Effects of Goose Astrovirus Type 2 Infection on Peripheral Blood Lymphocyte and Macrophage Activity In Vitro

Abstract

Goose astrovirus type 2 (GAstV-2) is a novel pathogen causing visceral gout in goslings; it not only causes necrosis of renal epithelial cells but also causes spleen damage, indicating that GAstV-2 induces immunosuppression in goslings. However, to date, the interaction between GAstV-2 and immune cells remains unclear. In this study, peripheral blood lymphocytes and macrophages were isolated from goslings without GAstV-2 infection and then inoculated in vitro with GAstV-2, and the virus localization in the lymphocytes and macrophages, proliferation and apoptosis of lymphocytes, and phagocytic activity, reactive oxygen species (ROS) and nitric oxide (NO) production, and cell polarity in macrophages were determined. The results showed that GAstV-2 was observed in the cytoplasm of CD4 and CD8 T cells and macrophages, indicating that GAstV-2 can infect both lymphocytes and macrophages. GAstV-2 infection reduced the lymphocyte proliferation induced by Concanavalin A and lipopolysaccharide stimulation and increased the lymphocyte apoptosis rate and mRNA expression of Fas, demonstrating that GAstV-2 causes damage to lymphocytes. Moreover, GAstV-2 infection enhanced phagocytic activity and production of ROS and NO and induced a proinflammatory phenotype in macrophages (M1 macrophages), indicating that macrophages play an antiviral role during GAstV-2 infection. In conclusion, these results demonstrate that GAstV-2 infection causes damages to lymphocytes, and host macrophages inhibit GAstV-2 invasion during infection.

Introduction

Goose astrovirus (GAstV) is a small, nonenveloped, and single-stranded RNA virus. On the basis of differences in gene sequences, GAstV strains are divided into two genotypes: GAstV-1 and GAstV-2 (Wan et al., 2018). At present, most isolated GAstV strains such as AHCZ2, GD, SDPY, and JSAH strains belong to the GAstV-2 genotype, and only three GAstV-1 strains have been reported: FLX, AHDY, and TZ03 (Wang et al., 2022b). Our previous study showed that 74.3% of 70 clinical samples were positive for GAstV-2 (Yi et al., 2022), indicating that GAstV-2 is the main genotype causing visceral gout in goslings.

GAstV-2 infection mainly causes visceral gout in 3–15-day-old goslings and results in 2–20% mortality, which poses a significant economic loss to goose flocks (Wei et al., 2020; Zhang et al., 2018b). High viral load is observed in the kidney, liver, and spleen of goslings infected with GAstV-2, and histopathological examination shows that GAstV-2 infection causes not only necrosis of renal epithelial cells but also lymphocyte depletion and apoptosis in the spleen (Ding et al., 2021; Huang et al., 2021; Yang et al., 2018; Zhang et al., 2018a). The spleen lesions suggest that GAstV-2 leads to immunosuppression in goslings. However, at present, the interaction between GAstV-2 and immune cells remains unclear.

Lymphocytes and macrophages are two most important types of immune cells, which play a vital role in the responses against viruses during the infection. Lymphocytes can combat the viruses through T cell-mediated immunity and B cell-mediated humoral immunity, and macrophages can engulf and eliminate the viruses and deliver the antigen to the T helper cells (Whitmire, 2011; Wykes and Lewin, 2018). However, some viruses such as Marek's disease virus, chicken infectious anemia virus, avian leukemia, and infectious bursal disease virus may affect the development and function of lymphocytes and macrophages and cause damages to these immune cells including necrosis, apoptosis, and proliferation inhibition (Gimeno and Schat, 2018; Wang et al., 2022a; Yang et al., 2022). Hence, there is a complex relationship between viruses and immune cells. Previous studies showed that GAstV-2 infection caused splenic lymphocyte apoptosis, and reduced CD8 T cells and MCH-I I mRNA expression in the spleen (Ding et al., 2021; Wang et al., 2021; Wu et al., 2021), but it is not clear whether the changes caused by GAstV-2 is a direct or indirect effect. Astroviruses also have been reported in macrophages in lambs and in cells around Peyer's patches in calves (Snodgrass et al., 1979; Woode et al., 1984). However, it remains unknown whether GAstV-2 affects the macrophages.

In addition, GAstV-2 is mainly transmitted through the fecal–oral route. Although the original cells of digest tract for GAstV-2 infection are unknown, a large number of viruses were found in the renal epithelial cells and hepatocytes (Cortez et al., 2017; Huang et al., 2021). Previous studies showed that GAstV-2 was detected in the serum in goslings infected with GAstV-2 (Yin et al., 2021). This leads us to speculate that GAstV-2 in the blood circulation may contribute to the virus movement to the kidney and liver tissues, and makes us interested in the interaction between GAstV-2 and immune cells (lymphocytes and macrophages).

Based on the above information, peripheral blood lymphocytes (PBLs) and monocyte-derived macrophages (MDMs) were separated and then infected with GAstV-2; the location of GAstV-2 in the PBLs and MDMs and the changes in lymphocyte and macrophage functions were evaluated in the study. The results showed that GAstV-2 infects PBLs and caused reduction of lymphocyte proliferation and apoptosis, whereas GAstV-2 infection increased phagocytic activity and reactive oxygen species (ROS) and nitric oxide (NO) production and skewed macrophage polarization to M1 in macrophages.

Materials and Methods

Ethics statements

Animal experiments were conducted in accordance with the Guidelines for Experimental Animals of the Ministry of Science and Technology (Beijing, China) and were approved by the institutional animal care and use committee (IACUC) of Nanjing Agricultural University (protocol code PTA2020013-2).

Virus

The GAstV-JSHA isolate (GenBank accession no. MK125058) belongs to the GAstV-2 and was isolated from the goose with visceral gout and kept in our laboratory, the titer of the virus was 1 × 10^4.25 TCID₅₀/mL as our previous studies (Wu et al., 2020).

Preparation of PBLs and MDMs

Blood was collected from the pterygoid vein of five 8-week-old goslings and heparinized (Yangzhou white goose). Polymerase chain reaction (PCR) was used to confirm that no GAstV-2 antigen was detected in the serum and kidneys and spleens collected from euthanized goslings. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque PLUS (Solarbio, Beijing, China) according to the manufacturer's instructions. In brief, the blood was diluted 1:1 with phosphate- buffered saline (PBS) and layered over lymphocyte separation medium in 50 mL tubes and centrifuged at 1000 g for 25 min at room temperature.

The buffy coat was then transferred to a clean 15 mL tube and washed thrice with PBS, followed by centrifugation at 400 g for 10 min. The viability of PBMCs was determined using the trypan blue exclusion assay as previously described (Strober, 2015). The PBMCs were suspended in RPMI 1640 medium supplemented with 10% fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 μg/mL) and incubated for 4 h at 37°C with 5% CO₂; then the nonadherent cells were collected and washed with PBS for three times that were used as PBLs. MDMs were obtained according to previous studies (Abdelsalam et al., 2020; Cornax et al., 2013; Zhao et al., 2021). In brief, the adherent cells were washed with PBS three times and detached by incubation for 5 min with trypsin digestion. Detached cells were washed twice in PBS to get rid of trypsin digestion. The isolated cells were cultured in complete RPMI 1640 for 5 days and used as MDMs. Then 5 × 10⁵/mL PBLs and 5 × 10⁵/mL MDMs were used for further experiments. Partially separated cells were used for experiments directly, while others were kept in −80°C.

Virus detection in CD4 and CD8 T cells by indirect immunofluorescence assay

PBLs were incubated with GAstV-2 at a multiplicity of infection (MOI) of 0.5 for 24 h and transferred to lysine-coated slides for 30 min adhesion. Then, the cells were fixed in 4% paraformaldehyde at 4°C for 10 min. After the cells were washed thrice with PBS, they were permeabilized with 0.3% Triton X-100 for 10 min and then sealed with 5% bovine serum albumin (Absin, Shanghai, China) for 30 min. For virus detection in CD4 T cells, the cells were incubated overnight with mouse anti-GAstV-2 capsid protein monoclonal antibody (gift from Prof. Zongyan Chen, Shanghai Veterinary Research Institute, China) and rabbit anti-CD4 polyclonal antibody (Beyotime, Shanghai, China).

For virus detection in CD8 T cells, the cells were incubated overnight with rabbit anti-GAstV-2 capsid protein polyclonal antibody and mouse anti-CD8 monoclonal antibody (gift from Prof. Bo Ma, Northeast Agricultural University, China). Then the cells were incubated with goat antimouse IgG-Alexa Fluor 488 (Beyotime, Shanghai, China) and goat antirabbit IgG-DyLight 488 (LiankeBio, Hangzhou, China) for 1 h. Then, the cells were washed thrice with PBS, incubated with 4′,6-diamidino-2-phenylindole (KeyGEN Biotech, Nanjing, China), and examined with a fluorescence microscope (Carl Zeiss, Gottingen, Germany).

Virus detection in macrophages by indirect immunofluorescence assay

Macrophages were incubated with GAstV-2 at an MOI of 0.5 for 24 h; using a protocol similar to that used for virus detection in CD4 and CD8 T cells, the macrophages were incubated with mouse anti-GAstV-2 capsid protein monoclonal antibody and goat antimouse IgG-Alexa Fluor 488 and then examined with a fluorescence microscope.

Assessment of apoptosis of PBLs

To examine PBL apoptosis caused by GAstV-2, PBLs were inoculated with GAstV-2 at an MOI of 0.5 for 12 h and then stained using the Annexin V-FITC Apoptosis Detection Kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. The stained cells were analyzed using flow cytometry (Beckman Coulter, CA, USA).

Assessment of proliferation of PBLs

PBLs were incubated with GAstV-2 at an MOI of 0.5 for 12 and 24 h and then treated with 20 μg/mL lipopolysaccharides (LPS) or 10 μg/mL Concanavalin A (ConA) for 24h, then cell proliferation was examined using the Cell Counting Kit-8 assay (Beyotime, Shanghai, China). The optical density of the lysates at 450 nm (OD₄₅₀) was determined using a microplate reader.

Assessment of phagocytic activity of MDMs

MDMs were seeded in 96-well plates and incubated with GAstV-2 at an MOI of 0.5 for 24 and 48 h. After washing twice with PBS, 20 μL neutral red staining solution was added to each well and incubated for 4 h at 37°C. Then, the cells were washed twice with PBS and treated with 200 μL neutral red cell lysis solution (Beyotime, Shanghai, China) each well for 10 min. The optical density of the lysates at 540 nm (OD₅₄₀) was determined using a microplate reader.

ROS assay of MDMs

The production of ROS in MDMs was examined using a Reactive Oxygen Species Assay Kit (Beyotime, Shanghai, China). MDMs cultured in all-black 96-well plates were incubated with GAstV-2 at an MOI of 0.5 at 37°C for 12 or 24 h. After the cells were washed twice with PBS, they were further incubated for 20 min with the DCFH-DA fluorescence probe diluted in serum-free medium (SFM) at 1:1000 (10 μM). Then, the plate was washed thrice with SFM, and the cells were stimulated with 5 μM phorbol 12-myristate 13-acetate (PMA) for 30 min. The fluorescence intensity of ROS was examined using a microplate reader at 488/525 nm, the fluorescence signal of ROS was detected by light microscopy.

Determination of NO in MDMs

The level of NO was measured using Griess reagent (Beyotime, Shanghai, China) according to the manufacturer's instructions. In brief, MDMs were incubated with GAstV-2 at an MOI of 0.5 for 12 or 24 h at 37°C and then stimulated with LPS at a final concentration of 20 μg/mL for another 24 h. The NaNO₂ standard was diluted with the medium to obtain concentrations of 0, 1, 2, 5, 10, 20, 40, 60, and 100 μM, respectively. Next, 50 μL of cell supernatant or NaNO₂ standard was added to 100 μL of Griess reagent in each well of a 96-well plate.

Chromophore absorbance was then measured at 540 nm using a microplate reader. A standard curve was drawn on the basis of the absorbance values of NaNO₂ standard; then NO concentration in the cell supernatants was estimated by comparison with the standard curve.

Quantitative real-time PCR analysis

Total RNA was extracted from both PBLs and MDMs using TRIzol (Vazyme Biotech Co., Ltd., Nanjing, China). The RNA samples were then reverse-transcribed into cDNA using the HiScript qRT SuperMix Kit (Vazyme, China). Primers for the target genes including apoptosis-related genes and macrophage polarity-related genes were designed using Primer 5.0 (Table 1). GADPH was used as the reference gene to standardize the relative expression of mRNA.

Table 1.

The Set of Primers Used in this Study

Accession number	Primers	Primer sequences (5′-3′)	Length
XM_013171650.1	Fas-F	CACTCCCACAAGTCAAG	163 bp
	Fas-R	AGTAGGGTTCCATAGGC	163 bp
EU375296.1	TNF-α-F	GAATGAACCCTCCTCCG	139 bp
	TNF-α-R	ATCTGGTTACAGGAAGG	139 bp
XM_013196440.1	TNF-R1-F	GCGTTTACGAGATGCCCAATA	146 bp
	TNF-R1-R	GGTTTAGCAAAGCCTCCTGAATA	146 bp
XM_013187929.1	TNF-R2-F	AAGAGGAACCGATAGCACAG	254 bp
	TNF-R2-R	CAGGTCGAGTTACTACGTCAGG	254 bp
XM_013174738.1	TRAIL-F	GCCGTCACCTTCCTCTACTTCA	141 bp
	TRAIL-R	TGCTCTGTCTTCGCTTTCAATT	141 bp
XM_013202112.1	TRAIL-R2-F	GCCGCACAGCGACCTCCTTT	186 bp
	TRAIL-R2-R	TGCACCACGTTGCCAGACTTTCT	186 bp
XM_013171877.1	cyt C-F	AAATGCTCCCAGTGCC	159 bp
	cyt C-R	CATCAGAGTATCCTCACCC	159 bp
XM_013187395.1	Bcl-2-F	TGACCGAGTACCTGAACCG	154 bp
	Bcl-2-R	GCTCCCACCAGAACCAAA	154 bp
KY788660	Bax-F	GGACGAGCTGGACAGCAACG	159 bp
	Bax-R	AGGCGGCAGGCGAAGTAGA	159 bp
MG674174.1	GAPDH-F	TCAAGGCTGAGAATGGGAAAC	191 bp
	GAPDH-R	GGCGGAGATGATGACACG	191 bp

Bax, Bcl-2-associated X; Bcl-2, B-cell lymphoma-2; cyt C, cytochrome c; Fas, fas cell surface death receptor; GADPH, glyceraldehyde-3-phosphate dehydrogenase; TNF-α, tumor necrosis factor-alpha; TNF-R, TNF receptor; TRAIL, TNF superfamily member 10; TRAIL-R2, TNF receptor superfamily member 10B.

Statistical analysis

A Student's t-test was performed to assess the differences between experimental and control group using the SPSS 16.0 software. Data are expressed as the mean ± standard deviation. p < 0.05 was considered statistically significant, however, p < 0.01 was considered very significant.

Results

Isolation of PBMCs, PBLs, and MDMs

After centrifugation of heparinized blood layered over the lymphocyte separation medium, four layers were obtained: plasma, PBMCs, isolated buffer, and red blood cells from top to bottom, respectively (Fig. 1A). PBMCs were extracted and examined using the Trypan blue exclusion assay (Fig. 1B); PBMCs with >95% cell viability were further used to obtain PBLs and MDMs. The PBLs were round and suspended cells that did not adhere to the cell culture dish, whereas MDMs were polygonal cells and adherent to the dish as shown in Figure 1C, D, respectively.

FIG. 1.

Isolation of PBMCs, PBLs, and MDMs. There were four layers in the separation solution after centrifugation, and the second layer from the top contained PBMCs (black arrow), (A). The viability of PBMCs was determined using trypan blue staining and microscopy (B). PBMCs were suspended in RPMI 1640 medium and incubated for 4 h, the nonadherent cells were collected and used as PBLs (C). The adherent cells were detached using trypsin digestion and then cultured in complete RPMI 1640 for 5 days and used as MDM (D). MDMs, monocyte-derived macrophages; RPMI, Roswell park memorial institute; PBLs, peripheral blood lymphocytes; PBMCs, peripheral blood mononuclear cells.

GAstV-2 infection on PBLs

GAstV-2 infection in PBLs was examined by indirect immunofluorescence assay (IFA). As shown in Figure 2A, CD4 T cells were labeled red, and GAstV-2 particles were marked green, positive colocalization with yellow signals was observed in PBLs infected with GAstV-2, whereas no positive signals were found in the control group, indicating that CD4 T cells can be infected by GAstV-2. Similarly, CD8 T cells were labeled green and GAstV-2 particles were marked red; in the merge image, positive colocalization with yellow signals was observed (Fig. 2B), demonstrating that CD8 T cells can also be infected by GAstV-2.

FIG. 2.

Detection of GAstV-2 in CD4 and CD8 lymphocytes using IFA. Cell nuclei are stained with DAPI (blue). CD4 T cells are labeled red, and GAstV-2 particles are marked green; positive colocalization with yellow signals was observed after merging (A). CD8 T cells are labeled as green, and GAstV-2 particles are marked red; positive colocalization with yellow signals was observed after merging (B). DAPI, 4′,6-diamidino-2-phenylindole; GAstV-2, goose astrovirus type 2; IFA, indirect immunofluorescence assay.

Effects of GAstV-2 infection on lymphocyte apoptosis

To evaluate the effect of GAstV-2 infection on PBL apoptosis, the cells were stained with Annexin V/PI, the extent of apoptosis was assessed using flow cytometry. As shown in Figure 3A, the ratio of apoptotic cells in GAstV-2-infected lymphocytes was significantly higher than that in the control group (p < 0.05). To further confirm the finding, the mRNA levels of apoptosis-related genes were analyzed using quantitative real-time polymerase chain reaction (qRCR). There were no significant differences in the mRNA expression of cyt C and the ratio of Bcl-2/Bax expression between the experimental groups and the control group (p > 0.05; Fig. 3B, C).

FIG. 3.

Detection of lymphocyte apoptosis and the mRNA levels of apoptosis-related genes after GAstV-2 infection. The extent of apoptosis in lymphocytes infected with GAstV-2 at 12 hpi was measured using flow cytometry (A). The mRNA expression of cyt C (B), BAX/BCL-2 (C), Fas (D), TNF-α (E), TNF-R1 (F), TNF-R2 (G), TRAIL (H), and TRAIL-R2 (I) in lymphocytes infected with GAstV-2 at 6, 12, 24, and 48 hpi. Values are expressed as mean ± SD, n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. hpi, hours postinfection; SD, standard deviation; TNF-α, tumor necrosis factor-alpha.

The mRNA expression levels of TNF-α, TRAIL, and TRAIL-R2 at 24 and 48 hours postinfection (hpi) and TNF-R1 at 24 hpi and TNF-R2 at 12 and 24 hpi were significantly lower than those in the control group (p < 0.05). However, Fas mRNA expression at 6, 12, 24, and 48 hpi was significantly higher than that in the control group (p < 0.05; Fig. 3D–I). These results indicated that GAstV-2 induced apoptosis in lymphocytes through a Fas-mediated signaling pathway.

Effects of GAstV-2 infection on T and B lymphocyte proliferation

T and B lymphocytes proliferation can be stimulated by ConA and LPS, respectively. To measure the effect of GAstV-2 on T and B lymphocyte proliferation, PBLs were incubated with GAstV-2 for 12 and 24 h and then stimulated with ConA and LPS for 24 h, respectively. As shown in Figure 4, lymphocyte proliferation was significantly lower in the infected group than in the control group after ConA or LPS stimulation at 12 and 24 hpi (p < 0.05), indicating that GAstV-2 inhibited T and B lymphocyte proliferation.

FIG. 4.

Effect of GAstV-2 infection on lymphocyte proliferation. PBLs were incubated with GAstV-2 for 12 and 24 h and then treated with ConA (A) or LPS (B) for 24 h. Cell proliferation was detected using CCK-8 assay. Values are expressed as mean ± SD, n = 3. **p < 0.01. CCK-8, cell counting kit-8; LPS, lipopolysaccharides; ConA, concanavalin A.

GAstV-2 infection on MDMs

GAstV-2 infection in MDMs was examined using IFA. After incubation of MDMs with GAstV-2 for 24 h, GAstV-2 particles labeled with green fluorescence were observed in the cell cytoplasm, whereas no green fluorescence was found in the noninfected group (Fig. 5), indicating that MDMs can be infected with GAstV-2.

FIG. 5.

Detection of GAstV-2 in MDMs using IFA. Cell nuclei are stained with DAPI (blue), and GAstV-2 antigen is stained green.

Effects of GAstV-2 infection on phagocytic activity of MDMs

A neutral red assay was used to estimate phagocytic ability of MDMs. As shown in Figure 6A, the OD₅₄₀ value was significantly higher in the infected group than in the control group at 12 and 24 hpi, indicating that the phagocytic ability of MDMs was enhanced by GAstV-2 infection.

FIG. 6.

Effect of GAstV-2 infection on the phagocytic activity and production of ROS and NO in MDMs. The MDMs were incubated with GAstV-2 for 24 and 48 h; neutral red staining solution was added to examine the phagocytic activity of MDMs (A). MDMs were inoculated with GAstV-2 for 12 and 24 h; the fluorescence intensity of ROS was examined using a microplate reader at 488/525 nm (B), and the fluorescence signals of ROS were detected using light microscopy using a ROS Assay Kit with or without PMA stimulation (C: 12 h; D: 24 h). NO was measured using Griess reagent; a standard curve was generated to calculate the NO levels (E). MDMs were inoculated with GAstV-2 for 12 and 24 h and then stimulated with LPS; NO concentration was measured and estimated by comparison with the standard curve (F). Values are expressed as mean ± SD, n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. NO, nitric oxide; PMA, phorbol 12-myristate 13-acetate; ROS, reactive oxygen species.

Effects of GAstV-2 infection on ROS production in MDMs

An ROS assay kit was used to measure the ROS activity. As shown in Figure 6B, the fluorescence intensity in the PMA-stimulation control and GAstV-2-infected macrophages was significantly higher than that in cells with no PMA stimulation (p < 0.05). Moreover, the fluorescence intensity in the GAstV-2-infected group was significantly higher than that in the control group with or without PMA stimulation at 12 and 24 hpi (p < 0.05). Similar results were obtained using fluorescence microscopy (Fig. 6C, D). These results demonstrate that GAstV-2 infection induces ROS production.

Effects of GAstV-2 infection on NO production in MDMs

NO was measured using Griess reagent, and the NO levels were calculated using a standard curve established on the basis of OD₅₄₀ values and NaNO₂ concentrations (Fig. 6E). The NO concentration in the LPS-stimulated control and GAstV-2-infected groups was significantly higher than that in groups with no LPS stimulation (p < 0.05). Moreover, the NO concentration in the GAstV-2-infected group was significantly higher than that in the control groups with or without LPS stimulation at 12 and 24 hpi (p < 0.05; Fig. 6F), indicating that GAstV-2 infection induces NO production.

Effects of GAstV-2 infection on macrophage polarity

M1 macrophage-related genes including inducible nitric oxide synthase (iNOS), interleukin (IL)-6 and CD86 and M2 macrophage-related genes including IL-10, PPARg, and Arg2 were determined by qPCR. The results showed that the mRNA expression levels of iNOS and IL-6 at 12 and 24 hpi and CD86 at 24 hpi in GAstV-2-infected groups were significantly higher than those in the control (p < 0.05; Fig. 7A–C), whereas the mRNA expression levels of IL-10 at 12 and 24 hpi and PPARg and Arg2 at 24 hpi in GAstV-2-infected groups were significantly lower than those in the control (p < 0.05; Fig. 7D–F). These results demonstrate that GAstV-2 infection skews macrophage polarization to M1 macrophages.

FIG. 7.

Changes of macrophage polarity-related genes after GAstV-2 infection using qPCR. The mRNA expression of iNOS (A), IL-6 (B), CD86 (C), IL-10 (D), PPARg (E), and Arg2 (F) in macrophages infected with GAstV-2 at 12 and 24 hpi. Values are expressed as mean ± SD, n = 3. *p < 0.05; **p < 0.01. IL, interleukin; iNOS, inducible nitric oxide synthase; qPCR, quantitative real-time polymerase chain reaction.

Discussion

T lymphocyte-mediated cellular immunity and B lymphocyte-mediated humoral immunity play an important role in the defense against viral infections. CD4 T lymphocytes affect antiviral cellular and humoral immunity (Wykes and Lewin, 2018), whereas CD8 T lymphocytes eliminate viruses by producing cytotoxic molecules. In this study, GAstV-2 was observed in the CD4 and CD8 T cells using IFA. To the best of our knowledge, this is the first study to report that GAstV-2 can infect lymphocytes.

In addition, GAstV-2 infection induced the apoptosis of lymphocytes and inhibited the proliferation of T and B lymphocytes induced by ConA and LPS. The decrease in lymphocyte function may cause immunosuppression in goslings. Our previous study showed that GAstV-2 infection in goslings induced spleen damage including splenic lymphocyte apoptosis, reticular fiber destruction, and CD8 T cell depletion (Ding et al., 2021). In addition, GAstV-2 infection in lymphocytes may facilitate the persistence of GAstV-2 infection in the body.

A previous study reported that hepatitis C virus infected CD4 and CD8 T lymphocytes and inhibit HCV clearance (Skardasi et al., 2018). Moreover, it has been reported that the initial infection site of GAstV-2 is the intestine (Cortez et al., 2017), whereas high viral load was found in the kidney and liver in GAstV-2-infected goslings. Therefore, it remains unclear how the virus transfers from the intestine to the kidney and liver. It is likely that GAstV-2 infection in lymphocytes helps the virus reach its target tissues, which needs to be further investigated.

Macrophages are key innate immune effectors against microbial infections (Morahan et al., 1985). Macrophages phagocytose and kill pathogenic microbes, present antigens to lymphocytes, and secrete various active factors (Mercer and Greber, 2013). In this study, GAstV-2 was detected in the cytoplasm of macrophages, indicating that macrophages can be infected by GAstV-2; however, whether GAstV-2 can replicate in macrophages needs further investigation. In addition, GAstV-2 infection enhanced macrophage phagocytic ability, demonstrating that macrophages are crucial in clearing the GAstV-2 during infection.

ROS are essential, potent microbicidal agents known to kill ingested microorganisms within phagosomes. It is reported that ROS production inhibits viral replication such as influenza virus, HSV, and dengue virus (Gonzalez-Dosal et al., 2011; Kim et al., 2013; Olagnier et al., 2014). NO is a signaling molecule produced by NO synthase and it is involved in a wide range of physiological processes including inflammatory response and antiviral activity (Lisi et al., 2021). NO directly inactivates viral particles or inhibits their replication and can directly regulate the host immune response, usually producing an inflammatory response to inhibit viral replication (Akaike and Maeda, 2000).

It is reported that turkey astrovirus type 2 induces NO production in macrophages, and NO donors inhibit astrovirus replication (Koci et al., 2004). NO is also reported to inhibit the replication of many other viruses, including Marek's disease virus and coronaviruses (Pieretti et al., 2021; Xing and Schat, 2000). In this study, GAstV-2 infection induced high ROS and NO production in macrophages, implying that the host resists GAstV-2 replication through these two substances.

Macrophages can be activated to divide into M1 and M2 phenotypes according to the microenvironment changes. Both M1 macrophages and M2 macrophages are involved in the modulation of inflammatory responses, among which M1 macrophages are capable of proinflammatory responses and M2 macrophages are capable of antiproinflammatory responses and repair damaged tissues. In addition, M1 macrophages have been shown to act as efficient antigen-presenting cells and have increased antiviral activity (Sang et al., 2015; Wang et al., 2022c). In the study, GAstV-2 infection increased iNOS, IL-6, and CD86 mRNA expression levels and decreased the IL-10, PPARg, and Arg2 mRNA levels, demonstrating that GAstV-2 infection skewed macrophage polarization to M1 macrophages, which may contribute to the virus defense.

In conclusion, GAstV-2 infects PBLs and causes lymphocyte damages, including reduction of lymphocyte proliferation and apoptosis, which may cause immunosuppression in goslings. Moreover, phagocytic activity, ROS and NO production, and proinflammatory phenotype in macrophages are increased during GAstV-2 infection, which enable the host to combat the viral invasion.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by a Grant (32372964) from the Natural Science Foundation of China, and by Prevention and Control Innovation Team of Jiangsu Modern Agriculture (waterfowl) Industry System [JATS (2022) 360].

References

Abdelsalam

, Rajput

, Elmowalid

, et al. The effect of bovine viral diarrhea virus (BVDV) strains and the corresponding infected-macrophages' supernatant on macrophage inflammatory function and lymphocyte apoptosis. Viruses, 2020; 12(7):701; doi: 10.3390/v12070701

Akaike

, Maeda

. Nitric oxide and virus infection. Immunology, 2000; 101(3):300–308; doi: 10.1046/j.1365-2567.2000.00142.x

Cornax

, Diel

, Rue

, et al. Newcastle disease virus fusion and haemagglutinin-neuraminidase proteins contribute to its macrophage host range. J Gen Virol, 2013; 94(Pt 6):1189–1194; doi: 10.1099/vir.0.048579-0

Cortez

, Meliopoulos

, Karlsson

, et al. Astrovirus biology and pathogenesis. Annu Rev Virol, 2017; 4(1):327–348; doi: 10.1146/annurev-virology-101416-041742

Ding

, Huang

, Wang

, et al. Goose nephritic astrovirus infection of goslings induces lymphocyte apoptosis, reticular fiber destruction, and CD8 T-cell depletion in spleen tissue. Viruses, 2021; 13(6):1108; doi: 10.3390/v13061108

Gimeno

, Schat

. Virus-Induced Immunosuppression in Chickens. Avian Dis, 2018; 62(3):272–285; doi: 10.1637/11841-041318-Review.1

Gonzalez-Dosal

, Horan

, Rahbek

, et al. HSV infection induces production of ROS, which potentiate signaling from pattern recognition receptors: Role for S-glutathionylation of TRAF3 and 6. PLOS Pathog, 2011; 7(9):e1002250; doi: 10.1371/journal.ppat.1002250

Huang

, Ding

, Chen

, et al. Goose nephritic astrovirus infection increases autophagy, destroys intercellular junctions in renal tubular epithelial cells, and damages podocytes in the kidneys of infected goslings. Vet Microbiol, 2021; 263:109244; doi: 10.1016/j.vetmic.2021.109244

Kim

, Kim

, Ryu

, et al. Reactive oxygen species induce antiviral innate immune response through IFN-lambda regulation in human nasal epithelial cells. Am J Respir Cell Mol Biol, 2013; 49(5):855–865; doi: 10.1165/rcmb.2013-0003OC

10.

Koci

, Kelley

, Larsen

, et al. Astrovirus-induced synthesis of nitric oxide contributes to virus control during infection. J Virol, 2004; 78(3):1564–1574; doi: 10.1128/jvi.78.3.1564-1574.2004

11.

Lisi

, Zelikin

, Chandrawati

. Nitric oxide to fight viral infections. Adv Sci (Weinh), 2021; 8(7):2003895; doi: 10.1002/advs.202003895

12.

Mercer

, Greber

. Virus interactions with endocytic pathways in macrophages and dendritic cells. Trends Microbiol, 2013; 21(8):380–388; doi: 10.1016/j.tim.2013.06.001

13.

Morahan

, Connor

, Leary

. Viruses and the versatile macrophage. Br Med Bullet, 1985; 41(1):15–21; doi: 10.1093/oxfordjournals.bmb.a072017

14.

Olagnier

, Peri

, Steel

, et al. Cellular oxidative stress response controls the antiviral and apoptotic programs in dengue virus-infected dendritic cells. PLOS Pathog, 2014; 10(12):e1004566; doi: 10.1371/journal.ppat.1004566

15.

Pieretti

, Rubilar

, Weller

, et al. Nitric oxide (NO) and nanoparticles—Potential small tools for the war against COVID-19 and other human coronavirus infections. Virus Res, 2021; 291:198202; doi: 10.1016/j.virusres.2020.198202

16.

Sang

, Miller

, Blecha

. Macrophage polarization in virus-host interactions. J Clin Cell Immunol, 2015; 6(2):311; doi: 10.4172/2155-9899.1000311

17.

Skardasi

, Chen

, Michalak

. Authentic patient-derived hepatitis C virus infects and productively replicates in primary CD4(+) and CD8(+) T lymphocytes in vitro . J Virol, 2018; 92(3):e01790–01717; doi: 10.1128/jvi.01790-17

18.

Snodgrass

, Angus

, Gray

, et al. Pathogenesis of diarrhoea caused by astrovirus infections in lambs. Arch Virol, 1979; 60(3–4):217–226; doi: 10.1007/bf01317493

19.

Strober

. Trypan blue exclusion test of cell viability. Curr Protoc Immunol, 2015;111:A3 B 1–A3 B 3; doi: 10.1002/0471142735.ima03bs111

20.

Wan

, Chen

, Cheng

, et al. A novel group of avian Avastrovirus in domestic geese, China. J Vet Med Sci, 2018; 80(5):798–801; doi: 10.1292/jvms.18-0013

21.

Wang

, Li

, Zheng

. Advances on innate immune evasion by avian immunosuppressive viruses. Front Immunol, 2022a;13:901913; doi: 10.3389/fimmu.2022.901913

22.

Wang

, Zhu

, Ye

, et al. Genomic and epidemiological characteristics provide insights into the phylogeographic spread of goose astrovirus in China. Transbound Emerg Dis, 2022b;69(5):e1865–e1876; doi: 10.1111/tbed.14522

23.

Wang

, Zheng

, Wang

, et al. Alveolar macrophages and airway hyperresponsiveness associated with respiratory syncytial virus infection. Front Immunol, 2022c;13:1012048; doi: 10.3389/fimmu.2022.1012048

24.

Wang

, Li

, Liu

, et al. Host innate immune responses of geese infected with goose origin nephrotic astrovirus. Microb Pathog, 2021; 152:104753; doi: 10.1016/j.micpath.2021.104753

25.

Wei

, Yang

, Wang

, et al. Isolation and characterization of a duck-origin goose astrovirus in China. Emerg Microbes Infect, 2020; 9(1):1046–1054; doi: 10.1080/22221751.2020.1765704

26.

Whitmire

. Induction and function of virus-specific CD4+ T cell responses. Virology, 2011; 411(2):216–228; doi: 10.1016/j.virol.2010.12.015

27.

Woode

, Pohlenz

, Gourley

, et al. Astrovirus and Breda virus infections of dome cell epithelium of bovine ileum. J Clin Microbiol, 1984; 19(5):623–630; doi: 10.1128/jcm.19.5.623-630.1984

28.

, Qiu

, Huang

, et al. Immune-related gene expression in the kidneys and spleens of goslings infected with goose nephritic astrovirus. Poult Sci, 2021; 100(4):100990; doi: 10.1016/j.psj.2021.01.013

29.

, Xu

, Lv

, et al. Goose astrovirus infection affects uric acid production and excretion in goslings. Poult Sci, 2020; 99(4):1967–1974; doi: 10.1016/j.psj.2019.11.064

30.

Wykes

, Lewin

. Immune checkpoint blockade in infectious diseases. Nat Rev Immunol, 2018; 18(2):91–104; doi: 10.1038/nri.2017.112

31.

Xing

, Schat

. Inhibitory effects of nitric oxide and gamma interferon on in vitro and in vivo replication of Marek's disease virus. J Virol, 2000; 74(8):3605–3612; doi: 10.1128/jvi.74.8.3605-3612.2000

32.

Yang

, Tian

, Tang

, et al. Isolation and genomic characterization of gosling gout caused by a novel goose astrovirus. Transbound Emerg Dis, 2018; 65(6):1689–1696; doi: 10.1111/tbed.12928

33.

Yang

, Yang

, Zhou

, et al. Interaction of p10/p27 with macrophage migration inhibitory factor promotes avian leukosis virus subgroup J infection. Vet Microbiol, 2022; 267:109389; doi: 10.1016/j.vetmic.2022.109389

34.

, Ding

, Cao

, et al. Development of a duplex TaqMan real-time RT-PCR assay for simultaneous detection of goose astrovirus genotypes 1 and 2. J Virol Methods, 2022; 306:114542; doi: 10.1016/j.jviromet.2022.114542

35.

Yin

, Tian

, Yang

, et al. Pathogenicity of novel goose-origin astrovirus causing gout in goslings. BMC Vet Res, 2021; 17(1):40; doi: 10.1186/s12917-020-02739-z

36.

Zhang

, Cao

, Wang

, et al. Isolation and characterization of an astrovirus causing fatal visceral gout in domestic goslings. Emerg Microbes Infect, 2018a;7(1):71; doi: 10.1038/s41426-018-0074-5

37.

Zhang

, Ren

, Li

, et al. An emerging novel goose astrovirus associated with gosling gout disease, China. Emerg Microbes Infect, 2018b;7(1):152; doi: 10.1038/s41426-018-0153-7

38.

Zhao

, Shi

, Han

, et al. Newcastle disease virus entry into chicken macrophages via a pH-dependent, dynamin and caveola-mediated endocytic pathway that requires Rab5. J Virol, 2021; 95(13):e0228820; doi: 10.1128/jvi.02288-20