Photosynthetic and oxidative stress responses of rice seedlings exposed to benzotriazole

Abstract

Objective: The widespread use of benzotriazole (BTA) has raised concerns about its potential risks to living organisms. However, the toxic effects of BTA on plants remain unclear. Thus, leaves of rice seedlings were employed as the tested materials in the current experiments. The objective was to investigate the toxicological effects of BTA on the photosynthesis and antioxidant systems in rice seedlings. Methods: The rice seedlings at the four-leaf stage were subjected to treatments by adding BTA into the nutrient solutions. The tested concentrations of BTA were set at 0, 1.5, 2.5, 5, and 10 mg/L. Results: The results showed that 1.5 mg/L BTA increased chlorophyll (Chl) content and net photosynthetic rate (Pn), accompanied by upregulation of atpA, atpB, psaB, and psbA genes. In contrast, 5 to 10 mg/L BTA stimulated excessive generation of superoxide anion (O₂·⁻), enhanced the activities of NADPH oxidase, superoxide dismutase (SOD) and catalase (CAT) isozymes, and reduced Chl content, Pn, and stomatal conductance (Gs). Simultaneously, such treatments suppressed the expression of atpB, psbA, and RbcS genes. In addition, compared to the control, the products of 70 kDa heat shock proteins (HSP70) were apparently enhanced with the increase of BTA. Conclusions: This study demonstrated that the effects of BTA on the photosynthesis and antioxidant systems of rice seedlings exhibited a concentration-dependent response, with low concentrations (1.5 mg/L) improving photosynthesis, while high concentrations (5 to 10 mg/L) induced oxidative stress and photosynthetic damage. Furthermore, the activation of SOD and CAT isozymes, along with HSP70 induction, may contribute to mitigating BTA toxicity.

Keywords

Benzotriazole reactive oxygen species antioxidant system photosynthesis rice

Introduction

Benzotriazole (BTA), a high-production-volume chemical, is mainly used for corrosion inhibitors, ultraviolet blockers, and plastic products.^1,2 Extensive use of BTA and its derivatives has resulted in their constant release into the environment, leading to widespread occurrence in various environmental media, including indoor dust,³ water,^2,4 sediment,⁵ and soil.¹ Due to its bioaccumulation and environmental persistence, long-term use of BTA will bring potential risks to living organisms.^6,7 To date, there have been numerous studies focused on the ecological risks of BTA on aquatic organisms, such as Daphnia magna⁸ and fish,^9–11 as well as soil biota.^12,13 However, studies concerning the toxic effects on plants exposed to BTA are still limited.

Accumulating studies indicate that exposure to BTA induces oxidative stress in living organisms,^11,13,14 which is confirmed by an increase in the level of reactive oxygen species (ROS) and the variations in antioxidant enzymes.¹¹ In plants, NADPH oxidase is one of the main sources of ROS, and it catalyzes the conversion of oxygen to superoxide anion (O₂·⁻).¹⁵ To cope with ROS toxicity, plants have developed an antioxidant system consisting of protective enzymes such as catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) to scavenge excessive ROS.^16,17 Among them, SOD converts O₂·⁻ into hydrogen peroxide (H₂O₂), and subsequently CAT together with POD decompose H₂O₂ into water (H₂O) and dioxygen (O₂).^16,18 In cells, these antioxidant enzymes exist as multiple isozymes that collaborate in protecting organelles and relieving tissue injury,^16,19 some of which have been used as biomarkers to evaluate the levels of environmental pollutants. However, when ROS generation reaches an extreme amount, oxidative damage might take place and cause oxidized intracellular macromolecules.^20,21 Chloroplasts are more susceptible to oxidative damage than other organelles, so their structural and functional integrity tends to be destroyed along with biochemical and physiological changes in plants.^20–22 Photosynthesis is a sensitive physiological process to oxidative stress.²³ However, little is known about the impact of BTA-induced toxicity on photosynthesis and the antioxidant system in plants. The relevant mechanisms remain to be elucidated.

Based on the above, the current study was thus conducted to explore the effects of BTA on photosynthetic and antioxidant response of rice (Oryza sativa L.) seedlings. The findings will afford a new scientific basis for ecological risk assessment of BTA.

Materials and methods

Plant materials

BTA powder (>99.9% purity) was purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Rice seeds were obtained from Huainan Seed Co., Ltd (China). The seeds were disinfected with a 0.3% sodium hypochlorite solution for 20 min, rinsed thoroughly, and germinated in the tray on the moistened gauze in an incubator at 28 °C. After germination, the young seedlings were transplanted and cultured in nutrient solutions (144.4 mg/L KNO₃, 50.4 mg/L NaH₂PO₄, 94.4 mg/L (NH₄)₂SO₄, 40.5 mg/L MgSO₄·7H₂O, 111.0 mg/L CaCl₂, 1.5 mg/L MnCl₂·4H₂O, 0.074 mg/L (NH₄)₆Mo₇O₂₄, 0.934 mg/L H₃BO₃, 0.035 mg/L ZnSO₄·7H₂O, 0.031 mg/L CuSO₄·5H₂O, 18.6 mg/L Na₂-EDTA, and 13.9 mg/L FeSO₄·7H₂O), and then placed in glasshouse with a temperature ranging from 19 °C to 30 °C and a photoperiod (16 h/8 h). The seedlings at the four-leaf stage were subjected to treatments by adding BTA into the nutrient solutions. The minimum concentration of BTA in various water environments from global areas was reported to be <1 μg/L, and the maximum concentration reached up to 200 mg/L.^4,24,25 Given these environmental concentrations of BTA, the tested concentrations of BTA were set at 0 (control, Ck), 1.5, 2.5, 5, and 10 mg/L. Triplicates were conducted for each concentration. Two weeks after treatments, leaves were collected for tests as below.

Protein extraction and protein gel blot analysis

The crude protein extraction and western blotting analysis were performed according to Wang et al.²⁶ and Rong et al.²⁷ with minor modifications. Fresh leaf (0.2 g) was grounded to be fine powder with liquid nitrogen, and then homogenized in 2 mL of extraction buffer (0.1 M Tris–HCl, pH 8.0, 10% (v/v) glycerol, 0.1 mM ethyl-enediaminetetraacetic acid (EDTA), 0.2% (v/v) Triton X-100, 5% (w/v) PVPP, 1 mM phenylmethylsulphonyl fluoride, 1 mM benzamidine, 1 mg/mL leupeptin, and 2 mg/mL apratinin) in cold conditions. The homogenates were centrifuged at 4 °C, 12,000 r/min for 15 min. The supernatants were stored at −80 °C for western blotting and isozyme analysis. Total protein content was determined in accordance with Bradford.²⁸

For protein gel blot analysis, the extract was mixed with 125 mM Tris–HCl (pH 6.8), 25% (v/v) glycerol, 5% (w/v) sodium dodecyl sulfate, 20% (v/v) 2-mercaptoethanol, and 0.1% (w/v) Bromophenol Blue, and denatured by boiling for 5 min. After cooling, the mixture was centrifuged at 12,000 r/min for 5 min. The total protein was separated on Sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% (m/v) separating gel and 5% (m/v) stacking gel), and then transferred onto polyvinylidene fluoride membrane. The membranes were blocked with 8% (m/v) non-fat milk/Tris-buffered saline with Tween 20 (TBST) buffer for 3 h. Afterwards, they were washed with TBST buffer and followed by incubating with primary antibodies, including rabbit anti-RbcL polyclonal antibody (dilution 1:5000; catalog no. AS03037A; lot no. 1501; Agrisera), mouse anti-70 kDa heat shock proteins (anti-HSP70) monoclonal antibody (dilution 1:2000; catalog no. MA00949; lot no. 23500731D19; clone no. OTI2C12; Boster), and mouse anti-Actin monoclonal antibody (dilution 1:2000; catalog no. M20009; clone no. 26F7; RRID, AB_2936239; Abmart) overnight at 4 °C, respectively. After that, the membranes were transferred to secondary antibody horseradish peroxidase conjugated goat anti-rabbit (dilution 1:5000; catalog no. BA1054; lot no. BST18G21C18I54; Boster) or goat anti-mouse (dilution 1:5000; catalog no. BA1050; lot no. BST18L01A19E50; Boster) IgG at room temperature for 3 h.

Key isozymes of antioxidant enzymes and NADPH oxidases determination

Isozyme patterns were assayed by native polyacrylamide gel electrophoresis. Electrophoresis was run with a constant voltage of 80 V to the separating gel, and thereafter resumed by 120 V to the end using the solution (25 mM Tris, 192 mM glycine solution, pH 8.3) as electrode buffer. SOD, CAT, and POD isozymes were visualized on the basis of García-Limones et al.,²⁹ and NADPH oxidases isozyme was determined by the methods of Sagi and Fluhr.³⁰

Quantitative real-time polymerase chain reaction (qPCR)

Fresh leaf (0.1 g) was prepared for total RNA extraction, followed by the manufacturer's instructions of an RNAprep pure plant kit (Beijing Tiangen, Inc., China). First-strand complementary DNA (cDNA) was synthesized from 2 μg RNA using RevertAid reverse Transcriptase (Thermo Fisher Scientific Biotech Co., Ltd, China). qPCR was performed with TB Green™ Fast qPCR Mix (TaKaRa, Japan) using StepOnePlus™ Real-Time PCR System (ABI, USA). Ubiquitin (Ubq) was served as the reference gene to normalize the amounts of cDNA among the samples. The amplification procedures included predenaturation at 95 °C for 30 s, followed by 40 cycles (95 °C for 5 s and 60 °C for 35 s) and a final dissociation cycle (95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s). Each experiment was replicated three times. The genes and the corresponding primer sequences used in this study are listed in Table 1.

Table 1.

Primers used in qPCR.

Name	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
atpA	GAGGCTTACTTGGGTCGTGTT	TGCTGTTTTGCCGGTTTG
atpB	TCTTTCGTTTTGTTCAAGCAGG	AATGTTGTAGCAGGAGCAGGGT
psbA	ATCTGTAGTTGATAGCCAAGGTCG	TAGGTCTAGAGGGAAGTTGTGAGC
psaB	GCGGCGGTACTTGTGATATT	CCCTGCCATAATGTGATGTG
RbcL	ACCCCGGAGTACGAAACCAAGG	CTGCTTCTTCGGGCGGAACC
RbcS	GAGGCTCATAAAGGCCCATTT	GAGCATGCCATGACGTTGTT
Ubq	TTCCATGCTGCTCTACCACAG	AGGGTTCACAAGTCTGCCTATT

Differences were calculated using the threshold cycle (Ct) and the comparative Ct methods for relative quantiﬁcation. The relative expression of the target genes was calculated by the 2^−ΔΔCT method,³¹ and the results were normalized to Ubq.

Nitroblue tetrazolium (NBT) visualization of superoxide anion radicals

NBT staining method³² was used to detect the production of superoxide radical (O₂·⁻). Leaf sections were incubated directly in staining solution (0.1% (w/v) NBT, 10 mM sodium azide, and 50 mM Tris–HCl, pH 6.5), and then treated by vacuum filtration for 2 min, repeating four times with an interval of 3 min. After that, leaf sections were placed in the incubator for illumination until dark blue spots appeared, and subsequently destained in 90% (v/v) ethanol by boiling for 20 min.

Chl content and key photosynthetic parameters determination

Fresh leaf (0.2 g) was chilled with liquid nitrogen and ground into a fine powder. The pigments were extracted with 100% (v/v) acetone. After centrifugation at 12,000 r/min for 10 min at 40 °C, the supernatant was taken for absorbance detection at 665 nm and 649 nm, respectively. Chl contents were calculated based on the method of Wang et al.²⁶

The net photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), and intercellular carbon dioxide concentration (Ci) were measured at 9:00 a.m. to 11:00 a.m., using a handheld photosynthesis system (TPS-2, PP-Systems, USA). External CO₂ concentration was about 380 µL/L, and illumination intensity was set at 1200 µmol/m²/s. Six leaves in vivo were randomly selected for determination in each treatment.

Statistical analysis

Statistical analyses were performed using SPSS 22.0 software. All data were presented as mean ± standard deviation (SD). A one-way analysis of variance followed by least significant difference tests was used to determine the difference between the treatments in the present experiment at a significance level of p < 0.05.

Results

Changes in O₂·⁻ production in the leaves

The reaction of intracellular O₂·⁻ with NBT produced dark blue hydrazone spots, and the density of spots displayed the generation of O₂·⁻.³³ As illustrated in Figure 1, with increasing concentrations of BTA, O₂·⁻ production exhibited a J-shaped dose–response curve, and 1.5 mg/L BTA significantly decreased the level of O₂·⁻, while 5 or 10 mg/L BTA stimulated the production of O₂·⁻ with an obvious increase compared to the control.

Figure 1.

NBT visualized O₂·⁻ production in rice leaves exposed to concentrations of BTA for 14 days. 0 (Ck), 1.5, 2.5, 5, and 10 mg/L denote the treatment concentrations of BTA added in solutions. The same below.

Changes in SOD, POD, CAT, and APX isozymes in the leaves

The electrophoresis gel band intensities (denoting enzyme activities) indicated the total activities of isozymes. As shown in Figure 2, the activities of SOD, CAT, or NADPH oxidase isozymes exhibited a J-shaped dose–response curve with the increase of BTA, and their activities were all inhibited at 1.5 mg/L and activated at 5 to 10 mg/L BTA. Unlikely, the activities of POD isozyme showed a U-shaped dose–response curve.

Figure 2.

Responses of SOD (A), POD (B), CAT (C), and NADPH oxidase (D) isozymes in rice leaves exposed to BTA for 14 days.

Alteration in plant height and Chl contents in the leaves

A remarkable decrease trend in plant height was observed with increasing BTA concentrations, and being 8.4%, 16.9%, 25.0%, and 34.6% lower than that of the control, respectively (Figure 3(A)). Chl content exhibited an inverted J-shaped dose–response curve, initially increasing by 6.2% at 1.5 mg/L BTA and dramatically decreasing by 26.7% when the tested BTA increased up to 10 mg/L in comparison to the control (Figure 3(B)).

Figure 3.

Changes in plant height (A) and Chl content (B) in rice leaves exposed to BTA for 14 days. The error bars represent the SD values. The values ±SD reported in (A) and (B) are means of 9 and 3 replicates, respectively. Different letters on bars indicate the significant difference (P < 0.05).

Variation in photosynthetic parameters in the leaves

As seen in Figure 4, Pn, Tr, and Gs differentially presented inverted J-shaped dose–response curves. They were enhanced by 8.7%, 8.1%, and 17.3% at 1.5 mg/L BTA, and declined by 40.8%, 37.3%, and 51.1% at 10 mg/L BTA compared with the control, respectively. Conversely, Ci displayed a J-shaped dose–response curve (Figure 4(D)).

Figure 4.

Changes in Pn (A), Tr (B), Gs (C), and Ci (D) in rice leaves exposed to BTA for 14 days. The error bars represent the SD. The values ±SD reported are means of six replicates. Different letters on bars indicate the significant difference (P < 0.05).

The expression levels of key photosynthesis-associated genes, coupled with protein abundances of RbcL and HSP70 in the leaves

The expression levels of atpA and atpB genes showed inverted U- and J-shaped dose–response curves with increasing BTA, respectively. Both of them were upregulated at 1.5 mg/L BTA, and downregulated at 10 mg/L versus controls (Figure 5(A) and (B)). Likewise, the levels of psaB and psbA were also, respectively, followed by inverted U- and J-shaped curves, being significantly upregulated at 1.5 mg/L BTA in comparison to the controls (Figure 5(C) and (D)).

Figure 5.

Analysis of atpA (A), atpB (B), psaB (C), psbA (D), RbcL (E), and RbcS (F) expression levels by qPCR in rice leaves exposed to BTA for 14 days. The error bars represent the SDs. The values ±SD reported are means of three replicates. Different letters on bars indicate the significant difference (P < 0.05).

The expression level of the RbcL gene showed a J-shaped dose–response curve (Figure 5(E)), which was consistent with the abundance of RbcL protein (Figure 6(A)). Notably, exposure to 1.5 mg/L BTA significantly suppressed RbcL level by approximately 60%, whereas 10 mg/L BTA induced a 7-fold upregulation compared with the control. By contrast, the RbcS gene displayed an inverted J-shaped dose–response curve, showing much lower expression level than the control at 5 to 10 mg/L BTA (Figure 5(F)).

Figure 6.

Western blotting of RbcL (A), HSP70 (B), and β-actin (C) in rice leaves exposed to BTA for 14 days.

Additionally, the abundance of HSP70 protein was apparently enhanced above that of the control due to BTA treatments (Figure 6(B)).

Discussion

BTA-induced oxidative stress

The antioxidant system is crucial for plants' resistance to abiotic stress through ROS scavenging. Antioxidant enzymes are recognized as biomarkers of oxidative damage.³⁴ To date, studies investigating the phytotoxicity of the antioxidant system in plants remain limited. Previous studies have demonstrated that BTA exposure increased CAT activity in rice seedlings, indicating BTA-induced oxidative stress.³⁵ In our study, exposure to BTA at low concentration (1.5 mg/L) led to the reduction of ROS along with a decrease in activities of SOD, POD, CAT, and NADPH oxidase isozymes compared with the control (Figures 1 and 2). The reduction in activities of those isozymes at low concentration (1.5 mg/L) may be associated with the hormetic effects of BTA on rice seedlings. In follow-up studies, additional concentrations below 1.5 mg/L should be tested to verify this phenomenon. By contrast, BTA at high concentration (5 to 10 mg/L) obviously elevated the levels of O₂·⁻, which was accompanied by improving the activities of SOD, CAT, and NADPH oxidase isozymes, confirming the induction of oxidative stress in rice seedlings. Moreover, the dose–response relationships between BTA and the isozymes of antioxidant enzymes were not linear (Figure 2). According to the distinct differences between the controls and BTA treatments, the results suggested that SOD and CAT isozymes could be used as more sensitive biomarkers for risk assessment of BTA pollution.

As reported, oxidative stress induced the generation of abnormal proteins and subsequently triggered the heat shock response.³⁶ Therefore, HSP70 are specifically produced for protecting cells from being damaged by repairing the abnormal proteins.³⁷ This study confirmed that the increasing BTA promoted the generation of HSP70 (Figure 6(B)), implying its participation in the defense and detoxification in the seedlings. The results above indicated that SOD and CAT isozymes, along with HSP70, might be involved in mitigating BTA-induced toxicity.

Effects of BTA on photosynthesis

To our knowledge, the impact of BTA toxicity on photosynthesis is still poorly understood. Chl is the most important photosynthetic pigment participating in light absorption and energy transfer during photosynthesis.³⁸ Stomatal closure prevents plants from assimilating CO₂, directly affecting photosynthesis.³⁹ So, the increase in Gs led to the elevation of Pn. In addition, Pn was identified as a direct indicator for evaluating photosynthetic efficiency.⁴⁰ Our study showed that Chl contents, Pn, and Gs were all increased at 1.5 mg/L BTA and apparently declined at 5 to 10 mg/L in comparison to the control (Figures 3(B), 4(A), and (C)). Therefore, high concentrations of BTA inhibited the growth of rice by diminishing Chl content, Pn, and Gs.

Photosystems are functional units that allow plants to absorb and use light energy for photosynthesis.³⁹ The photosynthetic genes PsaB and PsbA encode chloroplast proteins situated in the reaction center of Photosystem I (PSI) and Photosystem II (PSII), respectively,^41,42 and they are involved in photosynthetic electron transfer.^43,44 The genes atpA and atpB, respectively, coded for α and β subunits located at the catalytic regulatory sites of chloroplast ATP synthase, participating in ATP synthesis.⁴⁵ Also, PSI, PSII, and ATP synthase are indispensable protein complexes on the thylakoid membrane of chloroplasts. In the present study, atpA, atpB, psaB, and psbA genes were upregulated under 1.5 mg/L BTA exposure (Figure 5(A) to (D)), indicating the enhancement of electron transport and ATP synthesis. Whereas, atpB and psbA genes were downregulated by 5 to 10 mg/L BTA, unveiling the inhibition of the photosynthetic efficiency of PSII and ATP synthase activity. Additionally, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is one of the major limiting factors of photosynthesis, which consists of the large subunit (RbcL) and small subunit (RbcS).^26,46 The increased expression levels of RbcL and RbcS genes would facilitate the CO₂ fixation in rice leaves.⁴⁷ Interestingly, in this study, the expression levels of RbcL and RbcS genes exhibited an inverse trend (Figure 5(E) and (F)), showing a reciprocal relationship. This might reveal a compensatory mechanism of BTA in regulating photosynthetic carbon fixation, though further study is required for verification.

Taken together, BTA at low concentration (1.5 mg/L) increased Chl content, Pn, and Gs accompanied by upregulation of atpA, atpB, psaB, and psbA genes, resulting in the improvement of photosynthesis. In contrast, high concentrations of BTA (5 to 10 mg/L) reduced Chl content, Pn, and Gs, as well as the levels of atpB, psbA, and RbcS genes, leading to the impairment of photosynthesis. These findings also revealed that chloroplast function and photosynthetic mechanism in rice seedlings were greatly affected owing to BTA-induced toxicity.

Conclusion

The findings of the present study demonstrated that the effects of BTA on the photosynthesis and antioxidant systems of rice seedlings exhibited a concentration-dependent response. BTA at low concentration (1.5 mg/L) increased Chl content and Pn accompanied by upregulation of atpA, atpB, psaB, and psbA genes, resulting in the improvement of photosynthesis. In contrast, high concentration of BTA (5 to 10 mg/L) triggered excessive generation of O₂·⁻, enhanced the activities of NADPH oxidase, SOD, and CAT isozymes, and reduced Chl content and Pn. Concurrently, such treatments suppressed the expression of atpB, psbA, and RbcS genes. The above unveiled oxidative stress and photosynthetic damage in rice seedlings under high concentration of BTA exposure. Furthermore, the activation of SOD and CAT isozymes, along with HSP70 induction, may contribute to mitigating BTA toxicity.

Footnotes

Acknowledgements

The authors gratefully acknowledge the anonymous reviewers for their valuable comments and constructive suggestions.

ORCID iD

Hong Rong

Consent for publication

All authors have read, approved the manuscript, and provided their consent for publication.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by Hong Rong, Chengrun Wang, Zurong Shi, Qianqian Tong, and Lijuan Zhao. The first draft of the manuscript was written by Hong Rong, Chengrun Wang, Zurong Shi, and Lijuan Zhao, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

The authors declared receipt of the following ﬁnancial support for the research, authorship, and/or publication of this article: This work was supported by the Higher Education Science Research Project of Anhui Province (Grant Nos. 2023AH051538 and 2023AH051534).

Declaration of conflicting interests

The authors declared no potential conﬂicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability

All data generated or analyzed during this study are included in this article.

References

Pal

Kannan

, et al. 1,3-diphenylguanidine, benzothiazole, benzotriazole, and their derivatives in soils collected from northeastern United States. Sci Total Environ 2023; 887: 164110.

Moral

Borrull

Fourton

, et al. Extraction of selected benzothiazoles, benzotriazoles and benzenesulfonamides from environmental water samples using a home-made sol-gel silica-based mixed-mode zwitterionic sorbent modified with graphene. Talanta 2023; 256: 124315.

Deng

, et al. Benzotriazoles and benzothiazoles prevail in indoor dust from an E-waste dismantling area in South China: Elevated concentrations and implication for human exposure. Sci Total Environ 2020; 723: 1–8.

Han

Xie

Tian

, et al. Spatial and seasonal variations of organic corrosion inhibitors in the Pearl River, South China: Contributions of sewage discharge and urban rainfall runoff. Environ Pollut 2020; 262: 114321.

Xing

, et al. Occurrence and distribution of organic ultraviolet absorbents in sediments from small urban rivers, Tianjin, China: Implications for risk management. Ecotox Environ Safe 2022; 230: 113120.

Lai

Ying

, et al. Occurrence and dissipation of benzotriazoles and benzotriazole ultraviolet stabilizers in biosolid-amended soils. Environ Toxicol Chem 2014; 33: 761–767.

Struk-Sokołowska

Gwoździej-Mazur

Jurczyk

, et al. Environmental risk assessment of low molecule benzotriazoles in urban road rainwaters in Poland. Sci Total Environ 2022; 839: 156246.

Kang

Jacob

, et al. Transgenerational effects of benzotriazole on the gene expression, growth, and reproduction of Daphnia magna. Environ Pollut 2023; 323: 121211.

Duan

Xing

Feng

, et al. Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio. Environ Pollut 2017; 224: 706–713.

10.

Liang

Liu

, et al. Estrogenic potential of benzotriazole on marine medaka (Oryzias melastigma). Ecotox Environ Safe 2012; 80: 327–332.

11.

Kim

Shin

, et al. Effect of benzotriazole on oxidative stress response and transcriptional gene expression in Oryzias latipes and Danio rerio embryo. Comp Biochem Physiol Toxicol Pharmacol: CBP 2022; 252: 109222.

12.

Xing

Meng

Wang

, et al. Effects of benzotriazole on copper accumulation and toxicity in earthworm (Eisenia fetida). J Hazard Mater 2018; 351: 330–336.

13.

Zhang

Xing

, et al. Benzotriazole alleviates copper mediated lysosomal membrane damage and antioxidant defense system responses in earthworms (Eisenia fetida). Ecotox Environ Safe 2020; 197: 110618.

14.

Liu

Wang

, et al. Effect of corrosion inhibitor benzotriazole on the uptake and translocation of Cd in rice (Oryza sativa L.) under different exposure conditions. Chemosphere 2017; 186: 24–30.

15.

Liu

Sun

Zhang

, et al. ZmBSK1 positively regulates BR-induced H₂O₂ production via NADPH oxidase and functions in oxidative stress tolerance in maize. Plant Physiol Bioch 2022; 185: 325–335.

16.

Mittler

. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 2002; 7: 405–410.

17.

Marchand

Grebenshchykova

Mench

. Intra-specific variability of the guaiacol peroxidase (GPOD) activity in roots of Phragmites australis exposed to copper excess. Ecol Eng 2016; 90: 57–62.

18.

Salih

Bai

Liang

, et al. ROS Scavenging enzyme-encoding genes play important roles in the desert moss Syntrichia caninervis response to extreme cold and desiccation stresses. Int J Biol Macromol 2024; 254: 127778.

19.

Wang

Rong

Liu

, et al. Detoxification mechanisms, defense responses, and toxicity threshold in the earthworm Eisenia foetida exposed to ciprofloxacin-polluted soils. Sci Total Environ 2018; 612: 442–449.

20.

Gayathri

Mogili

Krishnan

, et al. Physio-biochemical evaluation and in situ localization of reactive oxygen species (ROS) in mulberry genotypes under optimal growth conditions. Acta Physiol Plant 2022; 44: 141.

21.

Kim

. Chloroplast ROS and stress signaling. Plant Commun 2022; 3: 100264.

22.

Challabathula

Analin

Mohanan

, et al. Differential modulation of photosynthesis, ROS and antioxidant enzyme activities in stress-sensitive and -tolerant rice cultivars during salinity and drought upon restriction of COX and AOX pathways of mitochondrial oxidative electron transport. J Plant Physiol 2022; 268: 153583.

23.

Wang

Zhang

, et al. The phytotoxicity of exposure to two polybrominated diphenyl ethers (BDE47 and BDE209) on photosynthesis and the response of the hormone signaling and ROS scavenging system in tobacco leaves. J Hazard Mater 2022; 426: 128012.

24.

Cancilla

Martinez

van Aggelen

. Detection of aircraft deicing/antiicing fluid additives in a perched water monitoring well at an international airport. Environ Sci Technol 1998; 32: 3834–3835.

25.

Park

Kang

Jeon

. Occurrence and concentration of micropollutants in the middle-and down-stream of Nakdong River. J Environ Anal Heal Toxicol 2021; 24: 1–12.

26.

Wang

Rong

Zhang

, et al. Effects and mechanisms of foliar application of silicon and selenium composite soils on diminishing cadmium and lead translocation and affiliated physiological and biochemical responses in hybrid rice (Oryza sativa L.) exposed to cadmium and lead. Chemosphere 2020; 251: 1–10.

27.

Rong

Wang

, et al. Carboxylated multi-walled carbon nanotubes exacerbated oxidative damage in roots of Vicia faba L. Seedlings under combined stress of lead and cadmium. Ecotox Environ Safe 2018; 161: 616–623.

28.

Bradford

. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72: 248–254.

29.

García-Limones

Hervás

Navas-Cortés

, et al. Induction of an antioxidant enzyme system and other oxidative stress markers associated with compatible and incompatible interactions between chickpea (Cicer arietinum L.) and Fusarium oxysporum f. sp. ciceris. Physiol Mol Plant Pathol 2002; 61: 325–337.

30.

Sagi

Fluhr

. Superoxide production by plant homologues of the gp91phox NADPH oxidase. Modulation of activity by calcium and by tobacco mosaic virus infection. Plant Physiol 2001; 126: 1281–1290.

31.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCT method. Methods 2001; 25: 402–408.

32.

Romero-Puertas

Rodriguez-Serrano

Corpas

, et al. Cadmium-induced subcellular accumulation of O₂·⁻and H₂O₂ in pea leaves. Plant Cell Environ 2004; 27: 1122–1134.

33.

Lin

Liu

Lin

, et al. In situ localisation of superoxide generated in leaves of Alocasia macrorrhiza (L.) Shott under various stresses. J Plant Biol 2009; 52: 340–347.

34.

Zulfqar

Ashraf

. Antioxidants as modulators of arsenic-induced oxidative stress tolerance in plants: An overview. J Hazard Mater 2021; 427: 127891.

35.

Ran

Liu

, et al. Combined pollution effects of Cu and benzotriazole in rice (Oryza sativa L.) verified by split-root experiment. Environ Sci Pollut R 2023; 30: 91997–92006.

36.

Singh

Reddy

MMK

Mathur

, et al. Induction of hsp70, hsp60, hsp83 and hsp26 and oxidative stress markers in benzene, toluene and xylene exposed Drosophila melanogaster: Role of ROS generation. Toxicol Appl Pharm 2009; 235: 226–243.

37.

Rehman

Atif

Qayyum

, et al. Genome-wide identification and characterization of HSP70 gene family in four species of cotton. Genomics 2020; 112: 4442–4453.

38.

Chen

, et al. The B-box transcription factor PabBBX27 in the regulation of chlorophyll biosynthesis and photosynthesis in poplar (Populus alba × P. Berolinensis). Ind Crop Prod 2023; 203: 117159.

39.

Wan

Zhang

Liu

, et al. Comparative effects of salt and alkali stress on photosynthesis and antioxidant system in tea plant (Camellia sinensis). Plant Growth Regul 2024; 103: 565–579.

40.

. Photosynthetic responses of Arabidopsis to SO₂ were related to photosynthetic pigments, photosynthesis gene expression and redox regulation. Ecotox Environ Safe 2020; 203: 111019.

41.

Scheller

Jensen

Haldrup

, et al. Role of subunits in eukaryotic photosystem I. Biochim Biophys Acta Bioenerg 2001; 1507: 41–60.

42.

Yang

Feng

Lin

, et al. Comparative effects of sodium hydrosulfide and proline on functional repair in rice chloroplast through the D1 protein and thioredoxin system under simulated thiocyanate pollution. Chemosphere 2021; 284: 131389.

43.

Choquet

Vallon

. Synthesis, assembly and degradation of thylakoid membrane proteins. Biochimie 2000; 82: 615–634.

44.

Wuyun

Chen

, et al. Responses of Trollius chinensis to drought stress and rehydration: From photosynthetic physiology to gene expression. Plant Physiol Bioch 2023; 201: 107841.

45.

Zhang

Wang

, et al. Effects of rare earth and acid rain pollution on plant chloroplast ATP synthase and element contents at different growth stages. Chemosphere 2018; 194: 441–449.

46.

Fernie

Bauwe

. Wasteful, essential, evolutionary stepping stone? The multiple personalities of the photorespiratory pathway. Plant J 2020; 102: 666–677.

47.

Suzuki

Makino

. Availability of rubisco small subunit up-regulates the transcript levels of large subunit for stoichiometric assembly of its holoenzyme in rice. Plant Physiol 2012; 160: 533e540.

Photosynthetic and oxidative stress responses of rice seedlings exposed to benzotriazole

Abstract

Keywords

Introduction

Materials and methods

Plant materials

Protein extraction and protein gel blot analysis

Key isozymes of antioxidant enzymes and NADPH oxidases determination

Quantitative real-time polymerase chain reaction (qPCR)

Nitroblue tetrazolium (NBT) visualization of superoxide anion radicals

Chl content and key photosynthetic parameters determination

Statistical analysis

Results

Changes in O2·− production in the leaves

Changes in SOD, POD, CAT, and APX isozymes in the leaves

Alteration in plant height and Chl contents in the leaves

Variation in photosynthetic parameters in the leaves

The expression levels of key photosynthesis-associated genes, coupled with protein abundances of RbcL and HSP70 in the leaves

Discussion

BTA-induced oxidative stress

Effects of BTA on photosynthesis

Conclusion

Footnotes

Acknowledgements

ORCID iD

Consent for publication

Author contributions

Funding

Declaration of conflicting interests

Data availability

References

Changes in O₂·⁻ production in the leaves