2 and 3 (43,46,48,54), but still viral relapse is very frequent (55,56) and the therapy itself has serious side effects that range from flu-like symptoms to thrombocytopenia and suicidal tendencies (7,12,27,33). An estimated 10–20% of the patients develop cirrhosis, while 1–5% patients may develop hepatocellular carcinoma at some point in their life (42,62).

First line defence against foreign invaders in our body is the innate system. Toll-like receptors (TLRs) is a group of evolutionarily conserved set of pattern recognition receptors found in a wide array of organisms (53) on innate immune cells. Up till now 11 TLRs have been recognized, functioning as initiators of inflammatory responses which triggers signaling pathways causing transcriptional activation and synthesis of proinflammatory cytokines and other proteins that promote host defense (8,29,30). These cytokines in turn activate inflammatory cascade, recruiting macrophages and neutrophils to the site of insult (13,64).

TLR4 or CD284 was the first human toll-like protein to be discovered (19,38), encoded by TLR4 gene, located on chromosome no 9. Different body tissues such as liver, peripheral blood leukocytes, and spleen express TLR4 receptors (35,37). Numerous pathogen-associated molecular patterns can act as ligand to activate TLR4 like gram-negative bacteria's lipopolysaccharides (LPS), taxol of plants, phosphorylcholine excreted by various Filarial nematode etc. (29,30). TLR4 can get stimulated by endogenous ligand like fibronectin, Tamm-Horsfall glycoprotein, and heparan sulfate of host as well (15,23,49). When ligand attaches to receptor, activation of TLRs leads to recruitment of immune cells like macrophages, NK cells, and other lymphocytes at the site of infection (9,49,65).

TLRs at their integrated side include a TIR domain which is Toll-IL-1 domain, conserved among all TLRs, which modulate TLR signaling. Proteins directly downwards of TLRs are TIR domain-containing adaptor-inducing IFN-β (TRIF), TRIF-related adaptor molecule (TRAM), Myeloid differentiation factor 88 (MyD88), MyD88 adaptor-like protein (MAL), all these also contain the same TIR domain motif, to interact with TLRs (44). TLR4 signaling occurs through two pathways: MyD88-dependent and TRIF-dependent pathways (1) (Fig. 1).

FIG. 1.

(a) MyD88-dependent signaling pathway: activation of transcription factors NF-κB and AP-1 through signaling cascade initiated by TLR4, (b) TRIF-dependent signaling pathway represented by TLR4. MyD88, Myeloid differentiation factor 88; TLR4, Toll-like receptor 4; TRIF, TIR domain-containing adaptor-inducing IFN-β.

Injured liver cells having higher level of mRNA of TLR4, CD14, MD2, and other adaptor proteins causes the initiation of inflammatory gush mediated by TLR4 in the insulted organ (15,34,36). However, overexpression of TLR4 also shows deadly consequences in injured organ. Ex vivo studies on cell lines also suggested that during HCV infection, the TLR3 and TR4 get activated in liver sinusoidal endothelial and Kupffer cells, activate IFN-inducible genes, which then leads to strong and effective repression of the viral replication (6,32,64).

TLR4 acts as a double edge sword in HCV infection; during acute phase of HCV infection, it significantly upregulates pathways involved in viral elimination, but it turns into a bad guy during chronic HCV infection. In chronic patients of HCV, a high expression of TLR4 and other proinflammatory cytokines is reported along with the higher number of T regs, which varies with HCV subtype and its viral count in the host (39,64). This elevated expression of TLR4 and other cytokines along with the infiltration of immune cells, causes the liver cell damage, and in some cases leads the cells toward transformation into cancerous cells thus leading to hepatocellular carcinoma (42,61). TLR4 has been notoriously pronounced one out of seven genes that shows higher threat of cirrhosis development in chronic HCV-infected patients (17,24,30).

TLR4 and its downstream targets can essentially be used as a potent therapeutic target to dampen HCV-associated liver cell damage in chronic HCV patients, especially in known interferon (IFN) therapy nonresponders. In developing countries, such as Pakistan, direct acting antivirals (DAAs) are being used in clinical practices to treat treatment naive patients, relapse cases due to viral reactivation of postsustained virological response (SVR), and previously known nonresponders to IFN and ribavirin standard therapy (26). Some of the poor treatment naive patients are also given the option of less expensive alternate to DAA; the standard IFN and ribavirin therapy, in case their medical is not covered by the government-based fund. Therefore, ribavirin and IFN therapy is still important and relevant in developing countries (20,21,47,66).

This study was designed to evaluate TLR4 signaling in innate immune response against HCV infection in patients who have undergone IFN and ribavirin therapy compared with treatment-naive and healthy controls and its role in induction of profibrotic microenvironment via proinflammatory signaling.

Materials and Methods

Clinical sample collection and ethical approval

Peripheral blood samples from HCV-infected patients with written informed consent were collected in 3 mL EDTA vacutainers from Armed Forces Institute of Pathology (AFIP), Rawalpindi, Pakistan, and transported to Atta-ur-Rahman School of Applied Biosciences (ASAB), National University of Sciences and Technology (NUST) Islamabad. Ethics Committee approval was obtained from both institutes. The ethical approval includes IRB approval for clinical sampling from AFIP and IRB to deal with samples from NUST.

The selection criteria for inclusion and exclusion were basis of patient's medical history. Patients with coinfection of hepatitis B virus, Epstein Bar Virus, cytomegalovirus and tuberculosis were excluded from the study. HCV-positive patients with any history of renal injury, hypertension or cardiac malfunctioning, hypo/hyperthyroidism, rheumatoid arthritis, asthma, and diabetes were also excluded from study to avoid any bias caused by inflammation response in metabolic or autoimmune disorders. Patients who were under DAA treatment were also excluded from the study, since the aim of the study was limited to study the TLR4 signaling in patients that were treated with IFN therapy in the past and were either nonresponders or relapse cases post-SVR for at least 6 months. This limited the included sample size to 30 HCV-infected cases only.

HCV-infected patients included in the study were divided into 3 subcategories, with 10 individuals in each subgroup category. The subcategories were devised on the status of IFN-α and ribavirin treatment. Treatment-naive patients were newly diagnosed with chronic HCV infection and had not received any antiviral treatment. Those who had previously received a standard IFN-α and ribavirin combinational treatment were regarded as responders and nonresponders based on active detectable viral infection after 24 weeks of treatment course.

Ten healthy blood donors were selected randomly from Armed Forces Institute of Transfusion (AFIT), Rawalpindi, who have undergone thorough screening for infections, as healthy controls for comparison. All samples were immediately processed within 2 h of collection. Baseline clinical information is summarized in Figure 2 and Table 1.

FIG. 2.

Whisker's plot, portraying age limit of study groups, with age at y-axis and categories at x-axis; central line showing the median while marginal lines showing the range limit.

Table 1.

Mean Age ± Standard Error of Mean and Median Age of Patients in Three Study Groups and Control Group

Sampling group	Age (mean ± SEM)	Median age	Gender (M/F)
Healthy controls (n = 10)	40.00 ± 2.70	41.00	5/5
Treatment naive (n = 10)	39.40 ± 2.90	37.00	6/4
Treatment responders (n = 10)	37.70 ± 2.65	37.00	7/3
Treatment nonresponders (n = 10)	39.40 ± 3.01	38.00	8/2

Isolation of peripheral blood mononuclear cells from clinical samples

Peripheral blood mononuclear cells of 10 control subjects and 30 HCV patients were isolated by density gradient centrifugation, using Ficoll-Histopaque (Histopaque^®-1077; Sigma-Aldrich), according to manufacturer's guideline. The pellets obtained were gently washed with phosphate-buffered saline and preceded for RNA extraction.

RNA extraction and complementary DNA synthesis

RNA extraction of total RNA via TRIzol^® Reagent (catalog number: 15596-026; Invitrogen, CA) was performed, according to manufacturer's instructions. Extracted RNA was treated with DNase I (catalog number: EN0521; Fermentas, ON, Canada) to circumvent any DNA contamination. Furthermore, RNA was quantified using Eppendorf BioPhotometer Plus (Eppendorf, NY) and was run on 1% agarose gel to confirm the integrity total extracted RNA.

The complementary DNA (cDNA) was then synthesized using RevertAid H minus Reverse Transcriptase (Fermentas) and Oligo-dT 18 primer, plus RiboLock™ RNase Inhibitor (Fermentas). Confirmation of synthesized cDNA was done using polymerase chain reaction (PCR) of housekeeping gene that is, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene.

Quantification of targeted genes

Complete coding sequences of targeted genes from NCBI gene bank were used to design primers by using Primer 3 software. Similarity index of each primer was analyzed individually both in BLAST and BLAT to avoid common occurring sequences of human genome and requested from the operon, commercially manufacturing distributors at HVD Biotech Vertriebs GmbH Wurzbachgasse 18 (Wurzbachgasse, Vienna, Austria) (Table 2 and Fig. 3).

FIG. 3.

Gel electrophotogram of 2% Agarose gel showing polymerase chain reaction amplification products of TLR4 (198-bp), TRIF (165-bp), TAK-1 (248-bp), NF-κB (198-bp), IL-28B (552-bp), IFN-B (152-bp), CASP 1 (245-bp), TGF-β (240-bp), and GAPDH (453-bp) (house-keeping gene) at annealing temperature of 60°C, (L = ladder 50 bp). GAPDH, glyceraldehyde 3-phosphate dehydrogenase

Table 2.

Primer Sequences and Their Product Sizes Used to Amplify Genes of Interests Both for Conventional and Quantitative Real-Time Polymerase Chain Reaction

Sr.	Genes	Primers sequences	Product sizes
1.	TLR4	Forward GGACCTGAGCTTTAATCCCCT	198
1.	TLR4	Reverse TAGTCCAGAAAAGGCTCCCAG	198
2.	TRIF	Forward CAGAAACCAGCACCAACTACC	165
2.	TRIF	Reverse CACGGCTTGGTATTTGGAGAG	165
3.	TAK-1	Forward CCTGTTTCCGATTTCAGCCC	248
3.	TAK-1	Reverse TGTAGACATGATCCCTCGCG	248
4.	NF-κB	Forward ACATTGCCTGGATGAAGTTTH	198
4.	NF-κB	Reverse CATCAATGCCTTCCCAGTAAA	198
5.	IL-28B	Forward CCCACTTCTGGAACAAATCGTCCC	552
5.	IL-28B	Reverse TCTCCTCCCCAAGTCAGGCAACC	552
6.	IFN-B	Forward ACCAACAAGTGTCTCCTCCA	152
6.	IFN-B	Reverse GCAGTATTCAAGCCTCCCATTC	152
7.	Caspase 1	Forward GCTTTGCTCCCTAGAAGAAGC	245
7.	Caspase 1	Reverse TCCAGCTCTGTAGTCATGTCC	245
8.	TGF-β	Forward TATCGACATGGAGCTGGTGA	240
8.	TGF-β	Reverse TGGGTTTCCACCATTAGCAC	240
9.	GAPDH	Forward ACCACAGTCCATGCCATCAC	453
9.	GAPDH	Reverse TCCACCACCCTGTTGCTGTA	453

The mRNA levels of TLR4, TRIF, TAK1, NF-κB, IL-28B, IFN-β, Caspase1, and TGF-β were determined by quantitative real-time PCR (qRT-PCR). Using Maxima^® SYBR Green/ROX qPCR Master Mix (2 × ) (catalog number: K0221; Fermentas), targeted genes were amplified on Applied Biosystems 7300 Real-Time PCR System. The reactions were preheated to 95°C for 10 min, then were run for 40 cycles at 95°C (denaturation) for 15 s and 60°C (annealing) for 60 s. Quantified expression of selected genes in chronic HCV samples of all categories in comparison with healthy controls was done using cDNA. Fold change in expression profile of genes was calculated by first normalizing, cycle threshold (Ct) values of selected genes by comparing with GAPDH (reference housekeeping gene). All experiments were performed in duplicates.

Statistical analysis

Statistical analysis was performed using GraphPad prism, version 6.0 (GraphPad Software, CA). Test applied was Student's unpaired t-test where p ≤ 0.05, p ≤ 0.005, and p ≤ 0.001 were considered statistically significant.

Results

Transcriptional analysis TLR4 and downstream targeted adaptor proteins in treatment naive compared to healthy controls

A significant increase of 1.3-fold (p < 0.05) was observed in the expression of TLR4 gene along with a significant increase of 2-fold (p < 0.01) in TAK-1 expression, while no significant change was observed in TRIF levels in treatment naive compared to healthy controls. Expression of NF-κB and its downstream anti-inflammatory cytokines during chronic HCV infection in treatment naive patient group was also compared to healthy controls. A significant increase of 1.8-fold (p < 0.05) was observed in the expression of NF-κB gene along with a significant increase of 1.4-fold (p < 0.05) in expression of IL-28B and a 1.8-fold (p < 0.01) increase in expression of TGF-β was observed in treatment-naive group, when compared to healthy controls. No statistically significant difference of expression of INF-β and caspase 1 was observed between the two groups (Fig. 4a).

FIG. 4.

Real-time quantitative expression in terms of fold change of desired genes, in peripheral blood mononuclear cells of chronic HCV patients (experimental) when compared with healthy individuals (controls). (a) Showing treatment-naive category, (b) treatment nonresponder category, and (c) treatment responder category. Significant expression of selected genes is shown. The data are shown as the mean ± standard error of the mean. Error bars represent the standard deviation between samples.

Transcriptional analysis TLR4 and downstream targeted adaptor proteins in treatment nonresponders compared to healthy controls

A significant increase of 2.3-fold (p < 0.001) was observed in the expression of TLR4 gene along with a significant increase of 2.2-fold (p < 0.01) in TAK-1 expression, while TRIF expression was increased by 2.5-folds (p < 0.01) in treatment nonresponders, when compared to healthy controls. A significant increase of 2.4-fold (p < 0.001) was observed in the expression of NF-κB gene along with a significant increase of 2-fold (p < 0.01) in expression of IL-28B. Moreover a significant increase of 1.7-fold (p < 0.05) in IFN-β and 1.8-fold (p < 0.05) of statistically significant increase in TGF-β expression was observed (Fig. 4b). Caspase 1 remained unchanged between treatment nonresponders and healthy controls.

Transcriptional analysis TLR4 and downstream targeted adaptor proteins in treatment responders compared to healthy controls

No significant change was found in any of the gene expressions of TLR4, TRIF, TAK 1, NF-κB, INF-β, TFG-β, IL-28B, and caspase 1, between the treatment responders and healthy controls (Fig. 4c). All values were expressed as ±SEM, p < 0.05 for experimental versus control by using unpaired Student's t-test.

Discussion

A significant role is played by Toll-like receptors in mounting innate and adaptive immune response against the attack of any foreign pathogen. Allele variations among the TLR genes have also been implicated in disease severity, disease prognosis, and treatment prognosis (14,18,37,41,56). According to many studies, the HCV proteins interact directly with the host proteins to perturb the signaling pathways (8,10,11,19,28,40).

Liver is an important organ of the body and can also be considered as a chief entity for the bacterial products residing in the gut system. An increase in pace of bacterial translocation has been reported in many cases, where different models of liver disorders were investigated. LPS is one of the expected candidates for TLR4-dependent fibrosis initiation. Moreover, many current researches have also reported that activation of TLR4 can be carried out by certain endogenous ligands, including HMGB1 and Hyaluronan as well (23).

One of the significant traits of HCV infection is impaired cellular signaling. This impaired signaling is known to cause steatosis, cirrhosis, and even hepatocellular carcinoma (HCC) in some extreme cases (4,10,17,52,59,63). Moreover, some of the proteins of HCV, for example, NS3 protease and the core protein, are known to hinder the downstream signaling proteins that are, Stat1, IRF-3, TRIF, TBK1, and Cardif, ultimately restraining IFN signaling (5,8,11,28,35,52,61).

According to many studies, an acceleration of liver disease in HCC occurs in presence of higher expression of TLR4. In addition, polymorphism in TLR4 gene and other TLRs has also been linked with the severity of the disease and treatment outcome (14,18,37,57). The interaction between viral protein NS5A with promoter region of TLR4 gene has also been established (52). Therefore, it is further suggested that LPS from the intestine and the NS5A protein, both interact with the promoter regions of TLR4, resulting in its upregulation of TLR4 signaling treatment-naive patients. Based on established role of TLR4, the study was designed to investigate the differential expression of TLR4 and adaptor proteins involved in chronic HCV infection.

Our results confirmed that MyD88-dependent pathway, and not TRIF, is upregulated in treatment-naive patients, when compared with healthy controls. MyD88-dependent TLR4 signaling pathway operates through Tak-1 complex, consisting of TAK1 and the adapter proteins TAB1 and TAB2 (60). TAK-1 expression was found to be elevated in both treatment-naive patients and treatment nonresponders, when compared to healthy controls, confirming the role of MyD88-dependent TLR4 signaling in chronically infected patients. This activation of TAK-1 by TLR4 can further lead to the activation of transcriptional factor NF-κB. In turn, NF-κB signaling alters the liver microenvironment to proinflammatory and profibrotic condition via upregulation of many inflammatory cytokines (both pro and anti) such as IL-6, IFN-α, IL-10, IL-28b, IL-29, etc., and TGF-β.

Viral proteins such as NS5A and NS3 are involved in upregulation of NF-κB via LPS-dependent mode of action and by augmenting ROS and ER stress, eventuating the peril for insulin resistance, carcinoma, and inflammation (8,13,28,36,45,52). We too observed statistically significant increase in NF-κB signaling, resulting in upregulation of downstream IL-28B as anti-inflammatory marker and TGF-β as profibrotic marker in treatment naive and treatment nonresponders, when compared with healthy controls.

MyD88-independent TLR4 signaling was observed in treatment nonresponder patients as the expression of TRIF was found to be elevated in comparison to healthy controls. However, no prominent change in mRNA expression level of TRIF was observed in treatment-naive patients. We can conclude that the INF-α in combination with ribavirin therapy somehow triggers the second downstream signaling pathway of TLR4 in treatment nonresponders. However, no significant difference in TLR4 signaling was observed in treatment responders, when compared with healthy controls, posttherapy. It is reported in literature and is a well-known fact that the activation of TRIF sparks two separate lineages of molecular events. The first one is late onset of NF-κB by RIP1 and TRAF6; while, the second lineage occurs via TRAF3, which then leads to the dimerization and thus activation of IRF3 (INF regulatory factor 3). IRF3 then moves inside the nucleus and act as transcription factor for INF-β (16,22). This was confirmed by the upregulation of INF-β in treatment nonresponders, in comparison to healthy controls.

The upregulation of TGF-β was observed in both treatment naive and treatment nonresponders with respect to healthy controls. The role of TGF-β induced collagen deposition in extracellular matrix is well established in the typical fibrotic liver (4,17,50). Although the primary source for TGF-β is considered to be Kupffer cells in paracrine signaling (52), it is also reported to be produced in autocrine manner by hepatic stellate cells. In hepatic stellate cells, upregulation of collagen I, II, and IV is established by TGF-β signaling. This upregulation leads to transdifferentiation of myofibroblasts in naive stellate cells (2,51). TLR4-dependent inflection of TGF-β signaling grants a link between proinflammatory and profibrogenic signals. It is previously reported that, in TLR4 knockout mice, the level of fibrogenesis was notably reduced. Moreover, mutant mice strains which have mutation in their CD14 or LPS gene also showed reduced hepatic fibrosis compared to their active counter parts (23).

Based on our study and known mechanism, we speculated that the upregulation of TLR4 signaling (MyD88 dependent and independent) might lead to downregulation of pseudoreceptor BAMBI of TGF-β via autocrine and paracrine signaling between hepatic stellate cells and Kupffer cells (19,58,64). Therefore, TLR4 activation and upregulation of NF-κB is responsible for liver tissue fibrosis during chronic infection of HCV in treatment naive and treatment nonresponders, but not in treatment responders.

Caspase 1expression analysis was included in the study, based on its stimulation by NLRP3 inflammasome in parasitic infections via TLR signaling. MyD88-dependent TLR signaling pathway upregulates NF-κB expression, which as a transcription factor, results in production of pro-IL-1B precursors and other inflammasome inducible structures. However, we found no significant difference in expression of caspase 1 in between the experimental groups and control group. Therefore, we were unable to confirm this mechanism of acute inflammation via TLR4 signaling in chronic HCV infection (8).

Conclusion

In current study, the activation of TLR4 pathway in chronically HCV-infected patients under combinational therapy (INF-α and ribavirin) and treatment naive was compared with healthy control. Upregulation of TLR4 expression was observed in treatment naive and treatment nonresponders, but not in treatment responders and healthy controls. Furthermore, an enhanced expression of profibrotic marker, such as TGF-β, along with upregulation of IFN-β and IL-28B genes in treatment nonresponders in comparison with healthy controls. It can be stated that during HCV infection, TLR4 plays a dual role, by upregulating expression of several anti-inflammatory genes like IL-28b to mount an antiviral response on one hand, but on the other hand, it also drives disease progression by inducing liver cell damage over the extended periods of time.

Further investigations into the role of highly expressed TLRs signaling cascades during HCV infections shall help us understand inflammation and disease progression. Moreover, relevant studies should be projected to evaluate the role of TLR4 signaling in disease risk stratification and prognosis in treatment-naive patients. Our study provides the foundation and proposes the use of TLR4 inhibitors in patients, who were previously resistant to INF-α and ribavirin combinational therapy and treatment-naive patients, along with DAAs, to reduce liver tissue damage.

Footnotes

Authors' Contributions

S.M. conceived the idea and designed the study. S.K. executed the experiments and did the analysis under guidance of S.M., M.A.M., and K.S. wrote the article. S.M. critically reviewed and revised the article. S.M. being principal investigator facilitated S.K. in smooth conductance of all experiments.

Ethical Approval

Ethical Approval for sampling was attained by Armed Forces Institute of Pathology (AFIP), Rawalpindi, Pakistan, and Armed Forces Institute of Transfusion (AFIT), Rawalpindi. The ethical approval for molecular work on clinical in BSL 2 facility was obtained from ASAB, NUST, Islamabad, Pakistan.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

No funding received from any source.

References

Akira

, and Takeda

, Toll-like receptor signalling. Nat Rev Immunol, 2004; 4:499–511.

Bachem

, Sell

, Melchior

, et al. Tumor necrosis factor alpha (TNFα) and transforming growth factor β1 (TGFβ1) stimulate fibronectin synthesis and the transdifferentiation of fat-storing cells in the rat liver into myofibroblasts. Virchows Archiv B, 1993; 63:123–130.

Basit

, Rahim

, Ahmad

, et al. Prevalence of hepatitis B and C infection in Pakistan. J Infect Mol Biol, 2014; 3:35–38.

Bissell

DM.

Hepatic fibrosis as wound repair: a progress report. J Gastroenterol, 1998; 33:295–302.

Breiman

, Grandvau

, Lin

, et al. Inhibition of RIG-I-dependent signalling to the interferon pathway during hepatitis C virus expression and restoration of signalling by IKKɛ. J Virol, 2005; 79:3969–3978.

Broering

, Wu

, Meng

, et al. Toll-like receptor-stimulated non-parenchymal liver cells can regulate hepatitis C virus replication. J Hepatol, 2008; 48:914–922.

Bukeirat

, and Bukeirat

. Hepatitis C (HCV) treatment is not a “one size fits all”. W V Med J, 2012; 108:20, 22–24.

Bureau

, Bernad

, Chaouche

, et al. Nonstructural 3 protein of hepatitis C virus triggers an oxidative burst in human monocytes via activation of NADPH oxidase. J Biol Chem, 2001; 276:23077–23083.

Carpenter

, and O'Neill

. How important are Toll-like receptors for antimicrobial responses?. Cell Microbiol, 2007; 9:1891–1901.

10.

Choi

, and Ou

JHJ

. Mechanisms of liver injury. III. Oxidative stress in the pathogenesis of hepatitis C virus. Am J Physiol Gastrointest Liver Physiol, 2006; 290:G847–G851.

11.

Chung

, Watanabe

, Kudo

, et al. Hepatitis C virus core protein induces homotolerance and cross-tolerance to Toll-like receptor ligands by activation of Toll-like receptor 2. J Infect Dis, 2010; 202:853–861.

12.

De Bruijne

, Sullivan

, Kieffer

, et al. Dynamic changes in HCV RNA levels and viral quasispecies in a patient with chronic hepatitis C after telaprevir-based treatment. J Clin Virol, 2011; 53:174–177.

13.

Dolganiuc

, Kodys

, Marshall

, et al. Type III interferons, IL-28 and IL-29, are increased in chronic HCV infection and induce myeloid dendritic cell-mediated FoxP3+ regulatory T cells. PLoS One, 2012; 7:e44915.

14.

El-Bendary

, Neamatallah

, Elalfy

, et al. The association of single nucleotide polymorphisms of Toll-like receptor 3, Toll-like receptor 7 and Toll-like receptor 8 genes with the susceptibility to HCV infection. Br J Biomed Sci, 2018; 75:175–181.

15.

Erridge

Endogenous ligands of TLR2 and TLR4: agonists or assistants?. J Leukoc Biol, 2010; 87:989–999.

16.

Foy

, Li

, Wang

, et al. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science, 2003; 300:1145–1148.

17.

Friedman

SL.

Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem, 2000; 275:2247–2250.

18.

Guo

, Loke

, Zheng

, et al. Functional linkage of cirrhosis-predictive single nucleotide polymorphisms of toll-like receptor 4 to hepatic stellate cell responses. Hepatology, 2009; 49:960–968.

19.

Guo

, and Friedman

. Toll-like receptor 4 signalling in liver injury and hepatic fibrogenesis. Fibrogenesis Tissue Rep, 2010; 3:21.

20.

Haqqi

, Munir

, Khalid

, et al. Prevalence of hepatitis C virus genotypes in Pakistan: current scenario and review of literature. Viral Immunol, 2019 Nov 1; 32:402–413.

21.

Hayashi

, Ishigami

, Yasuda

, et al. Occurrence of late relapse of hepatitis C virus confirmed by molecular analysis after sustained virologic response to interferon–ribavirin-based therapy. Hepatol Res, 2018 Feb; 48:E78–E86.

22.

Honda

, and Taniguchi

. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol, 2006; 6:644–658.

23.

Hoshino

, Takeuchi

, Kawai

, et al. Cutting edge: toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol, 1999; 162:3749–3752.

24.

Huang

, Shiffman

, Friedman

, et al. 7 gene signature identifies the risk of developing cirrhosis in patients with chronic hepatitis C. Hepatology, 2007; 46:97–306.

25.

Idrees

, Lal

, Naseem

, et al. High prevalence of hepatitis C virus infection in the largest province of Pakistan. J Dig Dis, 2008; 9:95–103.

26.

Idrees

, and Riazuddin

. A study of best positive predictors for sustained virologic response to interferon alpha plus ribavirin therapy in naive chronic hepatitis C patients. BMC Gastroenterol, 2009; 9:5.

27.

Idrees

, and Riazuddin

. Frequency distribution of hepatitis C virus genotypes in different geographical regions of Pakistan and their possible routes of transmission. BMC Infect Dis, 2008; 8:69.

28.

Karayiannis

The hepatitis C virus NS3/4A protease complex interferes with pathways of the innate immune response. J Hepatol, 2005; 43:743–745.

29.

Kawai

, and Akira

. TLR signalling. Cell Death Differ, 2006; 13:816–825.

30.

Kawai

, and Akira

. Toll-like receptor downstream signalling. Arthritis Res Ther, 2005; 7:12–19.

31.

King

, Adams

, and Lefkowitz

EJ.

Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. In: King

, Adams

, Lefkowitz

, Carstens

, eds. Elsevier, 2011. ISBN:0123846846,9780123846846.

32.

Kitazawa

, Tsujimoto

, Kawaratani

, et al. Expression of Toll-like receptor 4 in various organs in rats with d-galactosamine-induced acute hepatic failure. J Gastroenterol Hepatol, 2008; 23(8pt2):e494–e498.

33.

Kuniholm

, Xie

, Anastos

, et al. Association of chronic hepatitis C infection with T-cell phenotypes in HIV-negative and HIV-positive women. J Acquir Immune Defic Syndrome, 2015; 72:162–170.

34.

Kurt-Jones

, Popova

, Kwinn

, et al. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol, 2000; 1:398–401.

35.

Lin

, Choe

, Hiasa

, et al. Hepatitis C virus expression suppresses interferon signalling by degrading STAT1. Gastroenterology, 2005; 128:1034–1041.

36.

Machida

, Cheng

, Sung

VMH

, et al. Hepatitis C virus induces toll-like receptor 4 expression, leading to enhanced production of beta interferon and interleukin-6. J Virol, 2006; 80:866–874.

37.

Medhi

, Deka

, et al. Promoter region polymorphism & expression profile of toll like receptor-3 (TLR-3) gene in chronic hepatitis C virus (HCV) patients from India. Indian J Med Res, 2011; 134:200–207.

38.

Medzhitov

, Preston-Hurlburt

, and Janeway

. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature, 1997; 388:394–397.

39.

Morita

, and Imawari

. HCV-specific cytotoxic T lymphocyte and its epitope. Nihon Rinsho, 2004; 62 Suppl 7(Pt 1):155–158.

40.

Murphy

KM.

Janeway's Immunobiology. In: Walport

, Shlomchik

, eds. 8th ed. New York: Garland Science, 2012.

41.

Neamatallah

, El-Bendary

, Elalfy

, et al. Impact of toll-like receptors 2 (TLR2) and TLR 4 gene variations on HCV susceptibility, response to treatment and development of hepatocellular carcinoma in cirrhotic HCV patients. Immunol Invest, 2019:1–15.

42.

Nishikawa

, Nakajima

, Katagishi

, et al. Oxidative stress may enhance the malignant potential of human hepatocellular carcinoma by telomerase activation. Liver Int, 2009; 29:846–856.

43.

Núñez

, Marino

, Miralles

, et al. Baseline serum hepatitis C virus (HCV) RNA level and response at week 4 are the best predictors of relapse after treatment with pegylated interferon plus ribavirin in HIV/HCV-coinfected patients. J Acquir Immune Defic Syndr, 2007; 45:439–444.

44.

O'Neill

, and Bowie

. The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nat Rev Immunol, 2007; 7:353–364.

45.

Pamukcu

, Lip

, and Shantsila

. The nuclear factor-kappa B pathway in atherosclerosis: a potential therapeutic target for atherothrombotic vascular disease. Thromb Res, 2011; 128:117–123.

46.

Pariente

, Djilloul

, and Cadranel

. Treatment of chronic hepatitis C with interferon alpha and ribavirin. Results in “real life”. Gastroenterol Clin Biol, 2003; 27:590–595.

47.

Puoti

Antiviral treatment of HCV-related chronic hepatitis: is the cup half empty, or half full?. J Gastrointestin Liver Dis, 2007; 16:171–172.

48.

Qazi

, Saleem

, Mujtaba

, et al. Prevalence and factors associated with HCV (hepatitis C virus) seropositivity in Islamabad, Pakistan. Acta Med Iran, 2010; 48:394–398.

49.

Rassa

, Meyers

.L, Zhang

, et al. Murine retroviruses activate B cells via interaction with toll-like receptor 4. Proc Natl Acad Sci U S A, 2002; 99:2281–2286.

50.

Reed

, Stuver

, Tumilty

, et al. Predictors of treatment for hepatitis C virus (HCV) infection in drug users. Subst Abus, 2008; 29:5–15.

51.

Reeves

, and Friedman

. Activation of hepatic stellate cells-a key issue in liver fibrosis. Front Biosci, 2002; 7:808–826.

52.

Reyes

GR.

The nonstructural NS5A protein of hepatitis C virus: an expanding, multifunctional role in enhancing hepatitis C virus pathogenesis. J Biomed Sci, 2002; 9:187–197.

53.

Rock

, Hardiman

, Timans

, et al. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A, 1998; 95:588–593.

54.

Rodriguez-Torres

, Sulkowski

, Chung

, et al. Factors associated with rapid and early virologic response to peginterferon alfa-2a/ribavirin treatment in HCV genotype 1 patients representative of the general chronic hepatitis C population. J Viral Hepat, 2010; 17:139–147.

55.

Roux

, Fugon

, Winnock

, et al. Positive impact of hepatitis C virus (HCV) treatment on antiretroviral treatment adherence in human immunodeficiency virus-HCV coinfected patients: one more argument for expanded access to HCV treatment for injecting drug users. Addiction, 2012; 107:152–159.

56.

Sasase

, Kim

, Kudo

, et al. Outcome and early viral dynamics with viral mutation in PEG-IFN/RBV therapy for chronic hepatitis in patients with high viral loads of serum HCV RNA genotype 1b. Intervirology, 2010; 53:49–54.

57.

Schott

, Witt

, Neumann

, et al. Association of TLR7 single nucleotide polymorphisms with chronic HCV-infection and response to interferon-a-based therapy. J Viral Hepat, 2008; 15:71–78.

58.

Seki

, De Minicis

, Österreicher CH et al. TLR4 enhances TGF-β signalling and hepatic fibrosis. Nat Med, 2007; 13:1324–1332.

59.

Seronello

, Sheikh

, and Choi

. Redox regulation of hepatitis C in nonalcoholic and alcoholic liver. Free Radic Biol Med, 2007; 43:869–882.

60.

Shim

, Xiao

, Paschal AE et al. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signalling pathways in vivo. Genes Dev, 2005; 19:2668–2681.

61.

Spengler

, and Nattermann

. Immunopathogenesis in hepatitis C virus cirrhosis. Clin Sci (Lond), 2007; 112:141–155.

62.

Tanaka

, Moriya

, Kiyosawa

, et al. Hepatitis C virus core protein induces spontaneous and persistent activation of peroxisome proliferator-activated receptor alpha in transgenic mice: implications for HCV-associated hepatocarcinogenesis. Int J Cancer, 2008; 122:124–131.

63.

Tarao

, Rino

, Takemiya

, et al. Close association between high serum ALT and more rapid recurrence of hepatocellular carcinoma in hepatectomized patients with HCV-associated liver cirrhosis and hepatocellular carcinoma. Intervirology, 2000; 43:20–26.

64.

Wang

, Zhang

, Wei

, et al. Circulating Toll-like receptor (TLR) 2, TLR4, and regulatory T cells in patients with chronic hepatitis C. APMIS, 2010; 118:261–270.

65.

, Meng

, Jiang

, et al. Toll-like receptor-induced innate immune responses in non-parenchymal liver cells are cell type-specific. Immunology, 2010; 129:363–374.

66.

Zarębska-Michaluk

, Buczyńska

, Simon

, et al. Real world experience of chronic hepatitis C retreatment with genotype specific regimens in nonresponders to previous interferon-free therapy. Can J Gastroenterol Hepatol, 2019; 2019:4029541.