Expression of Epidermal Growth Factor and Its Receptor in Cirrhotic Liver Disease

Tissue Specimens

Liver specimens from three transplant patients with cirrhotic liver disease and control specimens (livers rejected for transplantation) were obtained at surgery according to UCSF policies of the Committee on Human Research at UCSF, in compliance with NIH guidelines. Tissue pieces were immediately placed in ice-cold 4% formaldehyde (freshly prepared from paraformaldehyde), dissolved in Dulbecco's Mg²⁺/Ca²⁺-free PBS, and were fixed for 24 hr at 4C. Tissues were dehydrated in increasing ethanol concentrations, cleared in xylenes, and embedded in paraffin by standard methods. Sections (5-μm) were collected on positively charged microscope slides (Superfrost Plus; Fisher Scientific, Pittsburgh, PA).

DNA Oligonucleotide Probes

Oligonucleotides were synthesized with an ABI 390 synthesizer. Biotin-dT was incorporated by programming the addition of 5′-dimethoxytrityloxy-5-N((4tbutylbenzoyl)-biotinyl)-aminohexyl) 3′acryimido) 2′deoxy-U-3′-2-cyanoethyl-N,N-diisopropyl)-phosphoramidite (Glen Research; Sterling, VA). After column elution, oligos were deprotected overnight at 58C, dried in vacuo, resuspended in H₂O, adjusted to 50% deionized formamide (pH 7.0), heated to 65C for 5 min, and fractionated by electrophoresis on a 15% acrylamide/Bis (30:1), 7 M urea, 1 × TBE gel. Bands were identified by UV shadowing, excised, and eluted in H₂O, precipitated twice with 3 volumes of ethanol, and stored in H₂O at −20C. Oligo sequences (bT, biotinylated thymidine) were selected from the GeneBank (NCBI) database: human EGF antisense: bTTACAAAGCACTGTbTGTCCCAATTTGGGTbTT (4325-4295) and AbTGTAGCCAACAACACAGbTTGCATGCATACTTGbTC (3459-3425); human EGF sense probe bTAATGGAGCAAGCTbTTCATATGCCCTCCTA (3915-3945). The human EGF receptor antisense, GGAGCGCTGCCCCGGCCGTCCGG(bT)₃ (197–220) and sense, CCGGGACGGCCGGGGCAGCGCTC(bT)₃ (476-499), were purchased from Research Genetics (Huntsville, AL).

In Situ Localization of EGFR mRNA Using Biotin-labeled Oligonucleotide Probes Detected by ABC-Peroxidase

Sections were dewaxed with Safeclear (CMS; Houston, TX), rehydrated in ethanol, washed with PBS, and treated with 0.2 N HCl for 20 min, followed by 1.5% H₂O₂ for 30 min, then by 0.3% Triton X-100 for 15 min, and incubated with 1 μg/ml proteinase K (Amresco; Solon, OH) for 30 min at 37C. After washing with 0.1 M triethanolamine buffer, pH 8.0, sections were acetylated for 10 min in 0.25% acetic anhydride in triethanolamine buffer, incubated with 40% formamide in 1 × SSC at 37C for 2 hr, and air-dried. One pmole biotinylated probe was diluted in 100 μl hybridization buffer containing 40% formamide, 1 × SSC, 10 × Denhardt's solution, 0.5% SDS, 0.5% sodium pyrophosphate, yeast tRNA (500 μg/ml) in 10 mM Tris buffer, pH 7.4, denatured at 85C, chilled on ice and applied to the sections, and hybridized in a humidified chamber at 40C. After 12 hr the sections were washed at room temperature (RT) (5 ml/ slide) with 2 × SSC, followed by 1 × SSC and 0.25 × SSC for 30 min each at 37C. Sections were briefly washed in TBS (10 mM Tris, pH 7.6, containing 500 mM NaCl), blocked with 4% BSA, 0.5% teleostean gelatin, 0.1% Tween-20 in TBS for 30 min, and incubated with ABC peroxidase (Vector; Burlingame, CA) for 30 min, followed by three-min washes in blocking buffer and three-min washes in TBS. Peroxidase activity was revealed with DAB substrate (5 min), purchased from Qual-Tek Laboratories (Santa Barbara, CA). The sections were washed with several changes of distilled water, counterstained lightly with Carazzi's hematoxylin, dehydrated with alcohol and xylenes, and coverslipped.

Localization of EGF Expression by In Situ Hybridization Using Biotin-labeled Oligonucleotide Probes Detected by Tyramide-mediated Signal Amplification

The conditions of pretreatment, hybridization, and posthybridization washes for EGF mRNA were essentially as described above, with the following modifications. Hybridization washes were followed by a brief wash in TBS and sections were blocked with 4% BSA, 0.5% teleostean gelatin, 0.1% Tween-20 in TBS for 30 min. Sections were then incubated with ABC-peroxidase (Vector) for 30 min, followed by three 5-min washes in blocking buffer, and were incubated with biotinylated tyramide (Dako; Carpinteria, CA) for 15 min, followed by ABC-peroxidase for 15 min. After three 5-min washes with blocking buffer and three 5-min min washes in TBS, peroxidase activity was revealed with DAB substrate for 5 min. Sections were then washed with several changes of distilled water, counterstained lightly with Carazzi's hematoxylin, dehydrated with alcohol and xylenes, and coverslipped. For all hybridizations, a set of controls was used to establish hybridization specificity: (a) sense control probes did not yield signal above background; (b) omission of the biotin-labeled antisense probes resulted in no signal; and (c) omission of ABC-peroxidase resulted in no signal, indicating the specificity of the signal amplification procedure.

Immunohistochemical Detection of Pro-EGF Peptide

Antiserum to the human EGF pre-pro-peptide amino acids 1-21 was a kind gift of Dr. B Mroczkowski and has been characterized elsewhere (Mroczkowski and Reich 1993). Five-μm sections were collected on microscope slides (Superfrost Plus; Fisher Scientific) and, after deparaffinization and rehydration, antigen retrieval was performed by micro-waving in 10 mM citrate buffer, pH 6.0. Nonspecific antibody binding was prevented by preincubation with blocking buffer: 2% BSA, 0.5% teleostean fish skin gelatin (Sigma Chemicals; St Louis, MO), 0.1% Tween-20, and 500 mM NaCl in Tris, pH 7.6, for 30 min at RT. Sections were incubated overnight at RT in 100 μl blocking buffer with a 1:125 antibody dilution. After five washes in blocking buffer, bound antibody was detected with biotinylated goat anti-rabbit IgG, followed by ABC-peroxidase conjugate (Vector). Peroxidase activity was developed with DAB substrate (5 min) and sections counterstained with hematoxylin before mounting. Omission of the first antibody resulted in no signal detection in either control or cirrhotic liver sections.

Localization of EGF Receptor mRNA in Control and Cirrhotic Human Liver

To localize the cellular distribution of EGFR gene expression in human liver, we used an antisense EGFR biotinylated oligonucleotide probe (Radinsky et al. 1993) that was complementary to a segment of the receptor mRNA coding region. As shown in Figure 1A, after stringent washing and color development, hybridization of the EGFR antisense probe to its target transcript could be clearly resolved in control hepatic sections, in which staining displayed a cell specific pattern restricted to hepatocytes. Kupffer and endothelial cells did not contain detectable levels of the EGFR transcript. In the individual lobules, EGFR mRNA expression was nonuniformly distributed, showing a peripheral bias (Figure 1A). To verify the specificity of the hybridization/detection procedure, parallel control sections were hybridized with a sense-control biotinylated EGFR probe, which did not produce detectable staining (Figure 1B).

We next compared the EGFR mRNA expression pattern observed in control tissue to sections obtained from advanced cirrhosis. Here, EGFR mRNA staining was evident throughout the cirrhotic tissue (Figure 1C), displaying a higher intensity bias in the smaller nodules and an increased concentration at the nodular periphery (Figure 1C). Moreover, positive signals were evident throughout the highly proliferative bile duct epithelium but were absent from the internodular fibrotic matrix. In all cases, the EGFR mRNA signal was restricted to the cytoplasm (Figure 1D).

Localization of EGF mRNA in Control and Cirrhotic Liver Using Biotin-labeled Oligoprobes Followed by Tyramide-catalyzed Signal Amplification

In previous studies we have demonstrated that a low constitutive level of EGF expression was detectable in rodent liver and was rapidly upregulated in the immediate-early phase of regenerative liver growth (Mullhaupt et al. 1994). To examine whether an increase in EGF expression could also be correlated with the regenerative nodular expansion of human cirrhosis, we compared the cellular distribution of EGF gene transcripts in control and diseased liver sections. To target hepatic EGF mRNA transcripts, we designed biotinylated oligonucleotides complementary to the coding region of the processed mature EGF peptide. With the use of two different biotin-labeled antisense oligonucleotide probes, staining for the EGF mRNA was essentially negative in control liver (not shown) but could be identified at a low albeit significant level in cirrhotic sections when ABC-peroxidase, followed by DAB substrate alone was used for detection (Figure 2A). To increase the detection sensitivity of the biotin oligo-mRNA hybrids, we applied a tyramide-deposition mediated signal amplification procedure which affords a 100- to 1000-fold signal increase (Adams 1992; Speel et al. 1999). With this method, hepatocytes remained negative for EGF mRNA in the control samples, although weak staining could be discerned in isolated bile duct cells (Figure 2B). In contrast, with the tyramide deposition-mediated signal amplification procedure, EGF mRNA accumulation was clearly evident in the cytoplasm of the cirrhotic hepatocytes (Figures 2C and 2D). EGF staining was highly localized to regenerative nodules and the presumptive proliferative bile ductules (Figure 2D). Staining appeared most concentrated at the nodule periphery. In cirrhotic liver, the EGF mRNA signal was more intense in the newly forming bile epithelium (Figure 2D). No EGF mRNA staining was detected in the fibroblasts of the internodular matrix (Figures 2C and 2D). Similar results were obtained with both EGF antisense oligoprobes. To verify the hybridization pattern, parallel sections were hybridized to an EGF sense control probe and were negative (not shown).

Detection of the EGF Pre-pro-peptide in Human Cirrhotic Liver

We next carried out immunohistochemical localization to determine whether the regenerative parenchyma produced detectable levels of the EGF peptide. Because the hepatocyte EGF receptor can serve as an uptake module for processed EGF (see Discussion), we used an antiserum raised against the pro-peptide region, amino acids 1-21 (Mroczkowski and Reich 1993), which discriminates the precursor from the endocytosed mature EGF peptide. No immunoreactivity could be detected in control liver samples (not shown). However, the regenerative nodules in cirrhotic liver sections stained positive with the pro-peptide antiserum (Figure 3). Remarkably EGF propeptide staining appeared nonuniform across the lobules, where it was seen with a distinct variation in cell-to-cell intensity. Fibroblasts in the adjoining internodular fibrotic matrix were negative. A less intense staining was consistently seen in the presumptive proliferative hepatic ductules, which in many cases exhibited a slight luminal bias (Figure 3).