A Multiplex Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification Assay for the Detection of Epstein–Barr Virus and Human Parvovirus B19 in Clinical Transplant Samples

Abstract

Viral infections are major causes of mortality in solid-organ and hematopoietic stem cell transplant recipients. Epstein–Barr virus (EBV) and Parvovirus B19 (B19V) are among the common viral infections after transplantation and were recommended for increased screening in relevant guidelines. Therefore, the development of rapid, specific, and cost-effective diagnostic methods for EBV and B19V is of paramount importance. We applied Fluorescence of Loop Primer Upon Self-Dequenching Loop-mediated Isothermal Amplification (FLOS-LAMP) for the first time to develop a novel multiplex assay for the detection of EBV and B19V; the fluorophore attached to the probe are self-quenched in unbound state. After binding to the dumbbell-shaped DNA target, the fluorophore is dequenched, resulting in fluorescence development. The novel multiplex FLOS-LAMP assay was optimized by testing various ratios of primer sets. This novel assay, with great specificity, did not cross-react with the common virus. For the detection of EBV and B19V, the limits of detection could reach 969 and 798 copies/μL, respectively, and the assay could be completed within 25 min. Applying this novel assay to detect 200 clinical transplant individuals indicated that the novel assay had high specificity and good sensitivity. We developed multiplex FLOS-LAMP assay for the detection of EBV and B19V, which has the potential to become an important tool for clinical transplant patient screening.

Introduction

Transplantation is an effective treatment for organ failure and prolongs patient survival (Zanella et al., 2020). However, prolonged use of immunosuppressants in transplant recipients leads to poor immune function and high susceptibility to opportunistic pathogens (Huang et al., 2022; Le et al., 2017). Epstein–Barr virus (EBV) and Parvovirus B19 (B19V) are currently associated with infection after transplantation (Lindsay et al., 2020; Simunov et al., 2022; Uhlin et al., 2014).

EBV, also known as human herpesvirus type 4, belongs to the Herpesviridae family and the Gamma-Herpesviridae subfamily. Primary infection manifests as infectious mononucleosis (Damania et al., 2022), but following clinical recovery, EBV persists in latent form, predominantly in B cells (Cohen, 2000). Epstein–Barr virus-associated post-transplant lymphoproliferative disorders (EBV-PTLD) are recognized as a significant cause of morbidity and mortality in patients undergoing allogeneic hematopoietic stem cell transplantation and solid organ transplantation (SOT) (Haider et al., 2020; Muffly et al., 2016).

Measurement of EBV-DNA is the method of choice for post-transplant early screening and monitoring, as well as assessing response to the treatment of EBV reactivation or EBV-PTLD (Kalra et al., 2018; Toner and Bollard, 2022). Earlier monitoring should be undertaken if there are several risk factors (Marjanska and Styczynski, 2023). B19V, a member of the large parvoviridae family and erythroparvovirus genus, is a small, nonenveloped, single-stranded DNA virus that infects only humans (Macri and Crane, 2023).

B19V is a viral threat after transplantation, which can persist and relapse frequently in individuals with compromised immune systems, one of the most serious common diseases in immunosuppressed allograft recipients is B19V-associated pure red cell aplasia, which can lead to graft damage (Mende and Sockel, 2018; Yu et al., 2021). Serology may not reliably establish the diagnosis in the transplant population due to the inability to produce a sufficient antibody response, and viral DNA should be detected in this population. Nucleic acid amplification tests (NAATs) have become an indispensable tool for the detection of viral DNA, and the use of polymerase chain reaction (PCR) assays has significantly increased the level of detection. However, these PCR-based methods often require expensive equipment and are time-consuming to perform, making it impossible to easily implement these techniques for on-site or rapid testing (Soroka et al., 2021).

Therefore, developing a rapid, simple, sensitive, and specific method for the detection of EBV and B19V is crucial and necessary to minimize the deleterious effects on the graft function. The loop-mediated isothermal amplification (LAMP) method is a novel nucleic acid amplification method developed in 2000, which is an attractive alternative to benchmark PCR (Notomi et al., 2000). The LAMP reaction is initiated by strand invasion of the DNA template by hairpin-forming LAMP primers, which extend catalyzed by a strand displacing DNA polymerase. These annealed LAMP primers are in turn displaced by displacement primers in the initiation of amplification, and lead to the formation of a dumbbell-like structure; this structure forms the basis of cycle amplification and elongation, amplified DNA can accumulate up to 10⁹ copies in 30 min under isothermal conditions (Li et al., 2023; Zeng et al., 2022; Zhang et al., 2023).

Despite the advantage in sensitivity and amplification speed, the traditional LAMP methods have some limitations: The measurement of LAMP products relies on endpoint analysis and requires post-amplification processing, including turbidity, agarose gel electrophoresis, colorimetric detection using naked eyes, and detection using ultraviolet light, which may lead to possible cross-contamination or detection of nonspecific LAMP amplicons, the published LAMP methods for detecting EBV and B19V are all such methods (Liu et al., 2013; Yamada et al., 2006); most traditional LAMP methods can only detect one target in a single reaction and few attempts have been made to develop a multiplex version of LAMP due to the difficulty of primer design.

To fulfill the needs of specific target detection and one-pot multiplex reaction, several probe-based LAMP assays have been developed (Zhang et al., 2023). The probe-based strategy proposed by more LAMPs is the fluorescence resonance energy transfer (FRET)-based approach: A dedicated quencher moiety, present in close proximity to the fluorophore, has to be physically displaced for the fluorophore to dequench (Tyagi and Kramer, 1996). Recently some researchers have utilized a non-FRET-based approach, in which the fluorophore is quenched/dequenched in the absence of a dedicated quencher, referred to as Fluorescence of Loop Primer Upon Self-Dequenching LAMP (FLOS-LAMP) (Gadkar et al., 2018; Hanyue et al., 2023; Li et al., 2022).

The FLOS-LAMP fluorophore attached to the Epstein–Barr virus (EBV)-FAM probe and Parvovirus B19 (B19V)-ROX are self-quenched in unbound state (Nazarenko et al., 2002a; Nazarenko et al., 2002b). After binding to the dumbbell-shaped DNA target, the fluorophore is dequenched, resulting in fluorescence development, and any non-dumbbell-shaped DNA structure structure(s), which is presumably formed in a typical LAMP reaction, is unable to offer a binding site to the probe (Fig. 1A, B). In this study, we applied this technique for the first time to develop a novel multiplex FLOS-LAMP assay for EBV and B19V detection. The novel multiplex FLOS-LAMP assay exhibited high specificity and sensitivity with the quantitative real-time PCR (qPCR) assay in the detection of 200 clinical transplant samples.

FIG. 1.

Principles of the FLOS-LAMP and optimization of the multiplex FLOS-LAMP primer set. (A) Schematic depiction of the binding of FLOS-LAMP probe to its target. The fluorophore attached to the FLOS-LAMP probe is self-quenched in unbound state. After binding to the dumbbell-shaped DNA target, the fluorophore is dequenched, resulting in fluorescence development. (B) Principle of self-quenching of fluorescent probes. A significant effect on fluorescence was demonstrated for oligonucleotide, an efficient electron donor. Blunt-end hairpin conformation emits the lowest fluorescent signal due to the proximity of oligonucleotide in the complementary strand upon hybridization. The signal increases when the primer is linear, and reaches its maximum when the primer is incorporated into the double-stranded DNA. (C) Locations and sequences of primers and probe in the EBV and B19V genome. (D) Optimization results and curves of the EBV and B19V multiplex FLOS-LAMP primer set and temperatures. Input template concentration EBV and B19V plasmid: 1 × 10⁵ copies/μL. B19V, Parvovirus B19; EBV, Epstein–Barr virus; FLOS-LAMP, Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification.

Materials and Methods

Study population

There is no direct patient and public involvement in this study. Between May 2023 to June 2023, 20 EBV-positive samples, 20 B19V-positive samples, and 160 negative samples were obtained from clinical transplant samples of the nephrology laboratory (Kidney Disease Center, The First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China). The samples were stored at minus 20°C until the time of examination. The study was conducted with the approval of the Ethics Committee of the First Affiliated Hospital Zhejiang University (Reference Number 2020-856), and all participants signed the informed consent for the study.

Primer design

Primer design is a key step in the development of multiplex LAMP assays (Gadkar et al., 2018; Nazarenko et al., 2002a; Rolando et al., 2020; Zhang et al., 2023). Specifically, LAMP primers set specific for EBV and B19V were designed using PrimerExplorer™ V4 (http://primerexplorer.jp/e/), based on the conserved regions of EBV-encoded nuclear antigen-1 (EBNA1) and the nonstructural protein (NS) gene sequences obtained from GenBank (www.ncbi.nlm.nih.gov). Sequences were aligned using ClustalX, and primer binding sites were chosen to ensure coverage of all sequences. Each gene consists of two inner primers (forward inner primer [FIP] and backward inner primer [BIP]), two outer primers (F3 and B3), and one FLOS-LAMP probe. The FIP was designed by a combination of the complementary sequence of F1 (F1c) and F2.

In addition, and similarly, the BIP was a combination of B1c and B2 as well (Fig. 1A–C). Respectively, two different fluorophores (FAM and ROX) were attached to the FLOS-LAMP probes, which are self-quenched in unbound state and become dequenched after binding to the dumbbell-shaped target DNA specifically. The FLOS-LAMP probes need to fulfill the conditions of the presence of oligonucleotide (thymine) at the 3′ end at the second or third position (Nazarenko et al., 2002a). All primers and probes used herein were synthesized and high-performance liquid chromatography (HPLC) purified by Sangon Biotech (Shanghai, China), hydrated to 100 μM with molecular grade water, and stored at minus 20°C. The target position of primers and probes was presented and depicted in the alignment, as illustrated in Table 1 and Figure 1C.

Table 1.

The Epstein–Barr Virus and Parvovirus B19 Multiplex Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification Assay Primer Sets Used in This Study

Target	Name	Sequence (5′-3′)
EBV	F3	TCCGGCGGCAGTGGAC
	B3	GCCCCTTTGCAGCCAAT
	FIP	TCCGCCTCCTCGTCCTCGTC CTCAAAGAAGAGGGGGGGAT
	BIP	TCCGGGCGGCTCAGGATCA CTTGGACGTTTTTGGGGTCT
	EBV probe	GCCAAGACATAGAGATGGTGT/i6FAMdT/C
B19V	F3	AATGCAGATGCCCTCCAC
	B3	AAAGCTGCTTTCACTGAGTTCGACACCAGTATCAGCAGCA
	FIP	TTAACCTCATCACCCCAGGCGTCTCCTGAACTGGTCCCG
	BIP	ACCCCAACTAACAGTTCACGAA
	B19V probe	CGCGCTCTAGTACGCCCAT/iROXdT/CC

T denotes the site for FAM/ROX attachment.

B19V, Parvovirus B19; BIP, backward inner primer; EBV, Epstein–Barr virus; FIP, forward inner primer.

Plasmid standard synthesis

Recombinant plasmids were constructed using the sequences of the EBV (GenBank: NC_007605.1) and B19V (GenBank: NC_000883.2). The PCR products were cloned into the pMDTM19-T common cloning vector (Takara, Dalian, China), and then transformed into Escherichia coli. Picked positive colonies were inoculated into a liquid medium and cultured overnight. After PCR and sequencing validation, plasmids were extracted and quantified by Sangon Biotech (Shanghai, China). Copy number (copies/μL) = plasmid concentration (ng/μL) × 6.02 × 10²³ × 10⁻⁹/total length of plasmid × 660.

The recombinant plasmids were used as standards for the novel multiplex FLOS-LAMP assay. Positive controls (10⁶ copies/well plasmids of EBV and B19V), negative controls (sterile water).

DNA extraction

DNA was extracted from the plasma samples with the MagaBio plus Blood Genomic DNA Purification Kit (Bioer Technology Inc., Hangzhou, Zhejiang, China) according to the manufacturer's instructions. All DNA samples were stored at minus 20°C.

Reaction system of the multiplex FLOS-LAMP assay

The novel multiplex FLOS-LAMP reaction was optimized by testing with a 25 μL reaction mixture containing 2.5 μL of 2 × 10 × Buffer (New England Biolab, UK), 4 mM of MgSO4 (New England Biolab), 4 U of DNA Bst 3.0 polymerase (New England Biolab), 1.4 mM of dNTPs (Yeasen, Shanghai), 0.24 μΜ each of F3 and B3, 1.2 μM FIP and BIP, 0.18 μΜ of EBV probe, and 0.24 μΜ of B19V probe, followed by 6 μL of template DNA. The LAMP assay was run on the real-time fluorimeter, the CFX96 Real-Time PCR detection instrument (Bio-Rad Laboratories, USA), at 63°C for 40 min. The instrument was programmed to acquire the fluorescence signal every 50 sec. Fluorescence signals were measured at the end of each cycle and a sigmoid-shaped fluorescence curve could be observed for successful amplification.

Specificity and sensitivity test

The specificity of the multiplex FLOS-LAMP assay was assessed using 8 common human viruses, including cytomegalovirus (CMV), herpes simplex virus 1/2 (HSV1/2), human herpesvirus type 8 (HHV-8), hepatitis B virus (HBV), hepatitis C virus (HCV), and hepatitis E virus (HEV). The sensitivity of the multiplex FLOS-LAMP assay was determined using 10-fold serial dilutions of DNA standard from 1.0 × 10² to 1.0 × 10⁶ copies/μL.

Limit of detection

The limit of detection (LOD) of the multiplex FLOS-LAMP assay was considered the lowest concentration level at which 95% of positive samples were detected. The nucleic acids of EBV and B19V, obtained from the nephrology laboratory, were used to determine the LOD of the multiplex FLOS-LAMP assay. To determine the LOD of the multiplex FLOS-LAMP assay, 25 μL reactions with serial dilutions of nucleic acids, 4,000, 1,000, 500, and 250 copies/μL, were performed. Each dilution was tested in 24 replicates. The LOD was defined as a 95% probability of obtaining a positive result using probit regression analysis with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA).

Reaction with a commercial EBV and B19V qPCR kit

Commercial EBV and B19V qPCR kits with a detection limit of 1 copy/μL (Shanghai ZJ Bio-Tech Co, Shanghai, China) were used to perform the reactions using the CFX96 Real-Time PCR Detection System according to the manufacturer's instructions. The thermal cycling protocol was 2 min at 94°C, followed by 40 cycles of 15 sec at 93°C and 60 sec at 60°C. Four microliters of template solution was used for the reaction. The threshold cycle (Ct) of the qPCR assay was determined by the detection system as the cycle at which sample fluorescence crosses the threshold.

Results

Primer design and optimization for multiplex FLOS-LAMP assay

For the EBV, EBNA1 is a multifunctional EBV-encoded protein whose primary function is to ensure EBV genome replication and maintenance (Dinh et al., 2023; Kanda, 2018). EBNA1 is the only viral protein expressed in all the latency programs of EBV (De Leo et al., 2020). Due to its wide distribution during the survival phase of EBV virus, it is considered the most suitable gene to be tested in clinical transplanted populations.

For the B19V, the NS gene encoding the nonstructural protein NS1, which has a trans-regulatory promoter mechanism and contains the motifs for nucleoside triphosphate binding and hydrolysis (Zhi et al., 2006), involved in the induction of apoptosis in red lineage cells (Manaresi and Gallinella, 2019). As the major replication protein of B19V, deletion of NS1 completely abolishes the infectivity of the virus (Zhang et al., 2022). Therefore, the NS gene is a more suitable gene for detecting B19V in transplant recipients.

In the multiplex LAMP assay, since there may be interference reactions between each primer set, an important factor in multiplex LAMP development is to obtain an optimal primer set ratio that can detect all target viruses by adjusting the ratio between each primer set. For optimization of the multiplex LAMP assay conditions, different concentration ratios and temperature of the EBV and B19V primer sets were tested with standards; Figure 1D shows the performance of the multiplex LAMP assay at the optimum conditions.

Specificity and sensitivity evaluation of the multiplex FLOS-LAMP assay

The specificity of the multiplex FLOS-LAMP assay was assessed using 8 common human viruses, including CMV, HSV1/2, HHV-8, HBV, HCV and HEV. No amplification curve was observed in any of the other three common human viruses, indicating that the novel multiplex FLOS-LAMP assay is specific for EBV and B19V (Fig. 2A). EBV and B19V standards that were 10-fold serial diluted from 10⁶ to 10² copies/μL were used to determine the sensitivity (Fig. 2B, C), and the detection ability of the multiplex FLOS-LAMP assay was 10³ copies/μL in <25 min (Fig. 2D, E).

FIG. 2.

Specificity and sensitivity of the multiplex FLOS-LAMP assay. (A) Specificity of the multiplex FLOS-LAMP assay. Approximately 10⁵ DNA copies of EBV and B19V were used as the positive control. The testing viruses included a two-by-two mix of CMV, HSV1/2, HHV-8, HBV, HCV, and HEV. (B, C) Sensitivity of the multiplex FLOS-LAMP assay. The sensitivity of detection was determined with 10-fold serial dilutions of the EBV and B19V standard from 1.0 × 10² to 1.0 × 10⁶ copies/μL. (D, E) Time to positivity (Tp) for the multiplex FLOS-LAMP assay. Horizontal line: Threshold. CMV, cytomegalovirus; HBV, hepatitis B virus; HCV, hepatitis C virus; HEV, hepatitis E virus; HHV-8, human herpesvirus type 8; HSV1/2, herpes simplex virus 1/2.

LOD of the multiplex FLOS-LAMP assay

We further measured the LOD of the multiplex FLOS-LAMP assay using serial dilution of EBV and B19V nucleic acids. The hit rates of two different template concentrations (4,000, 1,000, 500, and 250 copies/μL) in 24 replicates were measured and are listed in Table 2. The levels of LOD were obtained using the probit regression analysis: 969 copies/μL for EBV and 798 copies/μL for B19V, which were slightly higher than other studies (Liu et al., 2013; Yamada et al., 2006). The assay showed high analytical specificity (Fig. 2).

Table 2.

Limit of Detection of the Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification for Epstein–Barr Virus and Parvovirus B19 Detection

Template input (copies/μL)	4.00E+03	1.00E+03	5.00E+02	2.50E+02	LOD (copies/μL)
EBV (positive/total)	24/24	23/24	17/24	12/24	969
B19V (positive/total)	24/24	24/24	18/24	16/24	798

LOD, limit of detection.

Comparison of performance between the multiplex FLOS-LAMP assay and commercial EBV and B19V qPCR kit using clinical samples

Clinical transplant individuals are an immune-impaired population and often have a relatively higher EBV and B19V positive rate than other populations. To verify the clinical applicability of the multiplex FLOS-LAMP, a total of 200 plasma samples were collected from clinical transplant patients, of which 20 were B19V positive, 20 were EBV positive, and the remainder were negative for both two viruses. For comparison, a commercial EBV and B19V qPCR kit (Shanghai ZJ Bio-Tech Co) was used.

Among these samples, 20 were detected as EBV positive and 20 were detected as B19V positive by the commercial qPCR kit, and 19 were detected as EBV positive and 20 were detected as B19V positive by the multiplex FLOS-LAMP assay. One sample with a low viral load was detected as EBV positive by a commercial qPCR kit with the Ct values of 36.5 (viral load: 117), while the multiplex FLOS-LAMP was negative.

For transplant patients, a viral load of 235 copies/mL or less is generally considered no evidence of active infection (Gulley and Tang, 2010). The expert consensus states that there is no recognized peripheral blood EBV-DNA threshold for initiating preemptive therapy, but rapidly rising high-copy number viruses deserve more attention (Chinese Society of Hematology, Chinese Medical Association et al., 2022). If the positive samples by the commercial qPCR kit are considered true positive, the specificity of multiplex FLOS-LAMP assay for the detection of EBV and B19V was 100%, with sensitivities of 95.2% and 100%, respectively. In addition, the positive predictive value between the two assays for EBV and B19 was 100%, with negative predictive value of 99.4% and 100%, respectively (Table 3).

Table 3.

Comparison of the Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification Assay with Quantitative Real-Time PCR Assay

	EBV				B19V
		qPCR assay (commercial qPCR kit, Shanghai ZJ Bio-Tech Co)				qPCR Assay (commercial qPCR kit, Shanghai ZJ Bio-Tech Co)
Multiplex FLOS-LAMP assay		+	−	Total		+	−	Total
	+	20	0	20	+	20	0	20
	−	1	160	161	−	0	160	160
	Total	21	160	181	Total	20	160	180
Specificity (%)	100.0				100.0
Sensitivity (%)	95.2				100.0
Positive predictive value (%)	100.0				100.0
Negative predictive value (%)	99.4				100.0

FLOS-LAMP, Fluorescence of Loop Primer Upon Self-Dequenching Loop-Mediated Isothermal Amplification; qPCR, quantitative real-time PCR.

Discussion

Rapid diagnosis and treatment of EBV and B19V are of concern for clinical transplant patients, both for allogeneic stem cell transplantation and SOT. Most clinical transplant patients are heavily immunosuppressed and therefore unable to generate an effective humoral or cellular immune response; EBV and B19V infections may persist, and such persistent infections will lead to life-threatening complications in transplant recipients. Early identification of viral infection and viral load monitoring allow therapeutic interventions to prevent progression to complications. Serological diagnosis of immunosuppressed patients is unreliable due to inadequate or delayed antibody-mediated immune responses (Eid and Ardura, 2019; Kurtzman et al., 1987). Therefore, the current preferred measurement is screening and monitoring of viral load by NAATs.

In the KDIGO Clinical Practice Guideline for the Care of Kidney Transplant Recipients (Khwaja, 2010; Kidney Disease: Improving Global Outcomes (KDIGO) Transplant Work Group, 2009), it is stated that earlier monitoring should be undertaken, and more frequent and prolonged sampling should be considered in high-risk patients because of the rapid replication of EBV, and the calculated doubling time for EBV might be as short as 56 h (Khwaja, 2010; Kidney Disease: Improving Global Outcomes (KDIGO) Transplant Work Group, 2009; Marjanska and Styczynski, 2023).

B19V can be widely transmitted by airborne, bloodborne, and vertical routes of transmission (Barzon et al., 2009). B19V infection occurs after kidney, liver, and other SOT. It has been reported that B19V infection is more prevalent in renal transplant recipients than in other transplant recipients due to the trophic effect of B19V on renal tissue (Qiu et al., 2017; Wang et al., 2021). This is consistent with our detection of high viral load of B19V in two renal transplant recipients (Ma et al., 2022). A case–control study from China showed that the incidence of B19V infection after renal transplantation was 18.75% (Porignaux et al., 2013; Zhong et al., 2022). Guidelines from the American society of transplantation infectious diseases community recommend that in recipients with symptoms associated with B19V infection, especially in renal transplant recipients, monitoring should be repeated at high frequency (Krishnan et al., 2015; Rezahosseini et al., 2021).

At this stage, qPCR is considered to be the most sensitive and specific molecular diagnostic test for infectious diseases, and when new molecular diagnostic kits are developed, commercial qPCR kits are often used as a reference to assess their performance. However, given the time and cost associated with high-frequency screening, and the complex equipment and trained personnel required for qPCR, the development of a simple, rapid, and highly specific screening method for EBV and B19V is essential for the effective prevention and control of EBV- and B19V-related diseases and deaths in transplant patients.

Although LAMP was developed over 20 years ago (Notomi et al., 2000), it is difficult to achieve real-time monitoring, and multiplex detection with the traditional LAMP method, nonspecific amplification, and low detection accuracy have limited its application. To fulfill the needs of specific target detection and one-pot multiplex detection, several probe-based LAMP methods were developed. In particular, the FLOS-LAMP uses a labeled loop probe quenched in its unbound state, fluoresces only when bound to its target (amplicon).

The probe binds specifically to the target and releases a fluorescent signal, which prevents the detection of false positive signals caused by primer dimers, hairpin structures. It allows the sequence-specific and multiplex detection of LAMP amplicons (Gadkar et al., 2018). Therefore, we applied FLOS-LAMP to develop a multiplex assay for EBV and B19V infection.

In this study, we optimized the primer set and reaction conditions of the multiplex FLOS-LAMP assay and evaluated its specificity and sensitivity compared to those of the commercial EBV and B19V qPCR kit. The specificity of the multiplex FLOS-LAMP assay was 100%, which was excellent in terms of ruling out false positives. The sensitivities of the multiplex FLOS-LAMP assay for EBV and B19V samples were 95.2% and 100%, respectively. Although multiplex FLOS-LAMP amplification can detect the virus within 10–20 min when the viral load is high, when the viral load of EBV is low, sensitivity levels of the multiplex FLOS-LAMP assay were slightly lower, but still quite accurate. Meanwhile, high-level viremia is more likely to be associated with symptomatic disease.

Conversely, low-level DNAemia after infection may not be clinically significant (Al Hamed et al., 2020; Chinese Society of Hematology, Chinese Medical Association et al., 2022; Söderlund-Venermo et al., 2002). The multiplex FLOS-LAMP assay is attractive as an intermediate between rapid antigen/antibody kits and qPCR kits, with higher sensitivity than the former and faster and simpler equipment staffing requirements than the latter, and it shows similar performance to commercial qPCR kits. Simultaneous diagnosis of EBV and B19V with a single assay meets the clinical need for increased screening of transplant patients, saving time and resources. Applying the method to a small portable device that combines isothermal amplification and fluorescence monitoring allows for field testing.

Overall, we have established, for the first time, a multiplex FLOS-LAMP method for the simultaneous detection of EBV and B19V, which has the potential to become an important tool for clinical transplant patient screening and to complement existing diagnostic methods in clinical health care settings.

Conclusions

The multiplex FLOS-LAMP assay is expected to be an important tool for clinical transplant patient screening and to complement existing diagnostic methods in clinical health care settings.

Footnotes

Acknowledgments

We thank reviewers for their helpful comments on this article. Thanks are due to Medcaptain Inc. for assistance with the experiments and valuable discussion. We also thank the Kidney Disease Center (The First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China) for preparing and supplying clinical samples.

Authors' Contributions

Y.X.: Methodology (lead), writing–original draft (lead), and formal analysis (lead). M.L.: Writing–original draft (equal) and software (lead). M.L.: Conceptualization (supporting) and writing–original draft (equal). Y.L.: Writing–original draft (supporting) and formal analysis (supporting). D.C.: Conceptualization (equal) and methodology (supporting). Y.W.: Writing–review and editing (equal) and software (supporting). J.X.: Writing–review and editing (equal), conceptualization (lead), and software (lead). All authors have read and agreed to the published version of the article.

Availability of Data and Materials

The datasets used and/or analyzed during this study are available from the corresponding author on reasonable request. The datasets generated and/or analyzed during this study are available on the ScienceDB upon request.

Ethics Approval and Consent to Participate

The study was conducted with the approval of the Ethics Committee of the First Affiliated Hospital Zhejiang University (Reference Number 2020-856) and all participants signed the informed consent for the study.

Author Disclosure Statement

The authors declare that they have no competing interests.

Funding Information

This research was funded by Zhejiang Provincial Key Research and Development Program (Grant No. 2020C03032), Zhejiang Provincial Natural Science Foundation of China (Grant No. LQ20H080002), and the National Natural Science Foundation of China (Grant Nos. 82172335, 81971994 and 91846103).

References

Al Hamed

, Bazarbachi

, Mohty

. Epstein-Barr virus-related post-transplant lymphoproliferative disease (EBV-PTLD) in the setting of allogeneic stem cell transplantation: A comprehensive review from pathogenesis to forthcoming treatment modalities. Bone Marrow Transplant, 2020; 55(1):25–39; doi: 10.1038/s41409-019-0548-7

Barzon

, Murer

, Pacenti

, et al. Detection of viral DNA in kidney graft preservation and washing solutions is predictive of posttransplant infections in pediatric recipients. J Infect Dis, 2009; 200(9):1425–1433; doi: 10.1086/644504

Chinese Society of

Hematology

, Chinese Medical Association; China Hematology

Association

, Chinese Medical Doctor

Association

. [Chinese consensus on the diagnosis and management of Epstein-Barr virus-related post-transplant lymphoproliferative disorders after hematopoietic stem cell transplantation (2022)]. Zhonghua Xue Ye Xue Za Zhi, 2022; 43(9):716–725 [Chinese]; doi: 10.3760/cma.j.issn.0253-2727.2022.09.002

Cohen

. Epstein-Barr virus infection. N Engl J Med, 2000; 343(7):481–492; doi: 10.1056/nejm200008173430707

Damania

, Kenney

, Raab-Traub

. Epstein-Barr virus: Biology and clinical disease. Cell, 2022; 185(20):3652–3670; doi: 10.1016/j.cell.2022.08.026

De Leo

, Calderon

, Lieberman

. Control of viral latency by episome maintenance proteins. Trends Microbiol, 2020; 28(2):150–162; doi: 10.1016/j.tim.2019.09.002

Dinh

, Loaëc

, Quillévéré

, et al. The hide-and-seek game of the oncogenic Epstein-Barr virus-encoded EBNA1 protein with the immune system: An RNA G-quadruplex tale. Biochimie, 2023; 214:57–68; doi: 10.1016/j.biochi.2023.07.010

Eid

, Ardura

. Human parvovirus B19 in solid organ transplantation: Guidelines from the American society of transplantation infectious diseases community of practice. Clin Transplant, 2019; 33(9):e13535; doi: 10.1111/ctr.13535

Gadkar

, Goldfarb

, Gantt

, et al. Real-time Detection and Monitoring of Loop Mediated Amplification (LAMP) reaction using self-quenching and de-quenching fluorogenic probes. Sci Rep, 2018; 8(1):5548; doi: 10.1038/s41598-018-23930-1

10.

Gulley

, Tang

. Using Epstein-Barr viral load assays to diagnose, monitor, and prevent posttransplant lymphoproliferative disorder. Clin Microbiol Rev, 2010; 23(2):350–366.

11.

Haider

, Zamani

, Taqi

, et al. Post-transplant lymphoproliferative disorder after renal transplant in the pediatric population: A systematic review. Blood, 2020; 136(Suppl. 1):35–36; doi: 10.1182/blood-2020-143333

12.

Hanyue

, Yanjin

, Shihui

, et al. Closed-tube visual detection of Atlantic cod (Gadus morhua) using self-quenched primer coupled with a designed loop-mediated isothermal amplification vessel. J Sci Food Agric, 2023; 103(12):6025–6032; doi: 10.1002/jsfa.12711

13.

Huang

, Wang

, Chen

, et al. Parvovirus B19 infection in kidney transplant recipients: A prospective study in a teaching hospital in Shanghai, China. Transplant Immunol, 2022; 74:101667; doi: 10.1016/j.trim.2022.101667

14.

Kalra

, Roessner

, Jupp

, et al. Epstein-barr virus DNAemia monitoring for the management of post-transplant lymphoproliferative disorder. Cytotherapy, 2018; 20(5):706–714; doi: 10.1016/j.jcyt.2018.02.367

15.

Kanda

. EBV-encoded latent genes. Adv Exp Med Biol, 2018; 1045:377–394; doi: 10.1007/978-981-10-7230-7_17

16.

Khwaja

. KDIGO guidelines for care of the kidney transplant recipient. Nephron Clin Pract, 2010; 116(1):c27–c28; doi: 10.1159/000314547

17.

Kidney Disease: Improving Global Outcomes (KDIGO) Transplant Work Group. KDIGO clinical practice guideline for the care of kidney transplant recipients. Am J Transplant, 2009; 9(Suppl. 3):S1–S155; doi: 10.1111/j.1600-6143.2009.02834.x

18.

Krishnan

, Ramadas

, Rajendran

, et al. Effects of parvovirus B19 infection in renal transplant recipients: A retrospective review of three cases. Int J Angiol, 2015; 24(2):87–92; doi: 10.1055/s-0034-1371759

19.

Kurtzman

, Ozawa

, Cohen

, et al. Chronic bone marrow failure due to persistent B19 parvovirus infection. N Engl J Med, 1987; 317(5):287–294; doi: 10.1056/nejm198707303170506

20.

, Durand

, Agha

, et al. Epstein-Barr virus and renal transplantation. Transplant Rev (Orlando), 2017; 31(1):55–60; doi: 10.1016/j.trre.2016.12.001

21.

, Xue

, Fei

, et al. Visual detection of rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) simultaneously by duplex loop-mediated isothermal amplification. Food Chem Mol Sci, 2022; 4:100107; doi: 10.1016/j.fochms.2022.100107

22.

, Wang

, et al. Advances in ligase-based nucleic acid amplification technology for detecting gene mutations: A review. Mol Cell Biochem, 2023; 478(7):1621–1631; doi: 10.1007/s11010-022-04615-w

23.

Lindsay

, Yong

, Greenwood

, et al. Epstein-Barr virus related post-transplant lymphoproliferative disorder prevention strategies in allogeneic hematopoietic stem cell transplantation. Rev Med Virol, 2020; 30(4):e2108; doi: 10.1002/rmv.2108

24.

Liu

, Tang

, Wang

, et al. Visual detection and evaluation of latent and lytic gene expression during Epstein-Barr virus infection using one-step reverse transcription loop-mediated isothermal amplification. Int J Mol Sci, 2013; 14(12):23922–23940; doi: 10.3390/ijms141223922

25.

, Man

, Niu

, et al. Progress of research on human parvovirus B19 infection after renal transplantation. Transplant Rev (Orlando), 2022; 36(4):100730; doi: 10.1016/j.trre.2022.100730

26.

Macri

, Crane

. Parvoviruses. [Updated June 28, 2023]. In: StatPearls. StatPearls Publishing: Treasure Island, FL, USA; 2024.

27.

Manaresi

, Gallinella

. Advances in the development of antiviral strategies against parvovirus B19. Viruses, 2019; 11(7):659; doi: 10.3390/v11070659

28.

Marjanska

, Styczynski

. Who is the patient at risk for EBV reactivation and disease: Expert opinion focused on post-transplant lymphoproliferative disorders following hematopoietic stem cell transplantation. Expert Opin Biol Ther, 2023; 23(6):539–552; doi: 10.1080/14712598.2023.2196366

29.

Mende

, Sockel

. Parvovirus B19 infection. N Engl J Med, 2018; 379(24):2361; doi: 10.1056/NEJMicm1807156

30.

Muffly

, Shiraz

, Nguyen

, et al. Rate of rise of EBV viral load by quantitative PCR after allogeneic transplantation correlates with PTLD facilitates timely institution of rituximab. Blood, 2016; 128(22):4609–4609; doi: 10.1182/blood.V128.22.4609.4609

31.

Nazarenko

, Lowe

, Darfler

, et al. Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Res, 2002a;30(9):e37; doi: 10.1093/nar/30.9.e37

32.

Nazarenko

, Pires

, Lowe

, et al. Effect of primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of conjugated dyes. Nucleic Acids Res, 2002b;30(9):2089–2195; doi: 10.1093/nar/30.9.2089

33.

Notomi

, Okayama

, Masubuchi

, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000; 28(12):E63; doi: 10.1093/nar/28.12.e63

34.

Porignaux

, Vuiblet

, Barbe

, et al. Frequent occurrence of parvovirus B19 DNAemia in the first year after kidney transplantation. J Med Virol, 2013; 85(6):1115–1121; doi: 10.1002/jmv.23557

35.

Qiu

, Söderlund-Venermo

, Young

. Human parvoviruses. Clin Microbiol Rev, 2017; 30(1):43–113; doi: 10.1128/cmr.00040-16

36.

Rezahosseini

, Ekenberg

, Møller

, et al. Incidence and impact of parvovirus B19 infection in seronegative solid organ transplant recipients. J Infect Dis, 2021; 224(5):865–869; doi: 10.1093/infdis/jiab024

37.

Rolando

, Jue

, Barlow

, et al. Real-time kinetics and high-resolution melt curves in single-molecule digital LAMP to differentiate and study specific and non-specific amplification. Nucleic Acids Res, 2020; 48(7):e42; doi: 10.1093/nar/gkaa099

38.

Simunov

, Mrzljak

, Jurekovic

, et al. Parvovirus B19 status in liver, kidney and pancreas transplant candidates: A single center experience. World J Transplant, 2022; 12(11):378–387; doi: 10.5500/wjt.v12.i11.378

39.

Söderlund-Venermo

, Hokynar

, Nieminen

, et al. Persistence of human parvovirus B19 in human tissues. Pathol Biol (Paris), 2002; 50(5):307–316; doi: 10.1016/s0369-8114(02)00307-3

40.

Soroka

, Wasowicz

, Rymaszewska

. Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR?. Cells, 2021; 10(8):1931; doi: 10.3390/cells10081931

41.

Toner

, Bollard

. EBV+ lymphoproliferative diseases: Opportunities for leveraging EBV as a therapeutic target. Blood, 2022; 139(7):983–994; doi: 10.1182/blood.2020005466.

42.

Tyagi

, Kramer

. Molecular beacons: Probes that fluoresce upon hybridization. Nat Biotechnol, 1996; 14(3):303–308; doi: 10.1038/nbt0396-303

43.

Uhlin

, Wikell

, Sundin

, et al. Risk factors for Epstein-Barr virus-related post-transplant lymphoproliferative disease after allogeneic hematopoietic stem cell transplantation. Haematologica, 2014; 99(2):346–352; doi: 10.3324/haematol.2013.087338

44.

Wang

, Fu

, Song

, et al. Human parvovirus B19-associated early postoperative acquired pure red cell aplasia in simultaneous pancreas-kidney transplantation: A case report. World J Clin Cases, 2021; 9(8):1968–1975; doi: 10.12998/wjcc.v9.i8.1968

45.

Yamada

, Itoh

, Yoshida

. Sensitive and rapid diagnosis of human parvovirus B19 infection by loop-mediated isothermal amplification. Br J Dermatol, 2006; 155(1):50–55; doi: 10.1111/j.1365-2133.2006.07379.x

46.

, Bao

, Lyu

, et al. Foscarnet therapy for pure red cell aplasia related to human parvovirus B19 infection in kidney transplant recipients: A preliminary exploration. Infect Drug Resist, 2021; 14:2911–2923; doi: 10.2147/idr.s321936

47.

Zanella

, Cordey

, Kaiser

. Beyond cytomegalovirus and Epstein-Barr virus: A review of viruses composing the blood virome of solid organ transplant and hematopoietic stem cell transplant recipients. Clin Microbiol Rev, 2020; 33(4):e00027-20; doi: 10.1128/cmr.00027-20

48.

Zeng

, Wu

, He

. Loop-mediated isothermal amplification-based microfluidic platforms for the detection of viral infections. Curr Infect Dis Rep, 2022; 24(12):205–215; doi: 10.1007/s11908-022-00790-5

49.

Zhang

, Zhao

, Zeng

, et al. Evolution of the Probe-Based Loop-Mediated Isothermal Amplification (LAMP) assays in pathogen detection. Diagnostics (Basel), 2023; 13(9):1530; doi: 10.3390/diagnostics13091530

50.

Zhang

, Shao

, Gao

, et al. Structures and implications of the nuclease domain of human parvovirus B19 NS1 protein. Comput Struct Biotechnol J, 2022; 20:4645–4655; doi: 10.1016/j.csbj.2022.08.047

51.

Zhi

, Mills

, Lu

, et al. Molecular and functional analyses of a human parvovirus B19 infectious clone demonstrates essential roles for NS1, VP1, and the 11-kilodalton protein in virus replication and infectivity. J Virol, 2006; 80(12):5941–5950; doi: 10.1128/JVI.02430-05

52.

Zhong

, Zeng

, Lin

, et al. The detection, treatment of parvovirus B19 infection induced anemia in solid organ transplants: A case series and literature review of 194 patients. Transfus Clin Biol, 2022; 29(2):168–174; doi: 10.1016/j.tracli.2021.12.005