Photosynthetic and oxidative stress responses of rice seedlings exposed to benzotriazole

Plant materials

BTA powder (>99.9% purity) was purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Rice seeds were obtained from Huainan Seed Co., Ltd (China). The seeds were disinfected with a 0.3% sodium hypochlorite solution for 20 min, rinsed thoroughly, and germinated in the tray on the moistened gauze in an incubator at 28 °C. After germination, the young seedlings were transplanted and cultured in nutrient solutions (144.4 mg/L KNO₃, 50.4 mg/L NaH₂PO₄, 94.4 mg/L (NH₄)₂SO₄, 40.5 mg/L MgSO₄·7H₂O, 111.0 mg/L CaCl₂, 1.5 mg/L MnCl₂·4H₂O, 0.074 mg/L (NH₄)₆Mo₇O₂₄, 0.934 mg/L H₃BO₃, 0.035 mg/L ZnSO₄·7H₂O, 0.031 mg/L CuSO₄·5H₂O, 18.6 mg/L Na₂-EDTA, and 13.9 mg/L FeSO₄·7H₂O), and then placed in glasshouse with a temperature ranging from 19 °C to 30 °C and a photoperiod (16 h/8 h). The seedlings at the four-leaf stage were subjected to treatments by adding BTA into the nutrient solutions. The minimum concentration of BTA in various water environments from global areas was reported to be <1 μg/L, and the maximum concentration reached up to 200 mg/L.^4,24,25 Given these environmental concentrations of BTA, the tested concentrations of BTA were set at 0 (control, Ck), 1.5, 2.5, 5, and 10 mg/L. Triplicates were conducted for each concentration. Two weeks after treatments, leaves were collected for tests as below.

Protein extraction and protein gel blot analysis

The crude protein extraction and western blotting analysis were performed according to Wang et al. ²⁶ and Rong et al. ²⁷ with minor modifications. Fresh leaf (0.2 g) was grounded to be fine powder with liquid nitrogen, and then homogenized in 2 mL of extraction buffer (0.1 M Tris–HCl, pH 8.0, 10% (v/v) glycerol, 0.1 mM ethyl-enediaminetetraacetic acid (EDTA), 0.2% (v/v) Triton X-100, 5% (w/v) PVPP, 1 mM phenylmethylsulphonyl fluoride, 1 mM benzamidine, 1 mg/mL leupeptin, and 2 mg/mL apratinin) in cold conditions. The homogenates were centrifuged at 4 °C, 12,000 r/min for 15 min. The supernatants were stored at −80 °C for western blotting and isozyme analysis. Total protein content was determined in accordance with Bradford. ²⁸

For protein gel blot analysis, the extract was mixed with 125 mM Tris–HCl (pH 6.8), 25% (v/v) glycerol, 5% (w/v) sodium dodecyl sulfate, 20% (v/v) 2-mercaptoethanol, and 0.1% (w/v) Bromophenol Blue, and denatured by boiling for 5 min. After cooling, the mixture was centrifuged at 12,000 r/min for 5 min. The total protein was separated on Sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% (m/v) separating gel and 5% (m/v) stacking gel), and then transferred onto polyvinylidene fluoride membrane. The membranes were blocked with 8% (m/v) non-fat milk/Tris-buffered saline with Tween 20 (TBST) buffer for 3 h. Afterwards, they were washed with TBST buffer and followed by incubating with primary antibodies, including rabbit anti-RbcL polyclonal antibody (dilution 1:5000; catalog no. AS03037A; lot no. 1501; Agrisera), mouse anti-70 kDa heat shock proteins (anti-HSP70) monoclonal antibody (dilution 1:2000; catalog no. MA00949; lot no. 23500731D19; clone no. OTI2C12; Boster), and mouse anti-Actin monoclonal antibody (dilution 1:2000; catalog no. M20009; clone no. 26F7; RRID, AB_2936239; Abmart) overnight at 4 °C, respectively. After that, the membranes were transferred to secondary antibody horseradish peroxidase conjugated goat anti-rabbit (dilution 1:5000; catalog no. BA1054; lot no. BST18G21C18I54; Boster) or goat anti-mouse (dilution 1:5000; catalog no. BA1050; lot no. BST18L01A19E50; Boster) IgG at room temperature for 3 h.

Key isozymes of antioxidant enzymes and NADPH oxidases determination

Isozyme patterns were assayed by native polyacrylamide gel electrophoresis. Electrophoresis was run with a constant voltage of 80 V to the separating gel, and thereafter resumed by 120 V to the end using the solution (25 mM Tris, 192 mM glycine solution, pH 8.3) as electrode buffer. SOD, CAT, and POD isozymes were visualized on the basis of García-Limones et al., ²⁹ and NADPH oxidases isozyme was determined by the methods of Sagi and Fluhr. ³⁰

Quantitative real-time polymerase chain reaction (qPCR)

Fresh leaf (0.1 g) was prepared for total RNA extraction, followed by the manufacturer's instructions of an RNAprep pure plant kit (Beijing Tiangen, Inc., China). First-strand complementary DNA (cDNA) was synthesized from 2 μg RNA using RevertAid reverse Transcriptase (Thermo Fisher Scientific Biotech Co., Ltd, China). qPCR was performed with TB Green™ Fast qPCR Mix (TaKaRa, Japan) using StepOnePlus™ Real-Time PCR System (ABI, USA). Ubiquitin (Ubq) was served as the reference gene to normalize the amounts of cDNA among the samples. The amplification procedures included predenaturation at 95 °C for 30 s, followed by 40 cycles (95 °C for 5 s and 60 °C for 35 s) and a final dissociation cycle (95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s). Each experiment was replicated three times. The genes and the corresponding primer sequences used in this study are listed in Table 1.

OPEN IN VIEWER

Table 1.

Primers used in qPCR.

Name	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
atpA	GAGGCTTACTTGGGTCGTGTT	TGCTGTTTTGCCGGTTTG
atpB	TCTTTCGTTTTGTTCAAGCAGG	AATGTTGTAGCAGGAGCAGGGT
psbA	ATCTGTAGTTGATAGCCAAGGTCG	TAGGTCTAGAGGGAAGTTGTGAGC
psaB	GCGGCGGTACTTGTGATATT	CCCTGCCATAATGTGATGTG
RbcL	ACCCCGGAGTACGAAACCAAGG	CTGCTTCTTCGGGCGGAACC
RbcS	GAGGCTCATAAAGGCCCATTT	GAGCATGCCATGACGTTGTT
Ubq	TTCCATGCTGCTCTACCACAG	AGGGTTCACAAGTCTGCCTATT

Differences were calculated using the threshold cycle (Ct) and the comparative Ct methods for relative quantification. The relative expression of the target genes was calculated by the 2^−ΔΔCT method, ³¹ and the results were normalized to Ubq.

Nitroblue tetrazolium (NBT) visualization of superoxide anion radicals

NBT staining method ³² was used to detect the production of superoxide radical (O₂·⁻). Leaf sections were incubated directly in staining solution (0.1% (w/v) NBT, 10 mM sodium azide, and 50 mM Tris–HCl, pH 6.5), and then treated by vacuum filtration for 2 min, repeating four times with an interval of 3 min. After that, leaf sections were placed in the incubator for illumination until dark blue spots appeared, and subsequently destained in 90% (v/v) ethanol by boiling for 20 min.

Chl content and key photosynthetic parameters determination

Fresh leaf (0.2 g) was chilled with liquid nitrogen and ground into a fine powder. The pigments were extracted with 100% (v/v) acetone. After centrifugation at 12,000 r/min for 10 min at 40 °C, the supernatant was taken for absorbance detection at 665 nm and 649 nm, respectively. Chl contents were calculated based on the method of Wang et al. ²⁶

The net photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), and intercellular carbon dioxide concentration (Ci) were measured at 9:00 a.m. to 11:00 a.m., using a handheld photosynthesis system (TPS-2, PP-Systems, USA). External CO₂ concentration was about 380 µL/L, and illumination intensity was set at 1200 µmol/m²/s. Six leaves in vivo were randomly selected for determination in each treatment.

Statistical analysis

Statistical analyses were performed using SPSS 22.0 software. All data were presented as mean ± standard deviation (SD). A one-way analysis of variance followed by least significant difference tests was used to determine the difference between the treatments in the present experiment at a significance level of p < 0.05.

Changes in O₂·⁻ production in the leaves

The reaction of intracellular O₂·⁻ with NBT produced dark blue hydrazone spots, and the density of spots displayed the generation of O₂·⁻. ³³ As illustrated in Figure 1, with increasing concentrations of BTA, O₂·⁻ production exhibited a J-shaped dose–response curve, and 1.5 mg/L BTA significantly decreased the level of O₂·⁻, while 5 or 10 mg/L BTA stimulated the production of O₂·⁻ with an obvious increase compared to the control.

OPEN IN VIEWER

Figure 1.

NBT visualized O₂·⁻ production in rice leaves exposed to concentrations of BTA for 14 days. 0 (Ck), 1.5, 2.5, 5, and 10 mg/L denote the treatment concentrations of BTA added in solutions. The same below.

Changes in SOD, POD, CAT, and APX isozymes in the leaves

The electrophoresis gel band intensities (denoting enzyme activities) indicated the total activities of isozymes. As shown in Figure 2, the activities of SOD, CAT, or NADPH oxidase isozymes exhibited a J-shaped dose–response curve with the increase of BTA, and their activities were all inhibited at 1.5 mg/L and activated at 5 to 10 mg/L BTA. Unlikely, the activities of POD isozyme showed a U-shaped dose–response curve.

OPEN IN VIEWER

Figure 2.

Responses of SOD (A), POD (B), CAT (C), and NADPH oxidase (D) isozymes in rice leaves exposed to BTA for 14 days.

Alteration in plant height and Chl contents in the leaves

A remarkable decrease trend in plant height was observed with increasing BTA concentrations, and being 8.4%, 16.9%, 25.0%, and 34.6% lower than that of the control, respectively (Figure 3(A)). Chl content exhibited an inverted J-shaped dose–response curve, initially increasing by 6.2% at 1.5 mg/L BTA and dramatically decreasing by 26.7% when the tested BTA increased up to 10 mg/L in comparison to the control (Figure 3(B)).

OPEN IN VIEWER

Figure 3.

Changes in plant height (A) and Chl content (B) in rice leaves exposed to BTA for 14 days. The error bars represent the SD values. The values ±SD reported in (A) and (B) are means of 9 and 3 replicates, respectively. Different letters on bars indicate the significant difference (P < 0.05).

Variation in photosynthetic parameters in the leaves

As seen in Figure 4, Pn, Tr, and Gs differentially presented inverted J-shaped dose–response curves. They were enhanced by 8.7%, 8.1%, and 17.3% at 1.5 mg/L BTA, and declined by 40.8%, 37.3%, and 51.1% at 10 mg/L BTA compared with the control, respectively. Conversely, Ci displayed a J-shaped dose–response curve (Figure 4(D)).

OPEN IN VIEWER

Figure 4.

Changes in Pn (A), Tr (B), Gs (C), and Ci (D) in rice leaves exposed to BTA for 14 days. The error bars represent the SD. The values ±SD reported are means of six replicates. Different letters on bars indicate the significant difference (P < 0.05).

The expression levels of key photosynthesis-associated genes, coupled with protein abundances of RbcL and HSP70 in the leaves

The expression levels of atpA and atpB genes showed inverted U- and J-shaped dose–response curves with increasing BTA, respectively. Both of them were upregulated at 1.5 mg/L BTA, and downregulated at 10 mg/L versus controls (Figure 5(A) and (B)). Likewise, the levels of psaB and psbA were also, respectively, followed by inverted U- and J-shaped curves, being significantly upregulated at 1.5 mg/L BTA in comparison to the controls (Figure 5(C) and (D)).

OPEN IN VIEWER

Figure 5.

Analysis of atpA (A), atpB (B), psaB (C), psbA (D), RbcL (E), and RbcS (F) expression levels by qPCR in rice leaves exposed to BTA for 14 days. The error bars represent the SDs. The values ±SD reported are means of three replicates. Different letters on bars indicate the significant difference (P < 0.05).

The expression level of the RbcL gene showed a J-shaped dose–response curve (Figure 5(E)), which was consistent with the abundance of RbcL protein (Figure 6(A)). Notably, exposure to 1.5 mg/L BTA significantly suppressed RbcL level by approximately 60%, whereas 10 mg/L BTA induced a 7-fold upregulation compared with the control. By contrast, the RbcS gene displayed an inverted J-shaped dose–response curve, showing much lower expression level than the control at 5 to 10 mg/L BTA (Figure 5(F)).

OPEN IN VIEWER

Figure 6.

Western blotting of RbcL (A), HSP70 (B), and β-actin (C) in rice leaves exposed to BTA for 14 days.

Additionally, the abundance of HSP70 protein was apparently enhanced above that of the control due to BTA treatments (Figure 6(B)).

BTA-induced oxidative stress

The antioxidant system is crucial for plants' resistance to abiotic stress through ROS scavenging. Antioxidant enzymes are recognized as biomarkers of oxidative damage. ³⁴ To date, studies investigating the phytotoxicity of the antioxidant system in plants remain limited. Previous studies have demonstrated that BTA exposure increased CAT activity in rice seedlings, indicating BTA-induced oxidative stress. ³⁵ In our study, exposure to BTA at low concentration (1.5 mg/L) led to the reduction of ROS along with a decrease in activities of SOD, POD, CAT, and NADPH oxidase isozymes compared with the control (Figures 1 and 2). The reduction in activities of those isozymes at low concentration (1.5 mg/L) may be associated with the hormetic effects of BTA on rice seedlings. In follow-up studies, additional concentrations below 1.5 mg/L should be tested to verify this phenomenon. By contrast, BTA at high concentration (5 to 10 mg/L) obviously elevated the levels of O₂·⁻, which was accompanied by improving the activities of SOD, CAT, and NADPH oxidase isozymes, confirming the induction of oxidative stress in rice seedlings. Moreover, the dose–response relationships between BTA and the isozymes of antioxidant enzymes were not linear (Figure 2). According to the distinct differences between the controls and BTA treatments, the results suggested that SOD and CAT isozymes could be used as more sensitive biomarkers for risk assessment of BTA pollution.

As reported, oxidative stress induced the generation of abnormal proteins and subsequently triggered the heat shock response. ³⁶ Therefore, HSP70 are specifically produced for protecting cells from being damaged by repairing the abnormal proteins. ³⁷ This study confirmed that the increasing BTA promoted the generation of HSP70 (Figure 6(B)), implying its participation in the defense and detoxification in the seedlings. The results above indicated that SOD and CAT isozymes, along with HSP70, might be involved in mitigating BTA-induced toxicity.

Effects of BTA on photosynthesis

To our knowledge, the impact of BTA toxicity on photosynthesis is still poorly understood. Chl is the most important photosynthetic pigment participating in light absorption and energy transfer during photosynthesis. ³⁸ Stomatal closure prevents plants from assimilating CO₂, directly affecting photosynthesis. ³⁹ So, the increase in Gs led to the elevation of Pn. In addition, Pn was identified as a direct indicator for evaluating photosynthetic efficiency. ⁴⁰ Our study showed that Chl contents, Pn, and Gs were all increased at 1.5 mg/L BTA and apparently declined at 5 to 10 mg/L in comparison to the control (Figures 3(B), 4(A), and (C)). Therefore, high concentrations of BTA inhibited the growth of rice by diminishing Chl content, Pn, and Gs.

Photosystems are functional units that allow plants to absorb and use light energy for photosynthesis. ³⁹ The photosynthetic genes PsaB and PsbA encode chloroplast proteins situated in the reaction center of Photosystem I (PSI) and Photosystem II (PSII), respectively,^41,42 and they are involved in photosynthetic electron transfer.^43,44 The genes atpA and atpB, respectively, coded for α and β subunits located at the catalytic regulatory sites of chloroplast ATP synthase, participating in ATP synthesis. ⁴⁵ Also, PSI, PSII, and ATP synthase are indispensable protein complexes on the thylakoid membrane of chloroplasts. In the present study, atpA, atpB, psaB, and psbA genes were upregulated under 1.5 mg/L BTA exposure (Figure 5(A) to (D)), indicating the enhancement of electron transport and ATP synthesis. Whereas, atpB and psbA genes were downregulated by 5 to 10 mg/L BTA, unveiling the inhibition of the photosynthetic efficiency of PSII and ATP synthase activity. Additionally, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is one of the major limiting factors of photosynthesis, which consists of the large subunit (RbcL) and small subunit (RbcS).^26,46 The increased expression levels of RbcL and RbcS genes would facilitate the CO₂ fixation in rice leaves. ⁴⁷ Interestingly, in this study, the expression levels of RbcL and RbcS genes exhibited an inverse trend (Figure 5(E) and (F)), showing a reciprocal relationship. This might reveal a compensatory mechanism of BTA in regulating photosynthetic carbon fixation, though further study is required for verification.

Taken together, BTA at low concentration (1.5 mg/L) increased Chl content, Pn, and Gs accompanied by upregulation of atpA, atpB, psaB, and psbA genes, resulting in the improvement of photosynthesis. In contrast, high concentrations of BTA (5 to 10 mg/L) reduced Chl content, Pn, and Gs, as well as the levels of atpB, psbA, and RbcS genes, leading to the impairment of photosynthesis. These findings also revealed that chloroplast function and photosynthetic mechanism in rice seedlings were greatly affected owing to BTA-induced toxicity.