Genetic Polymorphism in Toll-Like Receptor 3 and Interferon Regulatory Factor 3 in Hepatitis C Virus-Infected Patients: Correlation with Liver Cirrhosis

Abstract

Host genetic factors could play a primary role in determining the risk for cirrhosis development in chronic hepatitis C virus (HCV)-infected patients. We designed this work to study the effect of single-nucleotide polymorphism (SNP) in Toll-like receptor 3 (TLR3) and interferon regulatory factor (IRF) on the risk of HCV-related cirrhosis. This study enrolled 139 Egyptian HCV-infected patients. They were divided into patients with cirrhotic (56) and noncirrhotic (83) liver. Genotyping of rs3775291 F459F (+1234C/T) and rs3775290 L412F (+1377C/T) in TLR3 and IRF3 rs2304204 (−925A/G) was performed by restriction fragment length polymorphism–polymerase chain reaction. Although there is no significant difference in genotype and allele distribution of +1377C/T of TLR3 gene between cirrhotic and noncirrhotic subjects, CC (odds ratio [OR] = 1.572, 95% confidence interval [CI]: 0.781–3.164); TT (OR = 1.463, 95% CI: 0.351–6.104) genotypes might be considered as risk factors for liver cirrhosis. On the contrary, the analysis revealed that only one genotype (CC) and one allele (C) were detected in +1234C/T SNP, with the total disappearance of CT/TT genotypes and T allele in all subjects. On the contrary, lower frequency has been found for the AG genotype of the IRF3 (−925A/G) gene in cirrhotic patients compared with noncirrhotic ones, indicating that AG is a protective genotype (OR = 0.509, 95% CI: 0.256–1.012). Our data stressed the association of AG genotype SNP in IRF3 (−925A/G) in protection against the worth outcome of HCV infection.

Introduction

Hepatitis C virus (HCV) infection constitutes a global public health burden. Its prevalence had an estimated 2.8% increase over the last decade, corresponding to more than 185 million infections. HCV infection is the major cause of acute hepatitis and chronic liver disease. Nearly 85% of all infected individuals develop chronic infection (El-Ghitany, 2019; Khatun and Ray, 2019; Ullah et al, 2020). Chronically infected individuals develop liver complications that include fibrosis and eventually cirrhosis, which can cause liver failure or the development of hepatocellular carcinoma (HCC) (Dash et al, 2020). Mechanisms responsible for liver damage associated with chronic HCV infection remain incompletely understood. However, increasing evidence points to immunological rather than direct viral effects (Kaspar and Sterling, 2017).

Innate immunity to HCV is triggered by the activation of cellular sensors that recognize the presence of pathogen-associated molecular patterns (Bruening et al, 2017). Pattern recognition receptors (PRRs) are expressed by various cells and are responsible for sensing the presence of microbial invasion. They are activated by RNA virus invasion. Membrane-bound Toll-like receptors (TLRs) are a family of conserved receptors that belong to PRRs (Heim, 2013). They have emerged as critical regulators of both innate and adaptive immune responses. TLRs are of substantial importance in initiating an antiviral response upon infection. Activation of immune cells through TLR agonists, which trigger interferon production, is being developed for therapy against HCV infection (Mifsud et al, 2014).

There are 10 TLRs expressed in different immune system organs (Akira et al, 2006). In particular, TLR3 is expressed intracellularly and thus recognizes dsRNA present in endosomal and/or extracellular compartments (Wang et al, 2009), produced during HCV replication. Upon dsRNA binding, TLR3 recruits several intracellular molecules leading to downstream activation of nuclear factor kappa-light-chain-enhancer of activated B cells and interferon regulatory factors (IRF) family members such as IRF3 and subsequent antiviral response (Wei et al, 2016). Moreover, IRF3 targets NS3/4A viral serine protease (Real et al, 2014).

TLR3 impacts the pathogenesis of several RNA virus infections, and its expression level is negatively associated with the severity of HCV infection (Kar et al, 2017). Meanwhile, IRF3 plays an essential role in the innate immune response to viral infection (Collins et al, 2004). It is closely related to interferon gene expression level and antiviral defense. IRF3 is differentially activated during type 1 IFN responses in macrophages and has a major role in gene expression of IFN regulatory factors (Jefferies, 2019; Yan et al, 2012). Polymorphisms in the TLR3 gene may cause changes in its expression, which affects the function and efficacy of signal transduction leading to an altered immune response (Said et al, 2018).

Moreover, polymorphisms in IRF3 can affect the induction of IFN-β1 expression (Yan et al, 2012). In the present study, we aimed to investigate the impact of genetic polymorphisms in rs3775291 F459F (+1234C/T) and rs3775290 L412F (+1377C/T) in TLR3 and IRF3 rs2304204 (−925A/G) on the susceptibility of Egyptians to develop liver cirrhosis due to HCV infection.

Patients and Methods

Patients

This work was achieved on 139 Egyptian HCV-infected patients from the outpatient clinic of the Hepatology Department, National Liver Institute (NLI), Menofia University, Egypt. The NLI-local Research Ethics Committee approved the study protocol. All investigations were performed according to NLI, Menofia University's ethical committee. All patients gave informed consent before enrolment. HCV patients were either newly admitted to the hospital or attending for follow-up. Patients with concomitant other causes of liver disease, such as alcohol abuse, autoimmune or metabolic disorders, coinfection with hepatitis B virus (HBV), or human immunodeficiency virus, were excluded. Liver cirrhosis was confirmed based on clinical, laboratory, and ultrasonography characteristics, and they were classified into 56 cirrhotic and 83 noncirrhotic. Viral detection and biochemical profile were performed as previously described (Talaat et al, 2022; Talaat et al, 2021).

Viral detection and biochemical profile

Anti-HCV testing was performed using the kit from Abon Biopharm, (Hangzhou, P.R. China) and confirmed by detection of HCV-RNA by quantitative real-time reverse transcription–polymerase chain reaction (PCR) using COBAS AmpliPrep/COBAS TaqMan HCV quantitative test version 2.0 (Roche Instrument Center AG, Switzerland). HCV-RNA was investigated in serum before treatment and routinely in weeks of treatment and after the last dose. All patients were subjected to entire history taking, complete clinical examination, and routine laboratory investigations, including complete blood count, creatinine, and alpha-fetoprotein. The liver functions, alanine aminotransferase (ALT), aspartate aminotransferase (AST), prothrombin (time and concentration), bilirubin (total and direct), and albumin were measured using test kits for Cobas 6000 (Roche Diagnostics GmbH, Germany).

DNA extraction

Blood was collected by withdrawing venous blood into sterile ethylenediaminetetra-acetic acid vacutainer tubes for DNA extraction and single-nucleotide polymorphisms (SNPs) analysis. According to the manufacturer's instructions, genomic DNA extraction from peripheral blood was carried out using a Wizard Genomic DNA Purification Kit (Promega, Madison). To confirm the presence and integrity of extracted DNA, 1% agarose gel electrophoresis was applied. The purity and quantity were assessed using Nanodrop 2000c (Thermo Scientific).

Genotyping of TLR3 and IRF3

Genotyping of TLR3 (+1377C/T and +1234C/T) and IRF3 (−925A/G) genes was performed using a PCR-based restriction fragment length polymorphism assay with specific primers (Li and Zheng, 2013; Özan et al, 2016). Primer sequences are presented in Table 1. All PCR reactions were performed in the Prime thermal cycler (Prime GmbH, Germany).

Table 1.

Primers Used to Detect Polymorphisms of Toll-Like Receptor 3 and Interferon Regulatory Factor 3 Genes in Hepatitis C Virus Patients

Gene	SNPs	Primers	PCR amplicon, bp	Enzyme	Product sizes, bp
TLR3	1377C/T (rs3775290)	Forward: 5′CCAGG CATAAAAAGCAATAT	337	TaqI	CC: 63 + 274
		Forward: 5′CCAGG CATAAAAAGCAATAT			CT: 337 + 274 + 63
		Reverse: 5′GGACCAAGGCAAAGGAGTTC3′			TT:337
TLR3	1234C/T (rs775291)	Forward: 5′d TCAGCTGCAGGTACTTGTTG 3	291	RsaI	CC: 113 + 178
		Forward: 5′d TCAGCTGCAGGTACTTGTTG 3			CT: 113 + 178 + 291
		Reverse: 5′ d TCACAGGATTGATAAACCTG 3′			TT:291
IRF3	−925A/G (rs2304204)	Forward: 5′CAATTTGCATGTGACGCTCCC 3′	294	PvuI	AA:146 + 148
		Reverse: 5′TCTTCCGCGTTACCTACGATG 3′			AG:146 + 148 + 294
		Reverse: 5′TCTTCCGCGTTACCTACGATG 3′			GG: 294

IRF3, interferon regulatory factor 3; PCR, polymerase chain reaction; SNP, single-nucleotide polymorphism; TLR3, Toll-like receptor 3.

PCR for TLR3 (1377C/T) was carried out in a total reaction volume of 25 μL contained MyTaq™ Red Master Mix (2 × ) (Maridin Life Science Company), with 10 pmol each of forward and reverse primers and 150 ng of DNA template. The mixture was amplified for one cycle of 95°C for 5 min, followed by 35 cycles for 45 sec at 95°C, 45 sec at 56°C and 30 sec at 72°C and finally 72°C for 7 min. PCR products of TLR3 (1377C/T) were further digested by restriction endonuclease TaqI then examined by 3% agarose gel electrophoresis. Bands of 274 and 63 bp corresponded to CC genotype, a single band of 337 bp for the TT genotype and 337, 274, and 63 bp bands corresponded to the CT genotype.

TLR3 (1234C/T) PCR was consisted of a total reaction volume of 25 μL contained MyTaq Red Master Mix (2 × ) (Meridian Life Science Company), with 10 pmol each of forward and reverse primers and 150 ng of DNA template. One cycle of 95°C for 5 min, followed by 30 cycles for 30 sec at 94°C, 40 sec at 62°C, and 45 sec at 72°C, and finally, 72°C for 10 min. RsaI digestion of PCR product resulted in two fragments of 123 bp for the CC genotype, three fragments of 113, 178, and 291 bp for CT genotype and a single fragment of 291 bp for TT genotype, which were run on 3% agarose gel electrophoresis.

PCR for IRF3 gene (−925A/G) was carried out of a total reaction volume of 25 μL contained MyTaq Red Master Mix (2 × ) (Meridian Life Science Company), with 10 pmol each of forward and reverse primers and 150 ng of DNA template. PCR reactions were performed under the following conditions: one cycle of 95°C for 2 min, followed by 37 cycles for 30 sec at 94°C, 30 sec at 62°C, 2 min at 72°C, and finally, 72°C for 7 min.

The amplified PCR product were further digested by PvuI and then examined by 4% agarose gel electrophoresis. Digestion by PvuI resulted two fragments of 146 and 148 bp for AA genotype, Three fragments of 145, 148, and 294 bp, for AG genotype and a single fragment of 294 bp for GG genotype. All PCR conditions are summarized in Table 2. Several samples from each position were sent for sequencing to ensure our results.

Table 2.

Polymerase Chain Reaction Condition for Toll-Like Receptor 3 (1234C/T), Toll-Like Receptor 3 (1377C/T), Interferon Regulatory Factor 3 (−925A/G) Single-Nucleotide Polymorphisms

SNPs	Step	Temp., °C	Time	Cycles
TLR3 1377C/T (rs3775290)	Preheating	95	5 min	1
	Denaturation	95	45 sec	35
	Annealing	56	45 sec
	Extension	72	30 sec
	Final extension	72	7 min	1
TLR3 1234C/T (rs775291)	Preheating	95	5 min	1
	Denaturation	94	30 sec	30
	Annealing	62	40 sec
	Extension	72	45 sec
	Final extension	72	10 min	1
IRF3 −925A/G (rs2304204)	Preheating	95	2 min	1
	Denaturation	94	30 sec	37
	Annealing	62	30 sec
	Extension	72	3 min
	Final extension	72	7 min	1

Statistical analyses

Statistical analyses were carried out by the statistical package for social science (SPSS) version 19 (IBM Corporation). Comparing cirrhotic and noncirrhotic individuals was made using an independent t-test, while pre- and posttreatment were made using paired t-test, and results were presented as mean ± standard error. A chi-square test compared the distribution of alleles and genotypes between different groups. Each polymorphism was examined to confirm that the distribution of the genotypes confirmed to Hardy-Weinberg equilibrium (HWE) (https://gene-calc.pl/hardy-weinberg). Polymorphism information content (PIC) was estimated (https://gene-calc.pl/pic). The odds ratio (OR) and 95% confidence intervals (CI) were calculated to evaluate the relative risks. The online tool SNPStats (https:/www.snpstats.net/start.htm) was used to perform haplotype analysis and linkage disequilibrium (LD) parameters (D′ and r ²). All values were two-tailed, and p < 0.05 was statistically significant. p Value was corrected for the number of variables (p corrected, pc) using Bonferroni correction.

Results

Patients' characteristics

One hundred thirty-nine patients were enrolled in the present study, with the cirrhotic group represented by 38 males and 18 females with a mean age of 53.3 ± 8.0. The noncirrhotic group was 44 males and 39 females with a mean age of 49.4 ± 10.9. The biochemical data of the study groups are displayed in Table 3. As previously mentioned by Talaat et al (2022, 2021), there was a significant difference in increase in HCV-RNA viral burden (p < 0.05), ALT (p < 0.001), AST (p < 0.05), hemoglobin (p < 0.05), and platelets (p < 0.05) between cirrhotic and noncirrhotic subjects.

Table 3.

Biochemical Characteristics of Cirrhotic and Noncirrhotic Hepatitis C Virus Patients

Parameters	Noncirrhotic (N = 83), M ± SD	Cirrhotic (N = 56), M ± SD	p
PCR, IU/mL	1352776.143 ± 1940614.313	4767982.643 ± 14774169.36	<0.05
ALT, IU/L	48.3 ± 37.2	80.2 ± 64.7	<0.001
AST, IU/L	47.8 ± 32.3	70.2 ± 49.3	<0.05
T.Bili., mg/dL	0.9 ± 0.78	0.77 ± 0.29	NS
D.Bili., mg/dL	0.62 ± 0.57	0.53 ± 0.28	NS
TLC, 10⁹/L	6.8 ± 2.3	6.51 ± 2.52	NS
HB, g/dL	13.1 ± 1.5	13.74 ± 1.46	<0.05
Platelet, 10⁹/L	198.6 ± 81.6	171.30 ± 61.20	<0.05
Creat, mg/dL	0.82 ± 0.15	0.86 ± 0.24	NS
Alb, g/dL	4.03 ± 0.06	3.95 ± 0.06	NS
AFP, IU/mL	11.89 ± 3.88	13.35 ± 6.85	NS

All data are presented as mean (M) ± SD.

AFP, alpha-fetoprotein tumor marker; Alb, serum albumin; ALT, alanine aminotransferase; AST, aspartate aminotransferase; Creat, serum creatinine; D.Bili., direct bilirubin; HB, hemoglobin; HCV, hepatitis C virus; NS, not significant; PCR, polymerase chain rection; SD, standard deviation; T. Bili., total bilirubin; TLC, total leucocyte cells.

Genotypes distribution in cirrhotic and noncirrhotic groups

The frequency of genotypes for TLR3 1377C/T did not deviate significantly from the HWE for genotypes CC, CT, and TT (47%, 32%, 4% [observed] vs. 47.82%, 30.36%, 4.82% [predicted] and 38%, 14%, 4% [observed] vs. 36.16%, 17.68%, 2.16% [predicted], for noncirrhotic and cirrhotic patients, respectively). The values predicted by assumption of HWE were different to those observed for IRF3 − 925A/G genotype GG, GA, AA (21, 54, 8 [observed] vs. 27.76%, 40.48%, 14.76% [predicted]; p < 0.01]) in noncirrhotic patients, while it was insignificantly changed in cirrhotic patients (18%, 28%, 10% [observed] vs. 18.29%, 24.43%, 10.29% [predicted]).

Genotyping of TLR3 + 1377C/T SNP showed that CC genotype and C allele are the most predominant genotype/allele in both studied groups. In contrast, TT genotype and T allele are the least frequent genotype/allele. Although no significant difference was reported in genotype and allele distribution of the TLR3 gene at the position +1377C/T between cirrhotic and noncirrhotic subjects (Table 4). CC (OR = 1.572, 95% CI: 0.781–3.164) and TT (OR = 1.463, 95% CI: 0.351–6.104) genotypes might be considered as risk factors for liver cirrhosis. On the contrary, analysis of +1234C/TSNP revealed that only one genotype (CC) and one allele (C) were seen. Neither CT/TT genotypes nor T alleles were present in all participants.

Table 4.

Genotype and Allele Frequencies of Toll-Like Receptor 3 (1377C/T and 1234C/T) and Interferon Regulatory Factor 3 (−925A/G) Gene Polymorphisms in Hepatitis C Virus-Cirrhotic and -Noncirrhotic Patients

Gene	Noncirrhotic group (N = 83)	Cirrhotic group (N = 56)	p/pc	OR (95% CI)
TLR3 1377C/T (rs3775290), N (%)
CC	47 (56.6)	38 (67.9)	NS	1.572 (0.781–3.164)
CT	32 (38.6)	14 (25.0)	NS	0.529 (0.254–1.101)
TT	4 (4.8)	4 (7.1)	NS	1.463 (0.351–6.104)
Allele frequency
C	126 (75.9)	90 (80.4)	NS	1.297 (0.722–2.33)
T	40 (24.1)	22 (19.6)	NS	0.770 (0.428–1.384)
TLR3 1234C/T (rs3775291), N (%)
CC	83 (100)	56 (100)	—	—
CT	—	—	—	—
TT	—	—	—	—
Allele frequency
C	83 (100)	56 (100)
A	—	—	—	—
IRF3 − 925A/G (rs2304204), N (%)
GG	21 (25.3)	18 (32.1)	NS	1.200 (0.559–2.578)
AG	54 (65.1)	28 (50.0)	p < 0.05/NS	0.509 (0.256–1.012)
AA	8 (9.6)	10 (17.9)	NS	2.194 (0.823–5.852)
Allele frequency
G	96 (57.8)	64 (57.1)	NS	0.977 (0.598–1.578)
A	70 (42.2)	48 (42.9)	NS	1.028 (0.633–1.670)

Bold numbers: Genotypes/alleles considered as risk factor for cirrhosis.

95% CI, 95% confidence interval; NS, not significant; OR, odds ratio; p/pc, p/p corrected value.

Regarding IRF3 (−925A/G) SNP, our results pointed to a reduction in the frequency of AG genotype in cirrhotic patients compared with noncirrhotic ones. AG is a protective genotype (OR = 0.509, 95% CI: 0.256–1.012). However, elevation in AA frequency in cirrhotic patients is statistically insignificant; it might be considered a risk factor for liver cirrhosis (OR = 2.194, 95% CI: 0.823–5.852).

Diversity analysis

To measure the informativeness of the identified SNPs, the PIC value was calculated for cirrhotic group. Based on the classification of PIC (PIC value <0.25, low polymorphism; PIC value >0.50, high polymorphism; 0.25 < PIC value <0.50, intermediate polymorphism) (Wang et al, 2016), the TLR3 1377C/T, and IRF3 − 925A/G SNPs had low (0.2659) and intermediate (0.3698) levels of genetic diversity, which indicated that IRF3 − 925A/G is more polymorphic loci than TLR3 1377C/T.

Haplotypes between noncirrhotic and cirrhotic groups

Haplotype assessment of TLR3 (+1377C/T) and IRF3 (−925A/G) was performed in the two studied groups and gave four haplotypes (GC, AC, GT, and AT) as presented in Table 5. GC is the predominant haplotype for 46.1% and 43.0% of total haplotypes in noncirrhotic and cirrhotic groups. The least frequent haplotype in the noncirrhotic group was AT, while the least frequent one in the noncirrhotic group is the GT haplotype. No statistically significant differences in haplotypes distribution were demonstrated. The LD pattern between TLR3 (+1377C/T) and IRF3 (−925A/G) is insignificant, with D′s value of 0.0246 and r ² value of −0.0113.

Table 5.

Haplotype Frequencies of Toll-Like Receptor 3 (1377C/T) and Interferon Regulatory Factor 3 (−925A/G) in Hepatitis C Virus-Noncirrhotic and -Cirrhotic Patients

Haplotype	Noncirrhotic (N = 83)	Cirrhotic (N = 56)	p	OR (95% CI)	LD
GC	46.11%	43.01%	—	1.00	D′: 0.0246
AC	29.79%	37.35%	NS	1.54 (0.74–3.21)	r ²: 0.0113
GT	11.72%	14.14%	NS	1.36 (0.57–3.24)	NS
AT	12.38%	5.51%	NS	0.46 (0.15–1.43)

Bold numbers: Genotypes/alleles considered as risk factor for cirrhosis.

LD, linkage disequilibrium.

Discussion

The human IRF3 gene located on chromosome 19ql3.3-ql3.4 has recently been acknowledged as a key element in regulating type I IFN during the antiviral defense. It is activated in infected cells upon recognizing dsRNA, which is considered the typical signature of virally infected cells (Geng et al, 2016; Santana-de Anda et al, 2014). A previous study reported that HCV could transiently trigger IRF3 activation during virus spread in chronic HCV (Lau et al, 2008). It has been demonstrated to play an essential role during HCV infection and clearance and the severity of liver diseases.

TLR3 SNPs are crucial to developing infection and inducing diseases (Al-Anazi et al, 2017). Genetic studies have described the importance of IRF3 polymorphisms. The present study investigated the relationship between genetic variants in TLR3 (+1234C/T and +1377C/T) and IRF3 (−925A/G) genes and the susceptibility to developing HCV-related liver damage that results in cirrhosis in the Egyptian population.

Our results revealed that noncirrhotic and cirrhotic groups had similar gene distribution at the +1377C/T polymorphic site. Hamdy et al (2018) performed a comparison study between 546 participants (409 health care workers and 137 patients) in the Egyptian population and found no difference in the distribution of TLR3 + 1377C/T between them. Similarly, another Egyptian study reported that the frequency of TLR3 + 1377C/T genotypes did not differ between 100 HCV patients and 100 healthy controls; however, the T-allele is significantly associated with the fibrosis stage (Zayed et al, 2017). In support of our results, El-Bendary et al (2018) found no association of TLR3 (+1377C/T) between negative controls and spontaneous viral clearance.

However, the C allele was significantly higher in spontaneous viral clearance than in chronic HCV infection, indicating that this SNP is associated with protection against the development of chronic HCV infection. Also, a former study by Askar et al (2009) failed to reveal any association of the TLR3 at the +1377C/T polymorphic site in Caucasian patients from Germany with chronic HCV.

Conflicting results were demonstrated in a cohort of Egyptian individuals; a significantly higher frequency between the homozygous CC and heterozygous CT genotypes of TLR3 (+1377C/T) and chronic HCV infection. These findings indicate that the CT genotype might be a risk factor while the CC genotype might protect against chronic HCV infection (Mosaad et al, 2018). Egyptian study that enrolled 546 subjects detected that the TLR3 (+1377C/T) CC genotype was more frequent among chronic HCV patients when compared to individuals with spontaneously resolved infection, and these data suggest that genetic variants in the TLR3 gene may play a role in disease progression (Hamdy et al, 2018). Moreover, TLR3 (+1377C/T) polymorphisms are associated with a risk for HBV-related liver diseases in a Chinese population (Huang et al, 2015).

In the present study, we examined the TLR3 (+1234C/T) SNP frequency in cirrhotic and noncirrhotic groups, only wild genotype/allele (CC/C) was detected with the total disappearance of CA or AA genotypes. In this regard, previous Egyptian study of TLR3 (+1234C/T) found no polymorphism link with HCV infection susceptibility (El-Bendary et al, 2018). In addition, Sá et al (2015) reported that TLR3 (+1234C/T) SNP was not associated with HCV infection risk. In contrast, a meta-analysis by Geng et al (2016) concluded that +1234C/T polymorphism of TLR3 is associated with susceptibility to HCV infection.

Citores et al (2016) result indicated that in persistent HCV infection, continuous TLR3 activation in immune cells from patients carrying the TLR3 Leu412Phe (+1234) CC wild-type genotype could favor an inflammatory milieu that sustains a more severe hepatic fibrosis than in carriers of the less functional T allele variant. A recent study by El-Sharawy et al (2020) provides evidence that TLR3 gene SNP +1234C/T could be a novel risk factor for HCV-related HCC among Egyptian women.

We also analyzed the IRF3 − 925A/G frequency in cirrhotic and noncirrhotic groups and revealed that the AG genotype is the most frequent genotype compared to GG and AA genotypes. Genotype frequency of IRF3 − 925A/G has been evaluated in the Chinese population infected with HBV, and no significant difference was found between cases and controls (Yan et al, 2012).

Following our results, Zhang et al (2004) demonstrated that SNPs in codon 427 of human IRF3 might be related to the susceptibility to esophageal cancer. Akahoshi et al (2008) report showed that genetic variants in −925A/G of IRF3 were associated with susceptibility to systemic lupus erythematosus (SLE). In contrast, a Chinese study indicated no associations between the genetic variants of −925A/G with the incidence and disease phenotype of Graves' disease, Hashimoto's thyroiditis, and autoimmune thyroid disease (Lin et al, 2019). A Spanish study showed that IRF3 − 925A/G polymorphism was not significantly associated with susceptibility to SLE (Sánchez et al, 2009).

In conclusion, our findings of this pilot study referred that the reduction in IRF3 A/G genotype of −925 in cirrhotic patients may suggest its role in limiting the progression of HCV to cirrhosis. In addition to the AA genotype of IRF3 − 925, both CC and TT genotypes of TLR3 1377 were considered the risk factor for liver cirrhosis in the Egyptians. More investigations have to be performed to understand better the role of IRF3 and TLR3 on the susceptibility of HCV-infected patients to develop liver cirrhosis. One of the study's limitations was that it only included cases from one province in Egypt, representing a small portion of the country. Larger scale primary studies involving interactions between genes and gene/environment are still needed to investigate further relationship between gene polymorphism and susceptibility to HCV-related liver cirrhosis.

Footnotes

Authors' Contributions

Study conception and design: R.M.T.: Clinical data collection and patient characterization: S.Z.E.-S.; Performing the experiments: S.S.E. and N.E.A.-H.; Performed the statistical analysis: R.M.T.; All authors discussed the results and contributed to the writing of the article.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

References

Akahoshi

, Nakashima

, Sadanaga

, et al. Promoter polymorphisms in the IRF3 gene confer protection against systemic lupus erythematosus. Lupus, 2008; 17(6):568–574; doi: 10.1177/0961203308089340.

Akira

, Uematsu

, Takeuchi

. Pathogen recognition and innate immunity. Cell, 2006; 124(4):783–801; doi: 10.1016/j.cell.2006.02.015.

Al-Anazi

, Matou-Nasri

, Abdo

, et al. Association of Toll-like receptor 3 single-nucleotide polymorphisms and hepatitis C virus infection. J Immunol Res, 2017; 2017:1590653; doi: 10.1155/2017/1590653.

Askar

, Bregadze

, Mertens

, Schweyer

, et al. TLR3 gene polymorphisms and liver disease manifestations in chronic hepatitis C. J Med Virol, 2009; 81(7):1204–1211; doi: 10.1002/jmv.21491.

Bruening

, Weigel

, Gerold

. The role of type III interferons in hepatitis C virus infection and therapy. J Immunol Res, 2017; 2017:7232361; doi:10.1155/2017/7232361.

Citores

, Perez-Pulgar

, Duca

, et al. Rapidity of fibrosis progression in liver transplant recipients with recurrent hepatitis C is influenced by toll-like receptor 3 polymorphism. Clin Transplant, 2016; 30(7):810–818; doi:10.1111/ctr.12754.

Collins

, Noyce

, Mossman

. Innate cellular response to virus particle entry requires IRF3 but not virus replication. J Virol, 2004; 78:1706–1717; doi: 10.1128/jvi.78.4.1706-1717.2004.

Dash

, Aydin

, Widmer

, et al. Hepatocellular carcinoma mechanisms associated with chronic HCV infection and the impact of direct-acting antiviral treatment. J Hepatocell Carcinoma, 2020; 7:45–76; doi: 10.2147/JHC.S221187.

El-Bendary

, Neamatallah

, Elalfy

, et al. The association of single nucleotide polymorphisms of Toll-like receptor 3, Toll-like receptor 7 and Toll-like receptor 8 genes with the susceptibility to HCV infection. Br J Biomed Sci, 2018; 75(4):175–181; doi: 10.1080/09674845.2018.1492186.

10.

El-Ghitany

. Hepatitis C virus infection in Egypt: Current situation and future perspective. JHIPH, 2019; 49(1):1–9; doi: 10.21608/JHIPH.2019.29460.

11.

El-Sharawy

, Negm

, Abd-Elsalam

, et al. Study of Toll-like receptor 3 gene polymorphism as a novel risk factor for HCV-related hepatocellular carcinoma in Egypt. Curr Cancer Drug Targets, 2020; 20(5):382–389; doi: 10.2174/1568009620666200319102929.

12.

Geng

, Song

, An

, et al. Toll-like receptor 3 is associated with the risk of HCV infection and HBV-related diseases. Medicine (Baltimore), 2016; 95(21):e2302; doi: 10.1097/MD.0000000000002302.

13.

Hamdy

, Osman

, Zakaria

, et al. Association of Toll-like receptor 3 and Toll-like receptor 9 single-nucleotide polymorphisms with hepatitis C virus persistence among Egyptians. Arch Virol, 2018; 163(9):2433–2442; doi: 10.1007/s00705-018-3893-8.

14.

Heim

. Innate immunity and HCV. J Hepatol, 2013; 58(3):564–574; doi: 10.1016/j.jhep.2012.10.005.

15.

Huang

, Li

, Wang

, Huang

, et al. Genetic polymorphisms in Toll-like receptor 3 gene are associated with the risk of hepatitis B virus-related liver diseases in a Chinese population. Gene, 2015; 569(2):218–224; doi: 10.1016/j.gene.2015.05.054.

16.

Jefferies

. Regulating IRFs in IFN driven disease. Front Immunol, 2019; 10:325; doi: 10.3389/fimmu.2019.00325.

17.

Kar

, Kumar

, Gumma

, et al. Downregulation of TRIF, TLR3, and MAVS in HCV-infected liver correlates with the outcome of infection. J Med Virol, 2017; 89(12):2165–2172; doi: 10.1002/jmv.24849.

18.

Kaspar

, Sterling

. Mechanisms of liver disease in patients infected with HIV. BMJ Open Gastroenterol, 2017; 4(1):e000166; doi: 10.1136/bmjgast-2017-000166.

19.

Khatun

, Ray

. Mechanisms underlying hepatitis C virus-associated hepatic fibrosis. Cells, 2019; 8(10):1249; doi: 10.3390/cells8101249.

20.

Lau

, Fish

, Sinha

, et al. Interferon regulatory factor-3 activation, hepatic interferon-stimulated gene expression, and immune cell infiltration in hepatitis C virus patients. Hepatology, 2008; 47(3):799–809; doi: 10.1002/hep.22076.

21.

, Zheng

. Toll-like receptor 3 genetic variants and susceptibility to hepatocellular carcinoma and HBV-related hepatocellular carcinoma. Tumor Biol, 2013; 34:1589–1594; doi: 10.1007/s13277-013-0689-z.

22.

Lin

, Yang

, Wang

, et al. Associations of gene polymorphisms in interferon-alpha signature-related genes with autoimmune thyroid diseases. Clin Endocrinol (Oxf), 2019; 91(6):860–868; doi: 10.1111/cen.14090.

23.

Mifsud

, Tan

ACL

, Jackson

. TLR agonists as modulators of the innate immune response and their potential as agents against infectious disease. Front Immunol, 2014; 3(5):79; doi: 10.3389/fimmu.2014.00079.

24.

Mosaad

, Metwally

, Farag

, et al. Association between Toll-like receptor 3 (TLR3) rs3775290, TLR7 rs179008, TLR9 rs352140 and chronic HCV. Immunol Invest, 2018; 48(3); 321–332; doi: 10.1080/08820139.2018.1527851.

25.

Özan

, Ocak

, Özan

, et al. Association of Toll-like receptors 2, 3, and 4 genes polymorphisms with periapical pathosis risk. Med Oral Patol Oral Cir Bucal, 2016; 21(4):408–412; doi: 10.4317/medoral.21081.

26.

Real

, Caruz

, Rivero-Juarez

, et al. A polymorphism linked to RRAS, SCAF1, IRF3 and BCL2L12 genes is associated with cirrhosis in hepatitis C virus carriers. Liver Int, 2014; 34:558–566; doi: 10.1111/liv.12330.

27.

Sá

, Pires-Neto

, Santana

, et al. Toll-like receptor 3 gene polymorphisms are not associated with the risk of hepatitis B and hepatitis C virus infection. Rev Soc Bras Med Trop, 2015; 48(2):136–142; doi: 10.1590/0037-8682-0008-2015.

28.

Said

, Tremblay

, Al-Balushi

, et al. Viruses seen by our cells: The role of viral RNA sensors. J Immunol Res, 2018; 2018:9480497; doi: 10.1155/2018/9480497.

29.

Sánchez

, González-Gay

, Callejas-Rubio

, et al. No evidence for genetic association of interferon regulatory factor 3 in systemic lupus erythematosus. Lupus, 2009; 18(3):230–234; doi: 10.1177/0961203308096256.

30.

Santana-de Anda

, Gómez-Martín

, Monsivais-Urenda

, et al. Interferon regulatory factor 3 as key element of the interferon signature in plasmacytoid dendritic cells from systemic lupus erythematosus patients: Novel genetic associations in the Mexican mestizo population. Clin Exp Immunol, 2014; 178(3):428–437; doi: 10.1111/cei.12429.

31.

Talaat

, Elsharnoby

, Abdelkhalek

, et al. The impact of interferon-γ (IFN-γ) and IFN-γ-inducible protein 10 (IP-10) genes' polymorphism on risk of hepatitis C virus–related liver cirrhosis. Immunol Invest, 2022; 51(3):688–704; doi: 10.1080/08820139.2020.1869251.

32.

Talaat

, Noweir

, Elmaghraby

, et al. TNF-related apoptosis-inducing ligand (TRAIL), death receptor (DR4) and Fas gene polymorphisms associated with liver cirrhosis in hepatitis C infected patients. Gene Rep, 2021; 2021(22):2452-0144; doi: 10.1016/j.genrep.2021.101018.

33.

Ullah

, Ullah

, Khan

, et al. Immunoassay technique for diagnosis of hepatitis B and C virus among drivers and conductors of long route heavy vehicles. Am J Life Sci, 2020; 3(1):9–16; doi: 10.34091/AJLS.3.1.2.

34.

Wang

, Liang

, Devaraj

, et al. Toll-like receptor 3 mediates the establishment of an antiviral state against hepatitis C virus in hepatoma cells. J Virol, 2009; 83(19):9824–9834; doi: 10.1128/JVI.01125-09.

35.

Wang

, Elzo

, Yan

, et al. A single nucleotide polymorphism in CAST gene is associated with meat quality traits in rabbits. Anim Sci Pap Reports, 2016; 34(3):269–278.

36.

Wei

, Li

, Zeng

, et al. The molecular chaperone GRP78 contributes to Toll-like receptor 3-mediated innate immune response to hepatitis C virus in hepatocytes. J Biol Chem, 2016; 291(23):12294–12309; doi: 10.1074/jbc.M115.711598.

37.

Yan

, Gao

Y-F

, Lv

, et al. No association between IRF3 polymorphism and susceptibility to hepatitis B virus infection in Chinese patients. World J Gastroenterol, 2012; 18(4):388–392; doi: 10.3748/wjg.v18.i4.388.

38.

Zayed

, Omran

, Mokhtar

, et al. Association of toll-like receptor 3 and toll-like receptor 9 single nucleotide polymorphisms with hepatitis C virus infection and hepatic fibrosis in Egyptian patients. Am J Trop Med Hyg, 2017; 96(3):720–726; doi: 10.4269/ajtmh.16-0644.

39.

Zhang

, Cao

, Lu

, et al. Relationship between polymorphism of IRF-3 gene codon 427 and esophageal cancer in Anyang population of China [in Chinese]. Beijing Da Xue Xue Bao, 2004; 36(4):345–347. PMID: 15303122.